- Email: [email protected]
A novel germline TP53 mutation p.Pro190Arg detected in a patient with lung and bilateral breast cancers
Advances in Medical Sciences 62 (2017) 207–210
Contents lists available at ScienceDirect
Advances in Medical Sciences journal homepage: www.elsevier.com/locate/advms
Original research article
A novel germline TP53 mutation p.Pro190Arg detected in a patient with lung and bilateral breast cancers Małgorzata Krzesniaka,1, Dorota Butkiewicza,1, Jadwiga Rachtanb , Iwona Matuszczyka , Ewa Grzybowskaa , Marek Rusina,* a Center for Translational Research and Molecular Biology of Cancer, Maria Skłodowska–Curie Memorial Cancer Center and Institute of Oncology, Gliwice Branch, 44-101 Gliwice, Poland b Epidemiology Department, Maria Skłodowska–Curie Memorial Cancer Center and Institute of Oncology, Kraków Branch, ul. Garncarska 11, 31-115 Cracow, Poland
A R T I C L E I N F O
A B S T R A C T
Article history: Received 14 June 2016 Accepted 21 December 2016 Available online xxx
Purpose: Li-Fraumeni syndrome (LFS) is a rare genetic disease with strong predispositions to multiple early-onset neoplasms, mostly sarcomas, breast cancers, brain tumors and adrenocortical carcinomas (LFS core cancers). In most LFS families the germline mutations of TP53 tumor suppressor gene were found. Lung cancer does not belong to the core cancers of LFS, however its higher incidence is observed in families with TP53 mutations. Our aim was to search for TP53 mutations in female lung cancer patients whose clinico-demographic characteristics suggested a probable genetic predisposition to the disease. Materials and methods: The coding region of TP53 from blood DNA was sequenced using Sanger method. The functioning of detected mutation was tested by luciferase reporter assay. Results: We found a nucleotide substitution c.569C > G, p.Pro190Arg, which was not described in the TP53 germline mutation database (http://p53.iarc.fr/TP53GermlineMutations.aspx). The mutation destroys the ability of p53 to transactivate BAX promoter and significantly reduces transactivation potential of p53 toward the promoter of MDM2 gen. Conclusion: We identified novel germline mutation of TP53. © 2017 Medical University of Bialystok. Published by Elsevier B.V. All rights reserved.
Keywords: TP53 germline mutation Lung cancer Bilateral breast cancer Familial cancer
1. Introduction The p53 tumor suppressor protein is a transcription factor regulating different groups of genes including regulators of apoptosis, e.g. BAX [1,2]. The high frequency of TP53 somatic mutations in various human cancers was well documented more than 20 years ago [2]. These mutations occur predominantly in exons 5–8, coding for DNA binding domain of p53. The structure of this domain is relatively unstable and amino acid substitutions in many locations are able to misfold the protein, which looses the ability to regulate its target genes [2]. TP53 was also found to be mutated in the germline of individuals from Li-Fraumeni families [3]. This rare, familial cancer syndrome is characterized by high predisposition to sarcomas and cancers of adrenal cortex, breast
and brain [4]. Up to this time, more than 500 families were found to harbor germline mutations in TP53. This huge collection of data helped to draw some conclusions concerning the relationship between the nature of TP53 mutations and the types of cancer found in the afflicted families [4,5]. Lung cancer is a major cause of cancer mortality around the world. Cigarette smoking is a main risk factor of lung cancer in both men and women, however the epidemiological data suggest that genetic host factors also play a role in its etiology [6]. Our goal was to search for germline TP53 mutations in female lung cancer cases whose clinico-demographic characteristics suggested a probable genetic predisposition to cancer. 2. Materials and methods 2.1. Patients
* Corresponding author at: Center for Translational Research and Molecular Biology of Cancer, Maria Skłodowska–Curie Memorial Cancer Center and Institute of _ Armii Krajowej 15, 44-101 Gliwice, Poland. Oncology, Gliwice Branch, ul. Wybrzeze E-mail address: [email protected] (M. Rusin). 1 These authors contributed equally to this work.
To search for TP53 germline mutations, 41 women were selected out of the group of 170 female, Caucasian lung cancer cases from Upper Silesia region in Southern Poland. The inclusion criteria for the TP53 analysis were: at least one first-degree relative
http://dx.doi.org/10.1016/j.advms.2016.12.002 1896-1126/© 2017 Medical University of Bialystok. Published by Elsevier B.V. All rights reserved.
208
M. Krzesniak et al. / Advances in Medical Sciences 62 (2017) 207–210
with cancer or relatively young age (below 45 years) at diagnosis, or multiple primary cancers, or being a never smoker. Informed consent was obtained from all individual participants included in the study and the complete, standardized questionnaires were collected by trained interviewers. The local ethics committee approved the study. 2.2. Sequencing of TP53 DNA samples were isolated using Genomic Maxi AX kit (A&A Biotechnology, Gdynia, Poland) from blood samples collected on EDTA. The coding exons of TP53 were amplified by PCR with the following primers (BioTez Berlin-Buch GmbH, Germany): exons 2– 3 50 GTGAAAAGAGCAGTCAGAGG30 , 50 GGTGAAACATTGGAAGAGAG30 , exon 4 50 TGAGGACCTGGTCCTCTGAC30 , 50 GAAGAGGAATCCCAAAGTTCCA30 , exons 5–6 50 GTTGCAGGAGGTGCTTACA30 , 50 GAGGTCAAATAAGCAGCAGG30 , exons 7–8 50 GAGCGAGATTCCATCTCAA30 , 50 CAGTGCTAGGAAAGAGGCAA30 , exon 9 50 TTGGGAGTAGATGGAGCCT30 , 50 AGTGTTAGACTGGAAACTTT30 , exons 10–11 50 GAACCATCTTTTAACTCAGG30 , 0 0 5 CTATTGCAAGCAAGGGTTC3 . After amplification, the PCR products were prepared for sequencing by digestion with exonuclease I and shrimp alkaline phosphatase. PCR products were sequenced using Big Dye Terminator Cycle Sequencing kit (Applied Biosystems). The sequences were acquired by ABI Prism 377 Genetic Analyzer (Applied Biosystems). The following primers were used for sequencing: exons 2–3 50 GTGAAGCAGCCATTCTTTTC30 , exon 4 50 ATACGGCCAGGCATTGAAGT30 , exons 5–6 50 GTTTCTTTGCTGCCGTGTTC30 , exons 7–8 50 CTGCTTGCCACAGGTCTCC30 , exon 9 50 TTCCTTACTGCCTCTTGCTT30 , exons 10–11 50 AATCCTATGGCTTTCCAACC30 , 50 TGGAGAAACCCCATCTCTAC30 . 2.3. Functional assay The expression vectors coding for wild-type (pC53-SN3) and mutant (pC53-SCX3, p.Val143Ala) TP53 sequences were kindly provided by Bert Vogelstein and Kenneth W. Kinzler (Johns Hopkins University and Howard Hughes Medical Institute [7]). The pGL3-BAX-luc plasmid coding for firefly luciferase under transcriptional control of human BAX gene promoter fragment was provided by Perwez Hussain and Curtis C. Harris from Laboratory of Human Carcinogenesis, NCI, NIH, Bethesda, USA. The mutation in the codon 190 was introduced to the wild-type TP53 plasmid (pC53-SN3) using QuickChange XL Site-Directed Mutagenesis kit (Stratagene). The following primers were used to introduce codon 190 mutation: 50 GATAGCGATGGTCTGGCCCGTCCTCAGCATCTTATCCG30 (sense primer), 50 CGGATAAGATGCTGAGGACGGGCCAGACCATCGCTATC30 (antisense primer, mutant positions are underlined). The coding region of the plasmid was sequenced to confirm successful mutagenesis and exclude collateral mutations. The cell lines U-2 OS and NCI-H1299 (ATCC) were grown at 37 C/5% CO2 in Dulbecco's modified Eagle's medium (DMEM, Sigma–Aldrich, St. Louis, MI) supplemented with 10% fetal bovine serum (Gibco-Invitrogen, Carlsbad, CA) and penicillin–streptomycin solution (Sigma–Aldrich). Plasmid DNA samples were prepared using QIAprep Miniprep kit (Qiagen). The transfections of plasmid DNA to the cells in culture were performed using FuGene6 reagent according to manufacturer's protocol (Roche Applied Science). The expression of p53 proteins from the plasmids was evaluated by Western blotting performed on whole cell lysates prepared with IP buffer as
described [8]. The expression of p53 was detected using DO-1 antibody from Santa Cruz Biotechnology (Dallas, TX, USA). The luciferase reporter assay system (Promega) was employed for functional test of TP53 mutation. The cells on 12-well plates were seeded a day before transfection. They were transfected with the following plasmid combinations (weight ratio 1:1): pC53SN3 + pGL3-BAX-luc, pC53-SCX3 + pGL3-BAX-luc, pC53190 + pGL3-BAX-luc, pCI-neo (empty vector) + pGL3-BAX-luc. Alternatively, we have substituted pGL3-BAX-luc reporter vector with the plasmid containing MDM2 promoter, which is also regulated by p53 [9]. We described the construction of the MDM2 plasmid in our recent paper [10]. After 24 h the cells were lysed and the firefly luciferase activity was measured. 3. Results The sequencing of TP53 exons 2–11 among 41 cases selected for the analysis (Table 1), revealed C to G substitution in exon 6, codon 190 (c.569C > G, p.Pro190Arg, CCT > CGT) in one patient diagnosed at age 52 with bronchioalveolar adenocarcinoma of the lung (Fig. 1b). The mutation was confirmed in DNA isolated from independent blood draw and by sequencing of the PCR product with antisence primer (50 TCAGGCGGCTCATAGGGCA30 ) designed specifically for this purpose. The patient was a former smoker (20 cigarettes/day for 10 years) and had the history of multiple primary cancers. The interview and medical records showed that she had lumpectomy of the left breast at age 30. The pathological examination detected fibroadenoma and malignant mesenchymoma. Three years later, at age 33, the patient underwent mastectomy of the left breast due to carcinoma infiltrans. She had lumpectomy of a benign tumor of the right breast at age 36 followed by mastectomy at age 49. The pathological diagnosis was carcinoma ductale infiltrans. The interview revealed several cancer cases in the family. The pedigree of the patient based on the data provided during the interview is shown in Fig. 1a. The mother of the proband was diagnosed with breast cancer at age 41 and died at age 42. The proband's son was diagnosed and died with brain tumor at the age of 17 months. The father of the proband was diagnosed with liver cancer at age 63. The mutation detected in the proband (c.569C > G, p.Pro190Arg) was reported as a somatic alteration in colorectal, esophageal and ovarian cancers (see Discussion). However, it was not reported in the latest release (R18) of International Agency for Research on Cancer (IARC) database of germline TP53 mutations (http://p53.
Table 1 Characteristics of the patients (N = 41) selected for TP53 sequencing. N (%) Age at diagnosis, mean SD 45 years >45 years Histological type Non-small cell ca. Small cell ca. Smoking Ever smokers Never smokers Smoking dose (ever smokers only) 30 pack-years >30 pack-years Number of the first-degree relatives with cancer None One More than one Other primary cancer diagnosed Yes No
52.6 9.6 10 (24) 31 (76) 28 (68) 13 (32) 38 (93) 3 (7) 25 (66) 13 (34) 2 (5) 26 (63) 13 (32) 11 (27) 30 (73)
M. Krzesniak et al. / Advances in Medical Sciences 62 (2017) 207–210
209
Fig. 1. (a) The pedigree of the proband (arrow) harboring TP53 mutation. The numbers indicate the age at diagnosis. Cancers running in the family are denoted as: BrCa – breast cancer, LuCa – lung cancer, BTu – brain tumor, HepCa – liver cancer. (b) The electropherogram showing c.569C > G mutation resulting in p.Pro190Arg substitution in the proband (upper panel) and wild-type sequence (lower panel). The arrow indicates the mutated nucleotide. The reading frame is marked on the lower panel.
iarc.fr/TP53GermlineMutations.aspx [11]). Thus, to the best of our knowledge this is the first report of this mutation in the germ line. There was a possibility that p.Pro190Arg substitution was a rare variant of TP53 or that this mutation only slightly destroys the functioning of p53 molecule. Hence, we performed a functional test based on the ability of wild-type p53 protein to activate the promoters of target genes. The Western blot demonstrated that the
plasmids coding for the various versions of p53, transfected into p53-negative NCI-H1299 cells, produced similar levels of p53 (Fig. 2a). The lower, faint band on the image most likely represents p53 isoform translated from a start codon downstream from the major translation start. Subsequently, the p53-positive (U-2 OS) or the p53-negative (NCI-H1299) cells were co-transfected with the reporter vector coding for the firefly luciferase under the
Fig. 2. (a) The Western blot showing expression of the p53 protein in NCI-H1299 cells transfected with the p53 expression vectors. NCI-H1299 cells do not express the endogenous p53 (last lane). (b) The functional test of the mutant version of TP53 (p.Pro190Arg). The relative firefly luciferase activity in NCI-H1299 or in U-2 OS cells transfected with reporter vector (pGL3-BAX-luc) and with expression vectors coding for wild-type and mutant proteins shown in (a). The means and standard deviations (in logarythmic scale) from two independent experiments performed in triplicate are shown. The luciferase activity in cells transfected with wild-type p53 expression vector was set as 1. (c) The functional tests of the mutants performed as in “b” using pGL3-MDM2-luc reporter vector in NCI-H1299 cells (the data from three independent experiments performed in triplicate).
210
M. Krzesniak et al. / Advances in Medical Sciences 62 (2017) 207–210
transcriptional control of p53-responsive BAX promoter [1] and with the expression vectors coding for either: wild-type p53, its well-characterized mutant (p.Val143Ala) or with the tested version detected in the proband (p.Pro190Arg). The empty vector served as another negative control. Expectedly, when compared with the empty expression vector, co-transfection of BAXluciferase construct with wild-type p53 plasmid increased the luciferase activity by a factor of 15–100 depending on the cell line (Fig. 2b). Both p53 mutants (p.Val143Ala and p.Pro190Arg) did not transactivate the BAX promoter in this assay. In U-2 OS cells, which have wild-type p53, we observe the upregulation of BAX promoter because to the activity of endogenous p53 (and the activity of BAX promoter) we add the activity of p53 expressed from the transfected plasmid. Hence, we observed the upregulation of BAX promoter from baseline activity to the activity increased approximately 100-fold (from 0.009 to 1). In light of the results published by Kato et al. [12] showing that the p.Pro190Arg mutant only partially looses the transactivation properties (in yeast assay), we have carried out the luciferase test with the MDM2 promoter as a p53 target. MDM2 promoter is more sensitive that BAX promoter to transactivation properties of p53 [10]. We have performed this test only in p53-negative NCH-H1299 cell line. We have found that the p.Val143Ala mutant lost completely the transactivation properties because its influence on MDM2 promotor did not differ from the empty expression vector (Fig. 2c). One the other hand, our p.Pro190Arg mutant retained 9.7% transactivation properties of the wild-type sequence (Fig. 2c). Thus, the loss of transactivation potential of p.Pro190Arg mutant is substantial but not complete, what is consistent with the results, which Kato et al. [12] obtained using their yeast test for p53 mutants.
Because proband's mother developed breast cancer at early age (41 years), we suspect that she passed the mutation to her daughter. The proband's son was diagnosed with brain tumor at a very young age, therefore one may suppose that the mutant TP53 was the major contributor to his tumor. Unfortunately, neither DNA from the proband's late mother nor DNA from her deceased son were available for the molecular analysis. However, the functional data on novel mutation reported in this work are a valuable contribution to the study of genotype-phenotype relationship between the TP53 alterations and the pattern of cancers in the cancer-prone families. 5. Conclusions We conclude that the nucleotide substitution c.569C > G causing p.Pro190Arg amino acid substitution is a mutation that impairs the ability of p53 to act as a transcription factor. Thus, we detected unidentified earlier germline mutation of TP53 in the proband with adenocarcinoma of the lung and bilateral breast cancer. Conflict of interests All authors declare no conflict of interest. Financial disclosure This work was supported by grants from: Polish State Committee for Scientific Research, grant No. PBZ-KBN 090/P05/ 13 to JR and National Science Center, Poland, grant No. 2013/11/B/ NZ5/03190 to MR.
4. Discussion The germline mutations of TP53 are found in substantial percentage of families with Li-Fraumeni and Li-Fraumeni-like syndromes [5]. Here we report the novel germline mutation of TP53 (c.569C > G, p.Pro190Arg, codon 190:CCT > CGT) in a cancer-prone family. The pattern of cancers in this family does not fit the classical Li-Fraumeni syndrome due to the lack of sarcoma in the pedigree, but is consistent with Li-Fraumeni-like syndrome [4]. The analysis of pedigree reveals that the family fulfills the 2009 Chompret criteria for TP53 germline mutation screening [13] hence a finding of the mutation in this proband was not surprising. The mutation is not localized in the mutational hot-spot and is very rare in somatic mutation database (IARC) reported only in colorectal, esophageal and ovarian cancer patients [11]. In principle, this nucleotide substitution could be a rare variant of TP53 without any major impact on functioning of the protein. The luciferase assay performed in this study showed that this amino acid substitution destroys the ability of p53 to transactivate p53-dependent promoter of BAX and significantly (to approximately 10% of wildtype) reduces capacity of p53 to transactivate promoter of another p53 target - MDM2. Our results are consistent with the functional data reported by Kato et al. [12], who, using yeast-based functional assay, demonstrated that p53 protein with p.Pro190Arg substitution partially lost transactivation properties (to approximately 30% of wild-type sequence) toward promoters of analyzed genes, e.g. CDKN1A, MDM2, BAX (the details in IARC database [11]). One must keep in mind that the p.Pro190Arg mutant was tested by Kato et al. [12] only in yeast cells, while our experiments were performed in human cells, so it cannot be expected that the two systems would yield exactly the same results.
References [1] Miyashita T, Reed JC. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 1995;80:293–9. [2] Leroy B, Anderson M, Soussi T. TP53 mutations in human cancer: database reassessment and prospects for the next decade. Hum Mutat 2014;35:672–88. [3] Malkin D, Li FP, Strong LC, Fraumeni Jr. JF, Nelson CE, Kim DH, et al. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 1990;250:1233–8. [4] Malkin D. Li-fraumeni syndrome. Genes Cancer 2011;2:475–84. [5] Kamihara J, Rana HQ, Garber JE. Germline TP53 mutations and the changing landscape of Li-Fraumeni syndrome. Hum Mutat 2014;35:654–62. [6] Rachtan J, Sokołowski A, Niepsuj S, Zemła B, Zwierko M. Familial lung cancer risk among women in Poland. Lung Cancer 2009;65:138–43. [7] Baker SJ, Markowitz S, Fearon ER, Willson JK, Vogelstein B. Suppression of human colorectal carcinoma cell growth by wild-type p53. Science 1990;249:912–5. [8] Krzesniak M, Zajkowicz A, Matuszczyk I, Rusin M. Rapamycin prevents strong phosphorylation of p53 on serine 46 and attenuates activation of the p53 pathway in A549 lung cancer cells exposed to actinomycin D. Mech Ageing Dev 2014;139:11–21. [9] Zauberman A, Flusberg D, Haupt Y, Barak Y, Oren M. A functional p53responsive intronic promoter is contained within the human mdm2 gene. Nucleic Acids Res 1995;23:2584–92. ski R, Rusin M. [10] Zajkowicz A, Butkiewicz D, Drosik A, Giglok M, Suwin Truncating mutations of PPM1D are found in blood DNA samples of lung cancer patients. Br J Cancer 2015;112:1114–20. [11] Petitjean A, Mathe E, Kato S, Ishioka C, Tavtigian SV, Hainaut P, et al. Impact of mutant p53 functional properties on TP53 mutation patterns and tumor phenotype: lessons from recent developments in the IARC TP53 database. Hum Mutat 2007;28:622–9. [12] Kato S, Han SY, Liu W, Otsuka K, Shibata H, Kanamaru R, et al. Understanding the function-structure and function-mutation relationships of p53 tumor suppressor protein by high-resolution missense mutation analysis. Proc Natl Acad Sci U S A 2003;100:8424–9. [13] Tinat J, Bougeard G, Baert-Desurmont S, Vasseur S, Martin C, Bouvignies E, et al. 2009 version of the Chompret criteria for Li Fraumeni syndrome. J Clin Oncol 2009;27:e108–9.
Contents lists available at ScienceDirect
Advances in Medical Sciences journal homepage: www.elsevier.com/locate/advms
Original research article
A novel germline TP53 mutation p.Pro190Arg detected in a patient with lung and bilateral breast cancers Małgorzata Krzesniaka,1, Dorota Butkiewicza,1, Jadwiga Rachtanb , Iwona Matuszczyka , Ewa Grzybowskaa , Marek Rusina,* a Center for Translational Research and Molecular Biology of Cancer, Maria Skłodowska–Curie Memorial Cancer Center and Institute of Oncology, Gliwice Branch, 44-101 Gliwice, Poland b Epidemiology Department, Maria Skłodowska–Curie Memorial Cancer Center and Institute of Oncology, Kraków Branch, ul. Garncarska 11, 31-115 Cracow, Poland
A R T I C L E I N F O
A B S T R A C T
Article history: Received 14 June 2016 Accepted 21 December 2016 Available online xxx
Purpose: Li-Fraumeni syndrome (LFS) is a rare genetic disease with strong predispositions to multiple early-onset neoplasms, mostly sarcomas, breast cancers, brain tumors and adrenocortical carcinomas (LFS core cancers). In most LFS families the germline mutations of TP53 tumor suppressor gene were found. Lung cancer does not belong to the core cancers of LFS, however its higher incidence is observed in families with TP53 mutations. Our aim was to search for TP53 mutations in female lung cancer patients whose clinico-demographic characteristics suggested a probable genetic predisposition to the disease. Materials and methods: The coding region of TP53 from blood DNA was sequenced using Sanger method. The functioning of detected mutation was tested by luciferase reporter assay. Results: We found a nucleotide substitution c.569C > G, p.Pro190Arg, which was not described in the TP53 germline mutation database (http://p53.iarc.fr/TP53GermlineMutations.aspx). The mutation destroys the ability of p53 to transactivate BAX promoter and significantly reduces transactivation potential of p53 toward the promoter of MDM2 gen. Conclusion: We identified novel germline mutation of TP53. © 2017 Medical University of Bialystok. Published by Elsevier B.V. All rights reserved.
Keywords: TP53 germline mutation Lung cancer Bilateral breast cancer Familial cancer
1. Introduction The p53 tumor suppressor protein is a transcription factor regulating different groups of genes including regulators of apoptosis, e.g. BAX [1,2]. The high frequency of TP53 somatic mutations in various human cancers was well documented more than 20 years ago [2]. These mutations occur predominantly in exons 5–8, coding for DNA binding domain of p53. The structure of this domain is relatively unstable and amino acid substitutions in many locations are able to misfold the protein, which looses the ability to regulate its target genes [2]. TP53 was also found to be mutated in the germline of individuals from Li-Fraumeni families [3]. This rare, familial cancer syndrome is characterized by high predisposition to sarcomas and cancers of adrenal cortex, breast
and brain [4]. Up to this time, more than 500 families were found to harbor germline mutations in TP53. This huge collection of data helped to draw some conclusions concerning the relationship between the nature of TP53 mutations and the types of cancer found in the afflicted families [4,5]. Lung cancer is a major cause of cancer mortality around the world. Cigarette smoking is a main risk factor of lung cancer in both men and women, however the epidemiological data suggest that genetic host factors also play a role in its etiology [6]. Our goal was to search for germline TP53 mutations in female lung cancer cases whose clinico-demographic characteristics suggested a probable genetic predisposition to cancer. 2. Materials and methods 2.1. Patients
* Corresponding author at: Center for Translational Research and Molecular Biology of Cancer, Maria Skłodowska–Curie Memorial Cancer Center and Institute of _ Armii Krajowej 15, 44-101 Gliwice, Poland. Oncology, Gliwice Branch, ul. Wybrzeze E-mail address: [email protected] (M. Rusin). 1 These authors contributed equally to this work.
To search for TP53 germline mutations, 41 women were selected out of the group of 170 female, Caucasian lung cancer cases from Upper Silesia region in Southern Poland. The inclusion criteria for the TP53 analysis were: at least one first-degree relative
http://dx.doi.org/10.1016/j.advms.2016.12.002 1896-1126/© 2017 Medical University of Bialystok. Published by Elsevier B.V. All rights reserved.
208
M. Krzesniak et al. / Advances in Medical Sciences 62 (2017) 207–210
with cancer or relatively young age (below 45 years) at diagnosis, or multiple primary cancers, or being a never smoker. Informed consent was obtained from all individual participants included in the study and the complete, standardized questionnaires were collected by trained interviewers. The local ethics committee approved the study. 2.2. Sequencing of TP53 DNA samples were isolated using Genomic Maxi AX kit (A&A Biotechnology, Gdynia, Poland) from blood samples collected on EDTA. The coding exons of TP53 were amplified by PCR with the following primers (BioTez Berlin-Buch GmbH, Germany): exons 2– 3 50 GTGAAAAGAGCAGTCAGAGG30 , 50 GGTGAAACATTGGAAGAGAG30 , exon 4 50 TGAGGACCTGGTCCTCTGAC30 , 50 GAAGAGGAATCCCAAAGTTCCA30 , exons 5–6 50 GTTGCAGGAGGTGCTTACA30 , 50 GAGGTCAAATAAGCAGCAGG30 , exons 7–8 50 GAGCGAGATTCCATCTCAA30 , 50 CAGTGCTAGGAAAGAGGCAA30 , exon 9 50 TTGGGAGTAGATGGAGCCT30 , 50 AGTGTTAGACTGGAAACTTT30 , exons 10–11 50 GAACCATCTTTTAACTCAGG30 , 0 0 5 CTATTGCAAGCAAGGGTTC3 . After amplification, the PCR products were prepared for sequencing by digestion with exonuclease I and shrimp alkaline phosphatase. PCR products were sequenced using Big Dye Terminator Cycle Sequencing kit (Applied Biosystems). The sequences were acquired by ABI Prism 377 Genetic Analyzer (Applied Biosystems). The following primers were used for sequencing: exons 2–3 50 GTGAAGCAGCCATTCTTTTC30 , exon 4 50 ATACGGCCAGGCATTGAAGT30 , exons 5–6 50 GTTTCTTTGCTGCCGTGTTC30 , exons 7–8 50 CTGCTTGCCACAGGTCTCC30 , exon 9 50 TTCCTTACTGCCTCTTGCTT30 , exons 10–11 50 AATCCTATGGCTTTCCAACC30 , 50 TGGAGAAACCCCATCTCTAC30 . 2.3. Functional assay The expression vectors coding for wild-type (pC53-SN3) and mutant (pC53-SCX3, p.Val143Ala) TP53 sequences were kindly provided by Bert Vogelstein and Kenneth W. Kinzler (Johns Hopkins University and Howard Hughes Medical Institute [7]). The pGL3-BAX-luc plasmid coding for firefly luciferase under transcriptional control of human BAX gene promoter fragment was provided by Perwez Hussain and Curtis C. Harris from Laboratory of Human Carcinogenesis, NCI, NIH, Bethesda, USA. The mutation in the codon 190 was introduced to the wild-type TP53 plasmid (pC53-SN3) using QuickChange XL Site-Directed Mutagenesis kit (Stratagene). The following primers were used to introduce codon 190 mutation: 50 GATAGCGATGGTCTGGCCCGTCCTCAGCATCTTATCCG30 (sense primer), 50 CGGATAAGATGCTGAGGACGGGCCAGACCATCGCTATC30 (antisense primer, mutant positions are underlined). The coding region of the plasmid was sequenced to confirm successful mutagenesis and exclude collateral mutations. The cell lines U-2 OS and NCI-H1299 (ATCC) were grown at 37 C/5% CO2 in Dulbecco's modified Eagle's medium (DMEM, Sigma–Aldrich, St. Louis, MI) supplemented with 10% fetal bovine serum (Gibco-Invitrogen, Carlsbad, CA) and penicillin–streptomycin solution (Sigma–Aldrich). Plasmid DNA samples were prepared using QIAprep Miniprep kit (Qiagen). The transfections of plasmid DNA to the cells in culture were performed using FuGene6 reagent according to manufacturer's protocol (Roche Applied Science). The expression of p53 proteins from the plasmids was evaluated by Western blotting performed on whole cell lysates prepared with IP buffer as
described [8]. The expression of p53 was detected using DO-1 antibody from Santa Cruz Biotechnology (Dallas, TX, USA). The luciferase reporter assay system (Promega) was employed for functional test of TP53 mutation. The cells on 12-well plates were seeded a day before transfection. They were transfected with the following plasmid combinations (weight ratio 1:1): pC53SN3 + pGL3-BAX-luc, pC53-SCX3 + pGL3-BAX-luc, pC53190 + pGL3-BAX-luc, pCI-neo (empty vector) + pGL3-BAX-luc. Alternatively, we have substituted pGL3-BAX-luc reporter vector with the plasmid containing MDM2 promoter, which is also regulated by p53 [9]. We described the construction of the MDM2 plasmid in our recent paper [10]. After 24 h the cells were lysed and the firefly luciferase activity was measured. 3. Results The sequencing of TP53 exons 2–11 among 41 cases selected for the analysis (Table 1), revealed C to G substitution in exon 6, codon 190 (c.569C > G, p.Pro190Arg, CCT > CGT) in one patient diagnosed at age 52 with bronchioalveolar adenocarcinoma of the lung (Fig. 1b). The mutation was confirmed in DNA isolated from independent blood draw and by sequencing of the PCR product with antisence primer (50 TCAGGCGGCTCATAGGGCA30 ) designed specifically for this purpose. The patient was a former smoker (20 cigarettes/day for 10 years) and had the history of multiple primary cancers. The interview and medical records showed that she had lumpectomy of the left breast at age 30. The pathological examination detected fibroadenoma and malignant mesenchymoma. Three years later, at age 33, the patient underwent mastectomy of the left breast due to carcinoma infiltrans. She had lumpectomy of a benign tumor of the right breast at age 36 followed by mastectomy at age 49. The pathological diagnosis was carcinoma ductale infiltrans. The interview revealed several cancer cases in the family. The pedigree of the patient based on the data provided during the interview is shown in Fig. 1a. The mother of the proband was diagnosed with breast cancer at age 41 and died at age 42. The proband's son was diagnosed and died with brain tumor at the age of 17 months. The father of the proband was diagnosed with liver cancer at age 63. The mutation detected in the proband (c.569C > G, p.Pro190Arg) was reported as a somatic alteration in colorectal, esophageal and ovarian cancers (see Discussion). However, it was not reported in the latest release (R18) of International Agency for Research on Cancer (IARC) database of germline TP53 mutations (http://p53.
Table 1 Characteristics of the patients (N = 41) selected for TP53 sequencing. N (%) Age at diagnosis, mean SD 45 years >45 years Histological type Non-small cell ca. Small cell ca. Smoking Ever smokers Never smokers Smoking dose (ever smokers only) 30 pack-years >30 pack-years Number of the first-degree relatives with cancer None One More than one Other primary cancer diagnosed Yes No
52.6 9.6 10 (24) 31 (76) 28 (68) 13 (32) 38 (93) 3 (7) 25 (66) 13 (34) 2 (5) 26 (63) 13 (32) 11 (27) 30 (73)
M. Krzesniak et al. / Advances in Medical Sciences 62 (2017) 207–210
209
Fig. 1. (a) The pedigree of the proband (arrow) harboring TP53 mutation. The numbers indicate the age at diagnosis. Cancers running in the family are denoted as: BrCa – breast cancer, LuCa – lung cancer, BTu – brain tumor, HepCa – liver cancer. (b) The electropherogram showing c.569C > G mutation resulting in p.Pro190Arg substitution in the proband (upper panel) and wild-type sequence (lower panel). The arrow indicates the mutated nucleotide. The reading frame is marked on the lower panel.
iarc.fr/TP53GermlineMutations.aspx [11]). Thus, to the best of our knowledge this is the first report of this mutation in the germ line. There was a possibility that p.Pro190Arg substitution was a rare variant of TP53 or that this mutation only slightly destroys the functioning of p53 molecule. Hence, we performed a functional test based on the ability of wild-type p53 protein to activate the promoters of target genes. The Western blot demonstrated that the
plasmids coding for the various versions of p53, transfected into p53-negative NCI-H1299 cells, produced similar levels of p53 (Fig. 2a). The lower, faint band on the image most likely represents p53 isoform translated from a start codon downstream from the major translation start. Subsequently, the p53-positive (U-2 OS) or the p53-negative (NCI-H1299) cells were co-transfected with the reporter vector coding for the firefly luciferase under the
Fig. 2. (a) The Western blot showing expression of the p53 protein in NCI-H1299 cells transfected with the p53 expression vectors. NCI-H1299 cells do not express the endogenous p53 (last lane). (b) The functional test of the mutant version of TP53 (p.Pro190Arg). The relative firefly luciferase activity in NCI-H1299 or in U-2 OS cells transfected with reporter vector (pGL3-BAX-luc) and with expression vectors coding for wild-type and mutant proteins shown in (a). The means and standard deviations (in logarythmic scale) from two independent experiments performed in triplicate are shown. The luciferase activity in cells transfected with wild-type p53 expression vector was set as 1. (c) The functional tests of the mutants performed as in “b” using pGL3-MDM2-luc reporter vector in NCI-H1299 cells (the data from three independent experiments performed in triplicate).
210
M. Krzesniak et al. / Advances in Medical Sciences 62 (2017) 207–210
transcriptional control of p53-responsive BAX promoter [1] and with the expression vectors coding for either: wild-type p53, its well-characterized mutant (p.Val143Ala) or with the tested version detected in the proband (p.Pro190Arg). The empty vector served as another negative control. Expectedly, when compared with the empty expression vector, co-transfection of BAXluciferase construct with wild-type p53 plasmid increased the luciferase activity by a factor of 15–100 depending on the cell line (Fig. 2b). Both p53 mutants (p.Val143Ala and p.Pro190Arg) did not transactivate the BAX promoter in this assay. In U-2 OS cells, which have wild-type p53, we observe the upregulation of BAX promoter because to the activity of endogenous p53 (and the activity of BAX promoter) we add the activity of p53 expressed from the transfected plasmid. Hence, we observed the upregulation of BAX promoter from baseline activity to the activity increased approximately 100-fold (from 0.009 to 1). In light of the results published by Kato et al. [12] showing that the p.Pro190Arg mutant only partially looses the transactivation properties (in yeast assay), we have carried out the luciferase test with the MDM2 promoter as a p53 target. MDM2 promoter is more sensitive that BAX promoter to transactivation properties of p53 [10]. We have performed this test only in p53-negative NCH-H1299 cell line. We have found that the p.Val143Ala mutant lost completely the transactivation properties because its influence on MDM2 promotor did not differ from the empty expression vector (Fig. 2c). One the other hand, our p.Pro190Arg mutant retained 9.7% transactivation properties of the wild-type sequence (Fig. 2c). Thus, the loss of transactivation potential of p.Pro190Arg mutant is substantial but not complete, what is consistent with the results, which Kato et al. [12] obtained using their yeast test for p53 mutants.
Because proband's mother developed breast cancer at early age (41 years), we suspect that she passed the mutation to her daughter. The proband's son was diagnosed with brain tumor at a very young age, therefore one may suppose that the mutant TP53 was the major contributor to his tumor. Unfortunately, neither DNA from the proband's late mother nor DNA from her deceased son were available for the molecular analysis. However, the functional data on novel mutation reported in this work are a valuable contribution to the study of genotype-phenotype relationship between the TP53 alterations and the pattern of cancers in the cancer-prone families. 5. Conclusions We conclude that the nucleotide substitution c.569C > G causing p.Pro190Arg amino acid substitution is a mutation that impairs the ability of p53 to act as a transcription factor. Thus, we detected unidentified earlier germline mutation of TP53 in the proband with adenocarcinoma of the lung and bilateral breast cancer. Conflict of interests All authors declare no conflict of interest. Financial disclosure This work was supported by grants from: Polish State Committee for Scientific Research, grant No. PBZ-KBN 090/P05/ 13 to JR and National Science Center, Poland, grant No. 2013/11/B/ NZ5/03190 to MR.
4. Discussion The germline mutations of TP53 are found in substantial percentage of families with Li-Fraumeni and Li-Fraumeni-like syndromes [5]. Here we report the novel germline mutation of TP53 (c.569C > G, p.Pro190Arg, codon 190:CCT > CGT) in a cancer-prone family. The pattern of cancers in this family does not fit the classical Li-Fraumeni syndrome due to the lack of sarcoma in the pedigree, but is consistent with Li-Fraumeni-like syndrome [4]. The analysis of pedigree reveals that the family fulfills the 2009 Chompret criteria for TP53 germline mutation screening [13] hence a finding of the mutation in this proband was not surprising. The mutation is not localized in the mutational hot-spot and is very rare in somatic mutation database (IARC) reported only in colorectal, esophageal and ovarian cancer patients [11]. In principle, this nucleotide substitution could be a rare variant of TP53 without any major impact on functioning of the protein. The luciferase assay performed in this study showed that this amino acid substitution destroys the ability of p53 to transactivate p53-dependent promoter of BAX and significantly (to approximately 10% of wildtype) reduces capacity of p53 to transactivate promoter of another p53 target - MDM2. Our results are consistent with the functional data reported by Kato et al. [12], who, using yeast-based functional assay, demonstrated that p53 protein with p.Pro190Arg substitution partially lost transactivation properties (to approximately 30% of wild-type sequence) toward promoters of analyzed genes, e.g. CDKN1A, MDM2, BAX (the details in IARC database [11]). One must keep in mind that the p.Pro190Arg mutant was tested by Kato et al. [12] only in yeast cells, while our experiments were performed in human cells, so it cannot be expected that the two systems would yield exactly the same results.
References [1] Miyashita T, Reed JC. Tumor suppressor p53 is a direct transcriptional activator of the human bax gene. Cell 1995;80:293–9. [2] Leroy B, Anderson M, Soussi T. TP53 mutations in human cancer: database reassessment and prospects for the next decade. Hum Mutat 2014;35:672–88. [3] Malkin D, Li FP, Strong LC, Fraumeni Jr. JF, Nelson CE, Kim DH, et al. Germ line p53 mutations in a familial syndrome of breast cancer, sarcomas, and other neoplasms. Science 1990;250:1233–8. [4] Malkin D. Li-fraumeni syndrome. Genes Cancer 2011;2:475–84. [5] Kamihara J, Rana HQ, Garber JE. Germline TP53 mutations and the changing landscape of Li-Fraumeni syndrome. Hum Mutat 2014;35:654–62. [6] Rachtan J, Sokołowski A, Niepsuj S, Zemła B, Zwierko M. Familial lung cancer risk among women in Poland. Lung Cancer 2009;65:138–43. [7] Baker SJ, Markowitz S, Fearon ER, Willson JK, Vogelstein B. Suppression of human colorectal carcinoma cell growth by wild-type p53. Science 1990;249:912–5. [8] Krzesniak M, Zajkowicz A, Matuszczyk I, Rusin M. Rapamycin prevents strong phosphorylation of p53 on serine 46 and attenuates activation of the p53 pathway in A549 lung cancer cells exposed to actinomycin D. Mech Ageing Dev 2014;139:11–21. [9] Zauberman A, Flusberg D, Haupt Y, Barak Y, Oren M. A functional p53responsive intronic promoter is contained within the human mdm2 gene. Nucleic Acids Res 1995;23:2584–92. ski R, Rusin M. [10] Zajkowicz A, Butkiewicz D, Drosik A, Giglok M, Suwin Truncating mutations of PPM1D are found in blood DNA samples of lung cancer patients. Br J Cancer 2015;112:1114–20. [11] Petitjean A, Mathe E, Kato S, Ishioka C, Tavtigian SV, Hainaut P, et al. Impact of mutant p53 functional properties on TP53 mutation patterns and tumor phenotype: lessons from recent developments in the IARC TP53 database. Hum Mutat 2007;28:622–9. [12] Kato S, Han SY, Liu W, Otsuka K, Shibata H, Kanamaru R, et al. Understanding the function-structure and function-mutation relationships of p53 tumor suppressor protein by high-resolution missense mutation analysis. Proc Natl Acad Sci U S A 2003;100:8424–9. [13] Tinat J, Bougeard G, Baert-Desurmont S, Vasseur S, Martin C, Bouvignies E, et al. 2009 version of the Chompret criteria for Li Fraumeni syndrome. J Clin Oncol 2009;27:e108–9.