- Email: [email protected]
A naturally occurring genetic variant of human XRCC2 (R188H) confers increased resistance to cisplatin-induced DNA damage
BBRC Biochemical and Biophysical Research Communications 352 (2007) 763–768 www.elsevier.com/locate/ybbrc
A naturally occurring genetic variant of human XRCC2 (R188H) confers increased resistance to cisplatin-induced DNA damage Patrick Danoy
b
a,c
, Eiichiro Sonoda b, Mark Lathrop c, Shunichi Takeda b, Fumihiko Matsuda a,c,*
a Centre for Genomic Medicine, Kyoto University Graduate School of Medicine, Yoshida, Kyoto 606-8501, Japan Department of Radiation Genetics, Kyoto University Graduate School of Medicine, Yoshida, Kyoto 606-8501, Japan c Centre National de Ge´notypage, 2 rue Gaston Cre´mieux, 91057 Evry, France
Received 25 October 2006 Available online 27 November 2006
Abstract Homologous recombination, a major double strand break repair pathway, plays critical roles in maintaining genome stability. Genetic polymorphisms in HR genes have been implicated in cancer risk. We report a novel assay system for evaluating polymorphisms in human homologous recombination genes using a panel of chicken DT40 repair mutants. We established mutant cell lines complemented with either wild-type or variant cDNAs of three human genes, RAD51, XRCC2, and XRCC3, and assessed their sensitivity to cisplatin and mitomycin C. DT40 mutants complemented with RAD51 coding and 5 0 UTR variants, and with a XRCC3 coding variant showed equivalent sensitivity as those with wild-type cDNAs. Interestingly, Xrcc2/ DT40 cells complemented with variant XRCC2 (R188H) were more tolerant to cisplatin than those with wild-type XRCC2. Considering that the XRCC2 (R188H) allele reduces risk to epithelial ovarian cancer, the increased XRCC2 activity with the R188H polymorphism may have clinical benefit in preventing cancer risk. Ó 2006 Elsevier Inc. All rights reserved. Keywords: DNA repair gene; Homologous recombination; Single nucleotide polymorphism; DT40; Cancer risk; Cisplatin; RAD51; XRCC2; XRCC3
Single nucleotide polymorphisms (SNPs) in human genes have been analyzed extensively not only to evaluate genetic susceptibility to cancer but also to investigate genetic traits that affect sensitivity to drugs or side effects. The information is considered to be extremely useful to design personal-oriented chemotherapy or detect cancer high-risk populations. Although SNPs in genes involved in various cellular functions are under extensive investigation, one of the most relevant cellular pathways in cancer prevention is DNA repair and damage response. The human genome is threatened not only by genotoxic stresses, such as X-rays, UV light, and chemicals but also by various metabolites generated by cells, such as superoxide. Cells have evolved various DNA repair pathways for processing such lesions to maintain genome integrity. In *
Corresponding author. Fax: +81 75 753 9313. E-mail address: [email protected] (F. Matsuda).
0006-291X/$ - see front matter Ó 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2006.11.083
fact, loss of function in DNA repair or checkpoint pathways causes cancer predisposition as well as hypersensitivity to genotoxic stresses. For example, loss of ATM (gene for ataxia telangiectasia) or NBS1 (gene for Nijmegen breakage syndrome), both of which are involved in double strand break repair and checkpoint, causes various types of cancers [1]. Among these DNA repair pathways, homologous recombination (HR) is the main pathway in maintaining genome stability during the cell cycle [2]. Deficiency in HR often causes severe chromosomal instability with embryonic lethality [3]. This indicates that even subtle changes of HR function perturb genome integrity, which may eventually lead to cell death or cancer predisposition. In fact, in various genomic studies on cancer, SNPs in HR genes have been shown to be associated with cancer risk [4– 8]. However, little evidence exists on functional analysis of HR gene variants due to the lack of an appropriate in vivo assay system.
764
P. Danoy et al. / Biochemical and Biophysical Research Communications 352 (2007) 763–768
DT40 is a chicken B lymphocyte line with highly stable phenotype, including growth properties, karyotype, and sensitivity to genotoxic stresses. Because of its high gene targeting efficiency [9], a number of gene-knockout mutants have been established from a single parental cell line [2]. A panel of DNA repair and damage checkpoint mutants is available to screen the cellular pathways responsible for various damage tolerance [10]. Remarkably, most human genes involved in DNA repair or checkpoint fully function in chicken DT40, probably due to the functional constraint. In this study, we report the usability of a panel of DT40 mutants for evaluating the DNA repair potential of human HR gene variants. We investigated whether naturally occurring gene variants of RAD51, XRCC2, and XRCC3 in Caucasians have any effect on DNA damage induced by cross-linking agents. Materials and methods SNP discovery. SNP discovery was performed on 64 chromosomes by re-sequencing of exons and flanking intronic regions. DNA samples were collected from French Caucasian subjects without disease history from the EGEA study [11]. Oligonucleotides for PCR and sequencing were designed using primer3 (http://frodo.wi.mit.edu/) and internal sequencing primers were positioned to cover targeted regions in both forward and reverse directions. Sixteen pools of equimolar mixture of each of two individuals were prepared and amplified using ExTaq (Takara, Otsu, Japan). Purified PCR products were used as template for sequencing reactions with BigDye Terminator Cycle Sequencing kit (PE Applied Biosystems). Sequence analysis and SNP detection genotype calling was performed using the Genalys software [12] which allows for genotype calls obtained from four chromosomes. cDNA isolation and expression vector construction. Full coding human wild-type and variant cDNAs for RAD51 (For: GCAAGCGAGTAGAG AAGTGGAGCGTAAG, Rev: ACTTAAGGTTTTTAACAGAGGAA AAACCCAATGAT) and XRCC2 (For: ATGTGTAGTGCCTTCCAT AG, Rev: TCAACAAAATTCAACCCCAC) were amplified with Pyrobestä Taq polymerase (Takara, Otsu, Japan) using mRNA isolated from individuals with respective genotypes. Variant XRCC3 was generated by site-directed mutagenesis (Invitrogen) from a previously isolated human XRCC3 cDNA (For: ATGGATTTGGATCTACTGGACC, Rev: TCAGTGGGACTGGGTCCCAG) [13]. PCR products were directly cloned into pCR2.1 using the TA cloning kit (Invitrogen), followed by further subcloning into a mammalian expression vector carrying the neomycin resistance gene and an IRES-GFP cassette under the influence of a CMV promoter [14]. Cell culture and phenotypic analysis. Cell culture, DNA transfections and G418 selection of stable transfectants were performed as described previously [9,13,15]. To measure GFP expression, cells were analysed by FACScalibur (Becton–Dickenson, Mountain View, USA) after 5 lg/ml of propidium iodide was added to 0.5 ml of cultured cells. Expression of GFP was assessed after comparison of plots from transfected clones and untransfected cells. To measure growth kinetics, cells were counted by flow cytometry after adding a fixed number of 25 lm microspheres as reference (Polyscience Inc., Warrington, USA). Colonogenic survival was monitored by colony formation assay, as described previously [16]. Sensitivity to cisplatin (Nihon-Kayaku, Tokyo, Japan) was assessed following a 1-h pulse to cisplatin. To measure sensitivity to mitomycin C (Mitomycin Kyowa S, Kyowa Hakko, Tokyo, Japan), cells were subjected to continuous exposure to Mitomycin C. Quantitative PCR. Total RNA was isolated using Trizol kit (Invitrogen) from each transfectant and first strand cDNA was generated using SuperScript FirstStrand System kit (Invitrogen). TaqMan forward (5 0 -GCCTCTCGACGACTGTGTGA-3 0 ), reverse PCR primers (5 0 -GCT
GCCATGCCTTACAGAGAT-3 0 ) and probe (5 0 -TGGACATAGAC TACAGACCT-3 0 ) were designed using Primer Express 2.0 (Applied Biosystems). TaqMan reactions were performed in triplicate using manufacturer’s instructions and conditions on an ABI 7900HT sequence detection system (PE Applied Biosystems).
Results Identification and isolation of human RAD51, XRCC2, and XRCC3 variants We performed systematic sequencing of exons and their flanking regions of the human RAD51, XRCC2, and XRCC3 genes and identified altogether 33 genetic variations in the Caucasian population (Supplementary Table 1). For the functional studies, we focused on three coding SNPs leading to amino acid substitution (Table 1). C19806301, a C/T SNP in exon 3 of the RAD51 gene introduces a proline to serine substitution at amino acid 56 (P56S) in RAD51. Similarly, C18326286 is a G/A polymorphism in exon 3 of XRCC2 which results in an amino acid change from arginine to histidine (R188H) and C18743943, a C/T SNP in exon 8 of XRCC3 changes threonine at position 241 to methionine (T241M). A G/T SNP (C18883867) in the 5 0 UTR of RAD51 (Table 1) was formerly reported to be associated with cancer risk (discussed below) and, hence, we included this SNP for functional evaluation. Based on SNP information, two RAD51 variants, one XRCC2 and XRCC3 variants as well as wild-type cDNAs were isolated by PCR (Fig. 1). Expression constructs were generated using a mammalian expression vector carrying an IRES-GFP cassette to facilitate detection of gene expression by flowcytometry. Complementation of DT40 knockout mutants Mammalian expression constructs were stably transfected into respective DT40 knockout mutant cells. Cloned cDNA sequences were verified by sequencing genomic DNA of transfectants. G418 resistant transfectants were examined for GFP expression by flowcytometry (data not shown). Expression of human cDNA was confirmed for each clone either by RT-PCR (for XRCC2 and XRCC3) or for protein expression by Western blotting in the case of RAD51 (data not shown). Growth kinetic curves of cloned cell lines were determined using flowcytometry (Fig. 2A). Due to the increased spontaneous cell death, HR-defective mutant cells have slower doubling times than wild-type DT40 cells. Mutant DT40 lines complemented with human RAD51, XRCC2 or XRCC3 cDNA showed similar doubling times as those complemented with wild-type cDNA. Sensitivity to DNA damaging agents The DNA repair potential of DT40 clones deficient in Xrcc2 or Xrcc3 was previously evaluated following
Position
196 423 649 1075
Accession #
0.775 0.017 0.083 0.317 G/T C/T G/A C/T
NM_002875.2 NM_002875.2 NM_005431.1 NM_005432.2
Pro/Ser Arg/His Thr/Met
A.A. A1/A2 Position in mRNA Freq. A2 A1/A2
NT_010194.16 NT_010194.16 NT_007914.14 NT_026437.11 rs1801321 N.A. rs3218536 rs861539
Position
XRCC2 XRCC3
C18883867 C19806301 C18326286 C18743943 RAD51
Accession #
11778122 11783897 12922023 85165506
5 0 UTR Exon 3 Exon 3 Exon 8
Location Position in genome dbSNP ID CNG ID Gene
Table 1 Genomic information for polymorphisms responsible for gene variants
765
56 188 241
A.A. position
P. Danoy et al. / Biochemical and Biophysical Research Communications 352 (2007) 763–768
Fig. 1. Genomic schematic representation of HR gene variants for (A) RAD51, (B) XRCC2 and (C) XRCC3. Numbers in brackets represent the position of SNPs on RefSeq mRNA from NCBI (RAD51; NM002875.2, XRCC2; NM005431.1, XRCC3; NM005432.2). Filled squares represent 5 0 and 3 0 UTRs and open squares coding exons.
exposure to DNA damaging agents [13]. The HR potential of these mutants were significantly impaired with their reduced frequency of targeted integration and sister chromatid exchange, and with hypersensitivity to cross-linking agents. On the other hand, Rad51 deficient DT40 cells are not viable due to the severe chromosomal instability [15]. For each gene, we investigated DNA repair potential of mutant cell lines complemented with wild-type and variant human cDNAs following DNA damage. It must be noted that human RAD51 cDNAs only partially restored tolerance levels to that of wild-type DT40 following exposure to cisplatin or mitomycin C (Fig. 2B and C). When DT40 clones complemented with XRCC3-WT and XRCC3-Mut were tested, wild-type chicken DT40 phenotype was fully recovered following treatment with cisplatin, but only partially after exposure with mitomycin C. Depending on the types of lesion by different DNA damaging agents, fine regulation of protein expression might be required to obtain full repair potential. Again, no differences in colony forming ability were observed between XRCC3-WT and XRCC3-Mut clones following cisplatin and mitomycin C-induced DNA damage (Fig. 2B and C). In contrast, Xrcc2/ DT40 cells complemented with the variant XRCC2 (R188H) cDNA showed more tolerant sensitivity to cisplatin (ANOVA P = 0.0012) than those complemented with wild-type cDNA (Fig. 2B). In order to rule out the possibility that the difference in sensitivity to cisplatin depended on the expression of human XRCC2 cDNAs, we measured the expression levels of human XRCC2 cDNA in each clone by quantitative PCR. As
766
P. Danoy et al. / Biochemical and Biophysical Research Communications 352 (2007) 763–768
Fig. 2. Phenotypic analysis of wild-type DT40, null/null mutants and null/null mutants complemented with human cDNA for RAD51, XRCC2, and XRCC3. (A) Representative growth curves for each corresponding cell line. Survival curves for each corresponding cell line following exposure to cisplatin (B) and mitomycin C (C). For each gene, all wild-type and variant clones tested were established independently and expressed comparable levels of cDNA or protein. Data shown are representative of three independent experiments. (D) Relative expression levels of wild-type and mutant XRCC2 by quantitative PCR. Average threshold cycle was calculated from triplicates and relative values were calculated against b-actin controls.
shown in Fig. 2D, there are no significant differences in expression levels between a wild-type (XRCC2-WT#2) and the two variant clones (XRCC2-Mut#1 and XRCC2Mut#2). The results of XRCC2-WT#1 were unstable with
a tendency of slightly higher expression of human XRCC2 cDNA, but still remained within a similar range. Furthermore, the XRCC2-WT#1 clone did not exhibit any tendency to be more tolerant to cisplatin than others. These
P. Danoy et al. / Biochemical and Biophysical Research Communications 352 (2007) 763–768
results clearly indicate that the increased resistance of XRCC2-Mut clones to cisplatin is due to an enhanced DNA repair activity of the variant XRCC2 protein and not gene expression levels. However, difference in the response to mitomycin C was not evident between XRCC2-WT and XRCC2-Mut clones (Fig. 2C). Varying effects of gene variants in response to different DNA damaging agents have previously been reported using Chinese hamster ovary cells [17]. Discussion HR plays a critical role in genome maintenance. Due to the essential nature of RAD51 and its paralogs in HR, polymorphisms in these genes are likely to alter DNA repair potential and modulate cancer predisposition. To investigate such possibilities, the use of DT40 cells in DNA repair studies presents several advantages over other available models [3,18–20]. Chicken DNA repair machinery is virtually identical with mammalian, as manifested by a number of complementation experiments. While repair mutants derived from Chinese hamster cells have been used for similar purposes [7,17], they are limited in the number of mutants available. In DT40 cells, a panel of gene-knockout mutants consisting of approximately 50 DNA repair deficient cell lines is available [3,10]. Furthermore, the absence of functional p53 in DT40 facilitates the assessment of DNA repair potential by eliminating the effect of checkpoint machinery and apoptosis. In addition, various phenotypic assays are available to evaluate DNA repair potential [2,3]. Former functional studies of the human XRCC2 gene using Xrcc2 deficient Chinese hamster cells (irs1) showed that the irs1 cells complemented with human XRCC2 cDNA with amino acid 188 deleted or XRCC2 (R188A) variant demonstrated a marked increase in sensitivity to mitomycin C [7]. However, in the same series of experiments, no significant association was obtained between the naturally occurring human XRCC2 (R188H) variant allele and sensitivity to mitomycin C. In the present study, we did not find any difference between wild-type and variant alleles in sensitivity to mitomycin C. Interestingly, however, when transfectants are treated with cisplatin, those with XRCC2 (R188H) variant displayed a more resistant phenotype to cisplatin than wild-type clones. Although both agents induce a number of intra- and inter-strand cross-links as well as mono-adducts on DNA, cysplatin shows a higher degree of specificity against RAD6/RAD18 post replication repair and HR mutants [20]. Thus, sensitivity to cisplatin may specifically correlate with repair function related to HR or RAD6/ RAD18 pathway. Although XRCC2 has also been shown to form complexes with other HR protein, the precise role and function of human XRCC2 in HR is yet to be elucidated. Amino acid 188 is conserved in human, mouse and rat XRCC2 proteins as well as human RAD51C, suggesting a potential functional role in DNA repair activity.
767
Future determination of functional and active sites in human XRCC2 protein will clarify the biological importance of this amino acid residue. In agreement with an increased DNA repair activity of XRCC2 with R188H substitution shown here, a large multiethnic genetic study on epithelial ovarian cancer (EOC) employing 1378 cases and 3057 controls showed significant association between the XRCC2 (R188H) allele and EOC risk, namely, 20% (OR = 0.8 [0.66–0.96]) and 70% (OR = 0.31 [0.11–0.88]) reduction in heterozygotes and homozygotes for XRCC2 (R188H), respectively [21]. However, other cancer studies conducted on much smaller case-control population failed to detected such an association [22–24], which might be due to decreased statistical power. In contrast, two smaller-scale pharyngeal cancer studies showed association of the XRCC2 (R188H) allele with a moderate increased risk in breast and pharyngeal cancers [7,25]. The analysis described here represents the first functional study of RAD51 polymorphisms using Rad51 conditional knockout cells [15]. We failed to show clear biological effect of both RAD51 SNPs in DNA repair activity. Former genetic association studies indicated that the C allele of the 5 0 UTR SNP (G/C) increases breast cancer risk in Polish and Jewish subjects who carry mutations in BRCA1 and BRCA2 [26–28]. Since both BRCA1 and BRCA2 are involved in HR and are critical for RAD51 foci formation [29], synergistic impact on repair potential and genome stability using the RAD51 5 0 UTR SNP may be tested in vivo using DT40 mutant cells carrying the polymorphisms in BRCA1/2 background. In this paper, we showed the usefulness of the DT40 system for functional evaluation of genetic variations in human DNA repair genes. Similar studies focusing on other DNA repair genes will enhance our knowledge of biological roles of genetic variations. Large-scale genomic epidemiological studies using functional variants as markers will address their involvement in disease susceptibility and prognosis, in particular in cancer. This will allow identifying cancer high-risk populations as well as improving personalized chemotherapy.
Acknowledgments We thank Dr. Hochegger for his scientific and technical help and all the technical staff in the Department of Radiation Genetics. We are grateful to the EGEA (Epidemiological study on the Genetics and Environment of Asthma) cooperative group for allowed access to DNA samples. The project was partially supported by a CREST program from the Japan Science and Technology Agency (Saitama, Japan). The CNG is supported by the Ministere de la Recherche et des Nouvelles Technologies. P.D. is a Doctoral Research Fellow supported by the Japan Society for the Promotion of Science (Tokyo, Japan).
768
P. Danoy et al. / Biochemical and Biophysical Research Communications 352 (2007) 763–768
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc. 2006.11.083. References [1] Y. Shiloh, Ataxia-telangiectasia and the Nijmegen breakage syndrome: related disorders but genes apart, Annu. Rev. Genet. 31 (1997) 635–662. [2] E. Sonoda, M. Takata, Y.M. Yamashita, C. Morrison, S. Takeda, Homologous DNA recombination in vertebrate cells, Proc. Natl. Acad. Sci. USA 98 (2001) 8388–8394. [3] M. Yamazoe, E. Sonoda, H. Hochegger, S. Takeda, Reverse genetic studies of the DNA damage response in the chicken B lymphocyte line DT40, DNA Repair (Amst.) 3 (2004) 1175–1185. [4] L. Zhang, Z. Zhang, W. Yan, Single nucleotide polymorphisms for DNA repair genes in breast cancer patients, Clin. Chim. Acta 359 (2005) 150–155. [5] D. Butkiewicz, M. Rusin, L. Enewold, P.G. Shields, M. Chorazy, C.C. Harris, Genetic polymorphisms in DNA repair genes and risk of lung cancer, Carcinogenesis 22 (2001) 593–597. [6] W.Y. Huang, A.F. Olshan, S.M. Schwartz, S.I. Berndt, C. Chen, V. Llaca, S.J. Chanock, J.F. Fraumeni Jr., R.B. Hayes, Selected genetic polymorphisms in MGMT, XRCC1, XPD, and XRCC3 and risk of head and neck cancer: a pooled analysis, Cancer Epidemiol. Biomarkers Prev. 14 (2005) 1747–1753. [7] S. Rafii, P. O’Regan, G. Xinarianos, I. Azmy, T. Stephenson, M. Reed, M. Meuth, J. Thacker, A. Cox, A potential role for the XRCC2 R188H polymorphic site in DNA-damage repair and breast cancer, Hum. Mol. Genet. 11 (2002) 1433–1438. [8] B. Kuschel, A. Auranen, S. McBride, K.L. Novik, A. Antoniou, J.M. Lipscombe, N.E. Day, D.F. Easton, B.A. Ponder, P.D. Pharoah, A. Dunning, Variants in DNA double-strand break repair genes and breast cancer susceptibility, Hum. Mol. Genet. 11 (2002) 1399–1407. [9] J.M. Buerstedde, S. Takeda, Increased ratio of targeted to random integration after transfection of chicken B cell lines, Cell 67 (1991) 179–188. [10] K. Nojima, H. Hochegger, A. Saberi, T. Fukushima, K. Kikuchi, M. Yoshimura, B.J. Orelli, D.K. Bishop, S. Hirano, M. Ohzeki, M. Ishiai, K. Yamamoto, M. Takata, H. Arakawa, J.M. Buerstedde, M. Yamazoe, T. Kawamoto, K. Araki, J.A. Takahashi, N. Hashimoto, S. Takeda, E. Sonoda, Multiple repair pathways mediate tolerance to chemotherapeutic cross-linking agents in vertebrate cells, Cancer Res. 65 (2005) 11704–11711. [11] M.H. Dizier, E. Bouzigon, M. Guilloud-Bataille, C. Betard, J. Bousquet, D. Charpin, F. Gormand, J. Hochez, J. Just, A. Lemainque, N. Le Moual, R. Matran, F. Neukirch, M.P. Oryszczyn, E. Paty, I. Pin, D. Vervloet, F. Kauffmann, M. Lathrop, F. Demenais, I. Annesi-Maesano, Genome screen in the French EGEA study: detection of linked regions shared or not shared by allergic rhinitis and asthma, Genes Immun. 6 (2005) 95–102. [12] M. Takahashi, F. Matsuda, N. Margetic, M. Lathrop, Automated identification of single nucleotide polymorphisms from sequencing data, J. Bioinform. Comput. Biol. 1 (2003) 253–265. [13] M. Takata, M.S. Sasaki, S. Tachiiri, T. Fukushima, E. Sonoda, D. Schild, L.H. Thompson, S. Takeda, Chromosome instability and defective recombinational repair in knockout mutants of the five Rad51 paralogs, Mol. Cell Biol. 21 (2001) 2858–2866. [14] A. Fujimori, S. Tachiiri, E. Sonoda, L.H. Thompson, P.K. Dhar, M. Hiraoka, S. Takeda, Y. Zhang, M. Reth, M. Takata, Rad52 partially substitutes for the Rad51 paralog XRCC3 in maintaining chromosomal integrity in vertebrate cells, EMBO J. 20 (2001) 5513–5520.
[15] E. Sonoda, M.S. Sasaki, J.M. Buerstedde, O. Bezzubova, A. Shinohara, H. Ogawa, M. Takata, Y. Yamaguchi-Iwai, S. Takeda, Rad51-deficient vertebrate cells accumulate chromosomal breaks prior to cell death, EMBO J. 17 (1998) 598–608. [16] M. Takata, M.S. Sasaki, E. Sonoda, C. Morrison, M. Hashimoto, H. Utsumi, Y. Yamaguchi-Iwai, A. Shinohara, S. Takeda, Homologous recombination and non-homologous end-joining pathways of DNA double-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells, EMBO J. 17 (1998) 5497–5508. [17] S. Rafii, A. Lindblom, M. Reed, M. Meuth, A. Cox, A naturally occurring mutation in an ATP-binding domain of the recombination repair gene XRCC3 ablates its function without causing cancer susceptibility, Hum. Mol. Genet. 12 (2003) 915–923. [18] P. Perego, G.S. Jimenez, L. Gatti, S.B. Howell, F. Zunino, Yeast mutants as a model system for identification of determinants of chemosensitivity, Pharmacol. Rev. 52 (2000) 477–492. [19] L.H. Hartwell, P. Szankasi, C.J. Roberts, A.W. Murray, S.H. Friend, Integrating genetic approaches into the discovery of anticancer drugs, Science 278 (1997) 1064–1068. [20] J.A. Simon, P. Szankasi, D.K. Nguyen, C. Ludlow, H.M. Dunstan, C.J. Roberts, E.L. Jensen, L.H. Hartwell, S.H. Friend, Differential toxicities of anticancer agents among DNA repair and checkpoint mutants of Saccharomyces cerevisiae, Cancer Res. 60 (2000) 328–333. [21] A. Auranen, H. Song, C. Waterfall, R.A. Dicioccio, B. Kuschel, S.K. Kjaer, E. Hogdall, C. Hogdall, J. Stratton, A.S. Whittemore, D.F. Easton, B.A. Ponder, K.L. Novik, A.M. Dunning, S. Gayther, P.D. Pharoah, Polymorphisms in DNA repair genes and epithelial ovarian cancer risk, Int. J. Cancer 117 (2005) 611–618. [22] K.M. Lee, J.Y. Choi, C. Kang, C.P. Kang, S.K. Park, H. Cho, D.Y. Cho, K.Y. Yoo, D.Y. Noh, S.H. Ahn, C.G. Park, Q. Wei, D. Kang, Genetic polymorphisms of selected DNA repair genes, estrogen and progesterone receptor status, and breast cancer risk, Clin. Cancer Res. 11 (2005) 4620–4626. [23] J. Han, G.A. Colditz, L.D. Samson, D.J. Hunter, Polymorphisms in DNA double-strand break repair genes and skin cancer risk, Cancer Res. 64 (2004) 3009–3013. [24] P.M. Webb, J.L. Hopper, B. Newman, X. Chen, L. Kelemen, G.G. Giles, M.C. Southey, G. Chenevix-Trench, A.B. Spurdle, Doublestrand break repair gene polymorphisms and risk of breast or ovarian cancer, Cancer Epidemiol. Biomarkers Prev. 14 (2005) 319–323. [25] S. Benhamou, J. Tuimala, C. Bouchardy, P. Dayer, A. Sarasin, A. Hirvonen, DNA repair gene XRCC2 and XRCC3 polymorphisms and susceptibility to cancers of the upper aerodigestive tract, Int. J. Cancer 112 (2004) 901–904. [26] L. Kadouri, Z. Kote-Jarai, A. Hubert, F. Durocher, D. Abeliovich, B. Glaser, T. Hamburger, R.A. Eeles, T. Peretz, A single-nucleotide polymorphism in the RAD51 gene modifies breast cancer risk in BRCA2 carriers, but not in BRCA1 carriers or noncarriers, Br. J. Cancer 90 (2004) 2002–2005. [27] A. Jakubowska, S.A. Narod, D.E. Goldgar, M. Mierzejewski, B. Masojc, K. Nej, J. Huzarska, T. Byrski, B. Gorski, J. Lubinski, Breast cancer risk reduction associated with the RAD51 polymorphism among carriers of the BRCA1 5382insC mutation in Poland, Cancer Epidemiol. Biomarkers Prev. 12 (2003) 457–459. [28] W. Wang, A.B. Spurdle, P. Kolachana, B. Bove, B. Modan, S.M. Ebbers, G. Suthers, M.A. Tucker, D.J. Kaufman, M.M. Doody, R.E. Tarone, M. Daly, H. Levavi, H. Pierce, A. Chetrit, G.H. Yechezkel, G. Chenevix-Trench, K. Offit, A.K. Godwin, J.P. Struewing, A single nucleotide polymorphism in the 5 0 untranslated region of RAD51 and risk of cancer among BRCA1/2 mutation carriers, Cancer Epidemiol. Biomarkers Prev. 10 (2001) 955–960. [29] A.R. Venkitaraman, Functions of BRCA1 and BRCA2 in the biological response to DNA damage, J. Cell Sci. 114 (2001) 3591– 3598.
A naturally occurring genetic variant of human XRCC2 (R188H) confers increased resistance to cisplatin-induced DNA damage Patrick Danoy
b
a,c
, Eiichiro Sonoda b, Mark Lathrop c, Shunichi Takeda b, Fumihiko Matsuda a,c,*
a Centre for Genomic Medicine, Kyoto University Graduate School of Medicine, Yoshida, Kyoto 606-8501, Japan Department of Radiation Genetics, Kyoto University Graduate School of Medicine, Yoshida, Kyoto 606-8501, Japan c Centre National de Ge´notypage, 2 rue Gaston Cre´mieux, 91057 Evry, France
Received 25 October 2006 Available online 27 November 2006
Abstract Homologous recombination, a major double strand break repair pathway, plays critical roles in maintaining genome stability. Genetic polymorphisms in HR genes have been implicated in cancer risk. We report a novel assay system for evaluating polymorphisms in human homologous recombination genes using a panel of chicken DT40 repair mutants. We established mutant cell lines complemented with either wild-type or variant cDNAs of three human genes, RAD51, XRCC2, and XRCC3, and assessed their sensitivity to cisplatin and mitomycin C. DT40 mutants complemented with RAD51 coding and 5 0 UTR variants, and with a XRCC3 coding variant showed equivalent sensitivity as those with wild-type cDNAs. Interestingly, Xrcc2/ DT40 cells complemented with variant XRCC2 (R188H) were more tolerant to cisplatin than those with wild-type XRCC2. Considering that the XRCC2 (R188H) allele reduces risk to epithelial ovarian cancer, the increased XRCC2 activity with the R188H polymorphism may have clinical benefit in preventing cancer risk. Ó 2006 Elsevier Inc. All rights reserved. Keywords: DNA repair gene; Homologous recombination; Single nucleotide polymorphism; DT40; Cancer risk; Cisplatin; RAD51; XRCC2; XRCC3
Single nucleotide polymorphisms (SNPs) in human genes have been analyzed extensively not only to evaluate genetic susceptibility to cancer but also to investigate genetic traits that affect sensitivity to drugs or side effects. The information is considered to be extremely useful to design personal-oriented chemotherapy or detect cancer high-risk populations. Although SNPs in genes involved in various cellular functions are under extensive investigation, one of the most relevant cellular pathways in cancer prevention is DNA repair and damage response. The human genome is threatened not only by genotoxic stresses, such as X-rays, UV light, and chemicals but also by various metabolites generated by cells, such as superoxide. Cells have evolved various DNA repair pathways for processing such lesions to maintain genome integrity. In *
Corresponding author. Fax: +81 75 753 9313. E-mail address: [email protected] (F. Matsuda).
0006-291X/$ - see front matter Ó 2006 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2006.11.083
fact, loss of function in DNA repair or checkpoint pathways causes cancer predisposition as well as hypersensitivity to genotoxic stresses. For example, loss of ATM (gene for ataxia telangiectasia) or NBS1 (gene for Nijmegen breakage syndrome), both of which are involved in double strand break repair and checkpoint, causes various types of cancers [1]. Among these DNA repair pathways, homologous recombination (HR) is the main pathway in maintaining genome stability during the cell cycle [2]. Deficiency in HR often causes severe chromosomal instability with embryonic lethality [3]. This indicates that even subtle changes of HR function perturb genome integrity, which may eventually lead to cell death or cancer predisposition. In fact, in various genomic studies on cancer, SNPs in HR genes have been shown to be associated with cancer risk [4– 8]. However, little evidence exists on functional analysis of HR gene variants due to the lack of an appropriate in vivo assay system.
764
P. Danoy et al. / Biochemical and Biophysical Research Communications 352 (2007) 763–768
DT40 is a chicken B lymphocyte line with highly stable phenotype, including growth properties, karyotype, and sensitivity to genotoxic stresses. Because of its high gene targeting efficiency [9], a number of gene-knockout mutants have been established from a single parental cell line [2]. A panel of DNA repair and damage checkpoint mutants is available to screen the cellular pathways responsible for various damage tolerance [10]. Remarkably, most human genes involved in DNA repair or checkpoint fully function in chicken DT40, probably due to the functional constraint. In this study, we report the usability of a panel of DT40 mutants for evaluating the DNA repair potential of human HR gene variants. We investigated whether naturally occurring gene variants of RAD51, XRCC2, and XRCC3 in Caucasians have any effect on DNA damage induced by cross-linking agents. Materials and methods SNP discovery. SNP discovery was performed on 64 chromosomes by re-sequencing of exons and flanking intronic regions. DNA samples were collected from French Caucasian subjects without disease history from the EGEA study [11]. Oligonucleotides for PCR and sequencing were designed using primer3 (http://frodo.wi.mit.edu/) and internal sequencing primers were positioned to cover targeted regions in both forward and reverse directions. Sixteen pools of equimolar mixture of each of two individuals were prepared and amplified using ExTaq (Takara, Otsu, Japan). Purified PCR products were used as template for sequencing reactions with BigDye Terminator Cycle Sequencing kit (PE Applied Biosystems). Sequence analysis and SNP detection genotype calling was performed using the Genalys software [12] which allows for genotype calls obtained from four chromosomes. cDNA isolation and expression vector construction. Full coding human wild-type and variant cDNAs for RAD51 (For: GCAAGCGAGTAGAG AAGTGGAGCGTAAG, Rev: ACTTAAGGTTTTTAACAGAGGAA AAACCCAATGAT) and XRCC2 (For: ATGTGTAGTGCCTTCCAT AG, Rev: TCAACAAAATTCAACCCCAC) were amplified with Pyrobestä Taq polymerase (Takara, Otsu, Japan) using mRNA isolated from individuals with respective genotypes. Variant XRCC3 was generated by site-directed mutagenesis (Invitrogen) from a previously isolated human XRCC3 cDNA (For: ATGGATTTGGATCTACTGGACC, Rev: TCAGTGGGACTGGGTCCCAG) [13]. PCR products were directly cloned into pCR2.1 using the TA cloning kit (Invitrogen), followed by further subcloning into a mammalian expression vector carrying the neomycin resistance gene and an IRES-GFP cassette under the influence of a CMV promoter [14]. Cell culture and phenotypic analysis. Cell culture, DNA transfections and G418 selection of stable transfectants were performed as described previously [9,13,15]. To measure GFP expression, cells were analysed by FACScalibur (Becton–Dickenson, Mountain View, USA) after 5 lg/ml of propidium iodide was added to 0.5 ml of cultured cells. Expression of GFP was assessed after comparison of plots from transfected clones and untransfected cells. To measure growth kinetics, cells were counted by flow cytometry after adding a fixed number of 25 lm microspheres as reference (Polyscience Inc., Warrington, USA). Colonogenic survival was monitored by colony formation assay, as described previously [16]. Sensitivity to cisplatin (Nihon-Kayaku, Tokyo, Japan) was assessed following a 1-h pulse to cisplatin. To measure sensitivity to mitomycin C (Mitomycin Kyowa S, Kyowa Hakko, Tokyo, Japan), cells were subjected to continuous exposure to Mitomycin C. Quantitative PCR. Total RNA was isolated using Trizol kit (Invitrogen) from each transfectant and first strand cDNA was generated using SuperScript FirstStrand System kit (Invitrogen). TaqMan forward (5 0 -GCCTCTCGACGACTGTGTGA-3 0 ), reverse PCR primers (5 0 -GCT
GCCATGCCTTACAGAGAT-3 0 ) and probe (5 0 -TGGACATAGAC TACAGACCT-3 0 ) were designed using Primer Express 2.0 (Applied Biosystems). TaqMan reactions were performed in triplicate using manufacturer’s instructions and conditions on an ABI 7900HT sequence detection system (PE Applied Biosystems).
Results Identification and isolation of human RAD51, XRCC2, and XRCC3 variants We performed systematic sequencing of exons and their flanking regions of the human RAD51, XRCC2, and XRCC3 genes and identified altogether 33 genetic variations in the Caucasian population (Supplementary Table 1). For the functional studies, we focused on three coding SNPs leading to amino acid substitution (Table 1). C19806301, a C/T SNP in exon 3 of the RAD51 gene introduces a proline to serine substitution at amino acid 56 (P56S) in RAD51. Similarly, C18326286 is a G/A polymorphism in exon 3 of XRCC2 which results in an amino acid change from arginine to histidine (R188H) and C18743943, a C/T SNP in exon 8 of XRCC3 changes threonine at position 241 to methionine (T241M). A G/T SNP (C18883867) in the 5 0 UTR of RAD51 (Table 1) was formerly reported to be associated with cancer risk (discussed below) and, hence, we included this SNP for functional evaluation. Based on SNP information, two RAD51 variants, one XRCC2 and XRCC3 variants as well as wild-type cDNAs were isolated by PCR (Fig. 1). Expression constructs were generated using a mammalian expression vector carrying an IRES-GFP cassette to facilitate detection of gene expression by flowcytometry. Complementation of DT40 knockout mutants Mammalian expression constructs were stably transfected into respective DT40 knockout mutant cells. Cloned cDNA sequences were verified by sequencing genomic DNA of transfectants. G418 resistant transfectants were examined for GFP expression by flowcytometry (data not shown). Expression of human cDNA was confirmed for each clone either by RT-PCR (for XRCC2 and XRCC3) or for protein expression by Western blotting in the case of RAD51 (data not shown). Growth kinetic curves of cloned cell lines were determined using flowcytometry (Fig. 2A). Due to the increased spontaneous cell death, HR-defective mutant cells have slower doubling times than wild-type DT40 cells. Mutant DT40 lines complemented with human RAD51, XRCC2 or XRCC3 cDNA showed similar doubling times as those complemented with wild-type cDNA. Sensitivity to DNA damaging agents The DNA repair potential of DT40 clones deficient in Xrcc2 or Xrcc3 was previously evaluated following
Position
196 423 649 1075
Accession #
0.775 0.017 0.083 0.317 G/T C/T G/A C/T
NM_002875.2 NM_002875.2 NM_005431.1 NM_005432.2
Pro/Ser Arg/His Thr/Met
A.A. A1/A2 Position in mRNA Freq. A2 A1/A2
NT_010194.16 NT_010194.16 NT_007914.14 NT_026437.11 rs1801321 N.A. rs3218536 rs861539
Position
XRCC2 XRCC3
C18883867 C19806301 C18326286 C18743943 RAD51
Accession #
11778122 11783897 12922023 85165506
5 0 UTR Exon 3 Exon 3 Exon 8
Location Position in genome dbSNP ID CNG ID Gene
Table 1 Genomic information for polymorphisms responsible for gene variants
765
56 188 241
A.A. position
P. Danoy et al. / Biochemical and Biophysical Research Communications 352 (2007) 763–768
Fig. 1. Genomic schematic representation of HR gene variants for (A) RAD51, (B) XRCC2 and (C) XRCC3. Numbers in brackets represent the position of SNPs on RefSeq mRNA from NCBI (RAD51; NM002875.2, XRCC2; NM005431.1, XRCC3; NM005432.2). Filled squares represent 5 0 and 3 0 UTRs and open squares coding exons.
exposure to DNA damaging agents [13]. The HR potential of these mutants were significantly impaired with their reduced frequency of targeted integration and sister chromatid exchange, and with hypersensitivity to cross-linking agents. On the other hand, Rad51 deficient DT40 cells are not viable due to the severe chromosomal instability [15]. For each gene, we investigated DNA repair potential of mutant cell lines complemented with wild-type and variant human cDNAs following DNA damage. It must be noted that human RAD51 cDNAs only partially restored tolerance levels to that of wild-type DT40 following exposure to cisplatin or mitomycin C (Fig. 2B and C). When DT40 clones complemented with XRCC3-WT and XRCC3-Mut were tested, wild-type chicken DT40 phenotype was fully recovered following treatment with cisplatin, but only partially after exposure with mitomycin C. Depending on the types of lesion by different DNA damaging agents, fine regulation of protein expression might be required to obtain full repair potential. Again, no differences in colony forming ability were observed between XRCC3-WT and XRCC3-Mut clones following cisplatin and mitomycin C-induced DNA damage (Fig. 2B and C). In contrast, Xrcc2/ DT40 cells complemented with the variant XRCC2 (R188H) cDNA showed more tolerant sensitivity to cisplatin (ANOVA P = 0.0012) than those complemented with wild-type cDNA (Fig. 2B). In order to rule out the possibility that the difference in sensitivity to cisplatin depended on the expression of human XRCC2 cDNAs, we measured the expression levels of human XRCC2 cDNA in each clone by quantitative PCR. As
766
P. Danoy et al. / Biochemical and Biophysical Research Communications 352 (2007) 763–768
Fig. 2. Phenotypic analysis of wild-type DT40, null/null mutants and null/null mutants complemented with human cDNA for RAD51, XRCC2, and XRCC3. (A) Representative growth curves for each corresponding cell line. Survival curves for each corresponding cell line following exposure to cisplatin (B) and mitomycin C (C). For each gene, all wild-type and variant clones tested were established independently and expressed comparable levels of cDNA or protein. Data shown are representative of three independent experiments. (D) Relative expression levels of wild-type and mutant XRCC2 by quantitative PCR. Average threshold cycle was calculated from triplicates and relative values were calculated against b-actin controls.
shown in Fig. 2D, there are no significant differences in expression levels between a wild-type (XRCC2-WT#2) and the two variant clones (XRCC2-Mut#1 and XRCC2Mut#2). The results of XRCC2-WT#1 were unstable with
a tendency of slightly higher expression of human XRCC2 cDNA, but still remained within a similar range. Furthermore, the XRCC2-WT#1 clone did not exhibit any tendency to be more tolerant to cisplatin than others. These
P. Danoy et al. / Biochemical and Biophysical Research Communications 352 (2007) 763–768
results clearly indicate that the increased resistance of XRCC2-Mut clones to cisplatin is due to an enhanced DNA repair activity of the variant XRCC2 protein and not gene expression levels. However, difference in the response to mitomycin C was not evident between XRCC2-WT and XRCC2-Mut clones (Fig. 2C). Varying effects of gene variants in response to different DNA damaging agents have previously been reported using Chinese hamster ovary cells [17]. Discussion HR plays a critical role in genome maintenance. Due to the essential nature of RAD51 and its paralogs in HR, polymorphisms in these genes are likely to alter DNA repair potential and modulate cancer predisposition. To investigate such possibilities, the use of DT40 cells in DNA repair studies presents several advantages over other available models [3,18–20]. Chicken DNA repair machinery is virtually identical with mammalian, as manifested by a number of complementation experiments. While repair mutants derived from Chinese hamster cells have been used for similar purposes [7,17], they are limited in the number of mutants available. In DT40 cells, a panel of gene-knockout mutants consisting of approximately 50 DNA repair deficient cell lines is available [3,10]. Furthermore, the absence of functional p53 in DT40 facilitates the assessment of DNA repair potential by eliminating the effect of checkpoint machinery and apoptosis. In addition, various phenotypic assays are available to evaluate DNA repair potential [2,3]. Former functional studies of the human XRCC2 gene using Xrcc2 deficient Chinese hamster cells (irs1) showed that the irs1 cells complemented with human XRCC2 cDNA with amino acid 188 deleted or XRCC2 (R188A) variant demonstrated a marked increase in sensitivity to mitomycin C [7]. However, in the same series of experiments, no significant association was obtained between the naturally occurring human XRCC2 (R188H) variant allele and sensitivity to mitomycin C. In the present study, we did not find any difference between wild-type and variant alleles in sensitivity to mitomycin C. Interestingly, however, when transfectants are treated with cisplatin, those with XRCC2 (R188H) variant displayed a more resistant phenotype to cisplatin than wild-type clones. Although both agents induce a number of intra- and inter-strand cross-links as well as mono-adducts on DNA, cysplatin shows a higher degree of specificity against RAD6/RAD18 post replication repair and HR mutants [20]. Thus, sensitivity to cisplatin may specifically correlate with repair function related to HR or RAD6/ RAD18 pathway. Although XRCC2 has also been shown to form complexes with other HR protein, the precise role and function of human XRCC2 in HR is yet to be elucidated. Amino acid 188 is conserved in human, mouse and rat XRCC2 proteins as well as human RAD51C, suggesting a potential functional role in DNA repair activity.
767
Future determination of functional and active sites in human XRCC2 protein will clarify the biological importance of this amino acid residue. In agreement with an increased DNA repair activity of XRCC2 with R188H substitution shown here, a large multiethnic genetic study on epithelial ovarian cancer (EOC) employing 1378 cases and 3057 controls showed significant association between the XRCC2 (R188H) allele and EOC risk, namely, 20% (OR = 0.8 [0.66–0.96]) and 70% (OR = 0.31 [0.11–0.88]) reduction in heterozygotes and homozygotes for XRCC2 (R188H), respectively [21]. However, other cancer studies conducted on much smaller case-control population failed to detected such an association [22–24], which might be due to decreased statistical power. In contrast, two smaller-scale pharyngeal cancer studies showed association of the XRCC2 (R188H) allele with a moderate increased risk in breast and pharyngeal cancers [7,25]. The analysis described here represents the first functional study of RAD51 polymorphisms using Rad51 conditional knockout cells [15]. We failed to show clear biological effect of both RAD51 SNPs in DNA repair activity. Former genetic association studies indicated that the C allele of the 5 0 UTR SNP (G/C) increases breast cancer risk in Polish and Jewish subjects who carry mutations in BRCA1 and BRCA2 [26–28]. Since both BRCA1 and BRCA2 are involved in HR and are critical for RAD51 foci formation [29], synergistic impact on repair potential and genome stability using the RAD51 5 0 UTR SNP may be tested in vivo using DT40 mutant cells carrying the polymorphisms in BRCA1/2 background. In this paper, we showed the usefulness of the DT40 system for functional evaluation of genetic variations in human DNA repair genes. Similar studies focusing on other DNA repair genes will enhance our knowledge of biological roles of genetic variations. Large-scale genomic epidemiological studies using functional variants as markers will address their involvement in disease susceptibility and prognosis, in particular in cancer. This will allow identifying cancer high-risk populations as well as improving personalized chemotherapy.
Acknowledgments We thank Dr. Hochegger for his scientific and technical help and all the technical staff in the Department of Radiation Genetics. We are grateful to the EGEA (Epidemiological study on the Genetics and Environment of Asthma) cooperative group for allowed access to DNA samples. The project was partially supported by a CREST program from the Japan Science and Technology Agency (Saitama, Japan). The CNG is supported by the Ministere de la Recherche et des Nouvelles Technologies. P.D. is a Doctoral Research Fellow supported by the Japan Society for the Promotion of Science (Tokyo, Japan).
768
P. Danoy et al. / Biochemical and Biophysical Research Communications 352 (2007) 763–768
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.bbrc. 2006.11.083. References [1] Y. Shiloh, Ataxia-telangiectasia and the Nijmegen breakage syndrome: related disorders but genes apart, Annu. Rev. Genet. 31 (1997) 635–662. [2] E. Sonoda, M. Takata, Y.M. Yamashita, C. Morrison, S. Takeda, Homologous DNA recombination in vertebrate cells, Proc. Natl. Acad. Sci. USA 98 (2001) 8388–8394. [3] M. Yamazoe, E. Sonoda, H. Hochegger, S. Takeda, Reverse genetic studies of the DNA damage response in the chicken B lymphocyte line DT40, DNA Repair (Amst.) 3 (2004) 1175–1185. [4] L. Zhang, Z. Zhang, W. Yan, Single nucleotide polymorphisms for DNA repair genes in breast cancer patients, Clin. Chim. Acta 359 (2005) 150–155. [5] D. Butkiewicz, M. Rusin, L. Enewold, P.G. Shields, M. Chorazy, C.C. Harris, Genetic polymorphisms in DNA repair genes and risk of lung cancer, Carcinogenesis 22 (2001) 593–597. [6] W.Y. Huang, A.F. Olshan, S.M. Schwartz, S.I. Berndt, C. Chen, V. Llaca, S.J. Chanock, J.F. Fraumeni Jr., R.B. Hayes, Selected genetic polymorphisms in MGMT, XRCC1, XPD, and XRCC3 and risk of head and neck cancer: a pooled analysis, Cancer Epidemiol. Biomarkers Prev. 14 (2005) 1747–1753. [7] S. Rafii, P. O’Regan, G. Xinarianos, I. Azmy, T. Stephenson, M. Reed, M. Meuth, J. Thacker, A. Cox, A potential role for the XRCC2 R188H polymorphic site in DNA-damage repair and breast cancer, Hum. Mol. Genet. 11 (2002) 1433–1438. [8] B. Kuschel, A. Auranen, S. McBride, K.L. Novik, A. Antoniou, J.M. Lipscombe, N.E. Day, D.F. Easton, B.A. Ponder, P.D. Pharoah, A. Dunning, Variants in DNA double-strand break repair genes and breast cancer susceptibility, Hum. Mol. Genet. 11 (2002) 1399–1407. [9] J.M. Buerstedde, S. Takeda, Increased ratio of targeted to random integration after transfection of chicken B cell lines, Cell 67 (1991) 179–188. [10] K. Nojima, H. Hochegger, A. Saberi, T. Fukushima, K. Kikuchi, M. Yoshimura, B.J. Orelli, D.K. Bishop, S. Hirano, M. Ohzeki, M. Ishiai, K. Yamamoto, M. Takata, H. Arakawa, J.M. Buerstedde, M. Yamazoe, T. Kawamoto, K. Araki, J.A. Takahashi, N. Hashimoto, S. Takeda, E. Sonoda, Multiple repair pathways mediate tolerance to chemotherapeutic cross-linking agents in vertebrate cells, Cancer Res. 65 (2005) 11704–11711. [11] M.H. Dizier, E. Bouzigon, M. Guilloud-Bataille, C. Betard, J. Bousquet, D. Charpin, F. Gormand, J. Hochez, J. Just, A. Lemainque, N. Le Moual, R. Matran, F. Neukirch, M.P. Oryszczyn, E. Paty, I. Pin, D. Vervloet, F. Kauffmann, M. Lathrop, F. Demenais, I. Annesi-Maesano, Genome screen in the French EGEA study: detection of linked regions shared or not shared by allergic rhinitis and asthma, Genes Immun. 6 (2005) 95–102. [12] M. Takahashi, F. Matsuda, N. Margetic, M. Lathrop, Automated identification of single nucleotide polymorphisms from sequencing data, J. Bioinform. Comput. Biol. 1 (2003) 253–265. [13] M. Takata, M.S. Sasaki, S. Tachiiri, T. Fukushima, E. Sonoda, D. Schild, L.H. Thompson, S. Takeda, Chromosome instability and defective recombinational repair in knockout mutants of the five Rad51 paralogs, Mol. Cell Biol. 21 (2001) 2858–2866. [14] A. Fujimori, S. Tachiiri, E. Sonoda, L.H. Thompson, P.K. Dhar, M. Hiraoka, S. Takeda, Y. Zhang, M. Reth, M. Takata, Rad52 partially substitutes for the Rad51 paralog XRCC3 in maintaining chromosomal integrity in vertebrate cells, EMBO J. 20 (2001) 5513–5520.
[15] E. Sonoda, M.S. Sasaki, J.M. Buerstedde, O. Bezzubova, A. Shinohara, H. Ogawa, M. Takata, Y. Yamaguchi-Iwai, S. Takeda, Rad51-deficient vertebrate cells accumulate chromosomal breaks prior to cell death, EMBO J. 17 (1998) 598–608. [16] M. Takata, M.S. Sasaki, E. Sonoda, C. Morrison, M. Hashimoto, H. Utsumi, Y. Yamaguchi-Iwai, A. Shinohara, S. Takeda, Homologous recombination and non-homologous end-joining pathways of DNA double-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells, EMBO J. 17 (1998) 5497–5508. [17] S. Rafii, A. Lindblom, M. Reed, M. Meuth, A. Cox, A naturally occurring mutation in an ATP-binding domain of the recombination repair gene XRCC3 ablates its function without causing cancer susceptibility, Hum. Mol. Genet. 12 (2003) 915–923. [18] P. Perego, G.S. Jimenez, L. Gatti, S.B. Howell, F. Zunino, Yeast mutants as a model system for identification of determinants of chemosensitivity, Pharmacol. Rev. 52 (2000) 477–492. [19] L.H. Hartwell, P. Szankasi, C.J. Roberts, A.W. Murray, S.H. Friend, Integrating genetic approaches into the discovery of anticancer drugs, Science 278 (1997) 1064–1068. [20] J.A. Simon, P. Szankasi, D.K. Nguyen, C. Ludlow, H.M. Dunstan, C.J. Roberts, E.L. Jensen, L.H. Hartwell, S.H. Friend, Differential toxicities of anticancer agents among DNA repair and checkpoint mutants of Saccharomyces cerevisiae, Cancer Res. 60 (2000) 328–333. [21] A. Auranen, H. Song, C. Waterfall, R.A. Dicioccio, B. Kuschel, S.K. Kjaer, E. Hogdall, C. Hogdall, J. Stratton, A.S. Whittemore, D.F. Easton, B.A. Ponder, K.L. Novik, A.M. Dunning, S. Gayther, P.D. Pharoah, Polymorphisms in DNA repair genes and epithelial ovarian cancer risk, Int. J. Cancer 117 (2005) 611–618. [22] K.M. Lee, J.Y. Choi, C. Kang, C.P. Kang, S.K. Park, H. Cho, D.Y. Cho, K.Y. Yoo, D.Y. Noh, S.H. Ahn, C.G. Park, Q. Wei, D. Kang, Genetic polymorphisms of selected DNA repair genes, estrogen and progesterone receptor status, and breast cancer risk, Clin. Cancer Res. 11 (2005) 4620–4626. [23] J. Han, G.A. Colditz, L.D. Samson, D.J. Hunter, Polymorphisms in DNA double-strand break repair genes and skin cancer risk, Cancer Res. 64 (2004) 3009–3013. [24] P.M. Webb, J.L. Hopper, B. Newman, X. Chen, L. Kelemen, G.G. Giles, M.C. Southey, G. Chenevix-Trench, A.B. Spurdle, Doublestrand break repair gene polymorphisms and risk of breast or ovarian cancer, Cancer Epidemiol. Biomarkers Prev. 14 (2005) 319–323. [25] S. Benhamou, J. Tuimala, C. Bouchardy, P. Dayer, A. Sarasin, A. Hirvonen, DNA repair gene XRCC2 and XRCC3 polymorphisms and susceptibility to cancers of the upper aerodigestive tract, Int. J. Cancer 112 (2004) 901–904. [26] L. Kadouri, Z. Kote-Jarai, A. Hubert, F. Durocher, D. Abeliovich, B. Glaser, T. Hamburger, R.A. Eeles, T. Peretz, A single-nucleotide polymorphism in the RAD51 gene modifies breast cancer risk in BRCA2 carriers, but not in BRCA1 carriers or noncarriers, Br. J. Cancer 90 (2004) 2002–2005. [27] A. Jakubowska, S.A. Narod, D.E. Goldgar, M. Mierzejewski, B. Masojc, K. Nej, J. Huzarska, T. Byrski, B. Gorski, J. Lubinski, Breast cancer risk reduction associated with the RAD51 polymorphism among carriers of the BRCA1 5382insC mutation in Poland, Cancer Epidemiol. Biomarkers Prev. 12 (2003) 457–459. [28] W. Wang, A.B. Spurdle, P. Kolachana, B. Bove, B. Modan, S.M. Ebbers, G. Suthers, M.A. Tucker, D.J. Kaufman, M.M. Doody, R.E. Tarone, M. Daly, H. Levavi, H. Pierce, A. Chetrit, G.H. Yechezkel, G. Chenevix-Trench, K. Offit, A.K. Godwin, J.P. Struewing, A single nucleotide polymorphism in the 5 0 untranslated region of RAD51 and risk of cancer among BRCA1/2 mutation carriers, Cancer Epidemiol. Biomarkers Prev. 10 (2001) 955–960. [29] A.R. Venkitaraman, Functions of BRCA1 and BRCA2 in the biological response to DNA damage, J. Cell Sci. 114 (2001) 3591– 3598.