A new member of the PBAN family in Spodoptera littoralis: molecular cloning and immunovisualisation in scotophase hemolymph

Insect Biochemistry and Molecular Biology 32 (2002) 901–908 www.elsevier.com/locate/ibmb

A new member of the PBAN family in Spodoptera littoralis: molecular cloning and immunovisualisation in scotophase hemolymph Francesc Iglesias a, Pilar Marco a, Marie-Christine Franc¸ois b, Francisco Camps a, Gemma Fabria`s a, Emmanuelle Jacquin-Joly b,∗ b

a Department of Biological Organic Chemistry, IIQAB, CSIC, Jordi Girona 18-26, E-08034 Barcelona, Spain INRA, Unite´ de Phytopharmacie et des Me´diateurs Chimiques, Baˆt. A, route de Saint-Cyr, F-78026 Versailles Cedex, France

Received 19 September 2001; received in revised form 19 October 2001; accepted 29 November 2001

Abstract In this article, we report evidence suggesting that the immunoreactive factor previously detected in Spodoptera littoralis scotophase hemolymph is PBAN, which supports a humoral route of the hormone to the pheromone gland. Western blot after nativePAGE of prepurified scotophase hemolymph extracts yielded an immunoreactive band with the same mobility as S. littoralis BrSOG factor and the expected mobility for a noctuid PBAN. This band was not detected in photophase hemolymph extract. The identity of S. littoralis Br-SOG factor as PBAN was obtained from cDNA cloning using RT-PCR strategy. This allowed us to deduce the amino acid sequence of Spl-PBAN, which is highly homologous to other known PBANs. Moreover, we found that the PBAN encoding cDNA also encoded four other putative amidated peptides (Spl-DH homologue, Spl-α-NP, Spl-β-NP and Spl-γNP) that are identical or highly conserved among noctuids, and two non amidated peptides of unknown function. This cDNA organization is common to all known cDNAs encoding PBANs, leading to the release of different peptides after putative enzymatic cleavage of the preprohormone.  2002 Elsevier Science Ltd. All rights reserved. Keywords: Pheromone biosynthesis activating neuropeptide; Diapause hormone; Molecular cloning; Lepidoptera; Spodoptera littoralis

1. Introduction Female moths produce and release species-specific sex pheromones to attract males for mating. Pheromone biosynthesis is hormonally regulated by the Pheromone Biosynthesis Activating Neuropeptide (PBAN) which is biosynthesized in the subesophageal ganglion (SOG). Abbreviations: Br-SOG, Brain-subesophageal ganglion complex; CC, Corpora Cardiaca; Ip, isoelectric point; IR, Immunoreactivity; MW, molecular weight; NP, neuropeptide; PAGE, Polyacrylamide Gel electrophoresis; PBAN, Pheromone Biosynthesis Activating Neuropeptide; PBAN-IR, PBAN immunoreactivity; RACE, Rapid Amplification of cDNA ends; RT-PCR, Reverse Transcription-Polymerase Chain Reaction; SGNP, Subesophageal ganglion neuropeptide; SOG, Subesophageal Ganglion; TAG, Terminal Abdominal Ganglion; TBS, Tris Buffer Saline; VNC, Ventral Nerve Chord ∗ Corresponding author. Tel.: +33-1-30-83-32-12; fax: +33-1-3083-31-19. E-mail address: [email protected] (E. Jacquin-Joly).

Three 33-residue pheromonotropic molecules have been isolated from the brain–SOG complex (Br-SOG) of adult moths and sequenced: Hez-PBAN from Helicoverpa zea (Raina et al., 1989), Bom-PBAN-I from Bombyx mori (Kitamura et al., 1989) and Lyd-PBAN from Lymantria dispar (Masler et al., 1994). Molecular cloning of PBAN-encoding cDNA from different species led to the obtention of PBAN deduced sequences in various species, including H. zea (Davis et al., 1992; Ma et al., 1994), B. mori (Kawano et al., 1992; Sato et al., 1993), the noctuids Mamestra brassicae (Jacquin-Joly et al., 1998), H. assulta (Choi et al., 1998), Agrotis ipsilon (Duportets et al., 1998) and, recently, the tortricid Adoxophyes sp. (Lee et al., 2001). PBANs are 33 or 34 amino acid peptides with an amidated C-terminus sharing significant homology. Structure-activity relationship studies have revealed that the C-terminal pentapeptide FXPLR-NH2 is the minimal sequence necessary for pheromonotropic activity (Raina and Kempe, 1990). Like many neuropep-

0965-1748/02/$ - see front matter  2002 Elsevier Science Ltd. All rights reserved. PII: S 0 9 6 5 - 1 7 4 8 ( 0 1 ) 0 0 1 7 9 - 5

902

F. Iglesias et al. / Insect Biochemistry and Molecular Biology 32 (2002) 901–908

tides of invertebrates, PBANs are synthesized as part of a larger precursor from which biologically active peptides are derived by posttranslational processing (Davis et al., 1992; Ma et al., 1994; Kawano et al., 1992; Sato et al., 1993; Jacquin-Joly et al., 1998; Choi et al., 1998; Duportets et al., 1998). It was shown that five peptides with the FXP(R or K)L-NH2 C-terminal portion, including PBAN, are encoded by the cDNA in H. zea (Ma et al., 1994). Later studies (Ma et al., 1996) have demonstrated that the five synthetic peptides, deduced from the oligonucleotide sequence of the PBAN-encoding gene, stimulate pheromone biosynthesis in H. zea. Based on HPLC fractionation and ELISA analysis of nervous tissue extracts, it was suggested that the five peptides are present in the SOG, corpora cardiaca (CC), thoracic ganglia and abdominal ganglia of H. zea (Ma et al., 1996). On the other hand, Ramaswamy et al. (1995) demonstrated the occurrence of pheromonotropic activity in HPLC fractions of hemolymph from scotophase H. zea females, suggesting that the hormone travels through hemolymph to the target tissue, the pheromonal gland (Ramaswamy et al.,1995). However, the retention time of the pheromonotropic fraction was not coincident with that of synthetic Hez-PBAN. Therefore, it is possible that several PBAN-related peptides and not only PBAN function to induce pheromone production in moths. Production of sex pheromone by the females of the Egyptian armyworm Spodoptera littoralis (Lepidoptera: Noctuidae) has been shown to be regulated by a cephalic factor (Fabria`s et al., 1994). Using an ELISA developed in our laboratory (Marco et al., 1995) we showed the existence of PBAN-immunoreactivity (PBAN-IR) in the SOG, CC and terminal abdominal ganglion (TAG) of virgin adult S. littoralis females during both photophase and scotophase (Marco et al., 1996). We also documented the presence of PBAN-IR and pheromonotropic activity in the hemolymph, but only during the period of pheromone production (Marco et al., 1996). Based on immunological detection and retention time in HPLC, this factor appeared to have PBAN-like characteristics (Iglesias et al., 1998). Here we report evidence suggesting that the immunoreactive factor present in S. littoralis scotophase hemolymph is PBAN, based on western blot analyses and determination of the S. littoralis PBAN (Spl-PBAN1) sequence, which was deduced from the PBAN-encoding cDNA sequence.2

2. Materials and methods 2.1. Insects S. littoralis larvae were reared on a wheat germ diet at 25±1 °C, with a light:dark cycle of 16 h:8 h. One week before the expected day of adult emergence, sexes were separated and pupae were transferred to a reversed photoperiod chamber with the same photoregime. Adults were segregated daily before the onset of the scotophase and fed with a 5% sucrose solution. M. brassicae were reared in Domaine du Magneraud (INRA, France) on a semi-artificial diet (Poitout and Bues, 1974) at 24 °C and 60% RH and sexed as pupae. Br-SOG of 2–3-day-old adult females were dissected in scotophase and stored in liquid nitrogen until use. 2.2. Protein extraction and hemolymph purification Proteins were extracted from 10 Br-SOG in 90/10 water/trifluoroacetic acid as described (Jacquin-Joly and Descoins, 1996). Hemolymph from 1000 females was taken from 2 to 3-day-old intact virgin insects either 2– 3 h after the onset of scotophase (scotophase extract), that correspond to the time of maximum PBAN-IR (Marco et al., 1996), or in the middle of photophase (photophase extract). Hemolymph (pools of 1 ml) was extracted in 9 ml of ethanol:water (1:1), centrifuged at 12,000 rpm for 5 min and the supernatant was dried down and stored at ⫺80 °C. The hemolymph extract was applied onto a C4 cartridge that was home-made with Vydac (Palo Alto, CA) C4 reverse phase. The cartridge was washed with 5 ml of water and 4 ml of 10% acetonitrile in water, both containing 0.1% TFA. PBAN-IR was eluted with 4 ml of 60% acetonitrile in water and 0.1% TFA. Fractions of 1 ml were collected and those containing PBAN-IR, as analyzed by ELISA (Marco et al., 1995), were subjected to HPLC fractionation. HPLC was carried out using a Waters Assoc. Model 626 pump, a Waters 996 diode array detector and a Waters Assoc. Model 600 S programming unit. Samples were injected with a Rheodyne 9125 (50 µl loop) injector. The analyses were performed using a Vydac (Hesperia, CA) C18 reversedphase column (25×0.46 cm, 5 µm). Fractionations were performed by gradient elution programmed linearly from (5:95) to (50:50) acetonitrile–water, both containing 0.1% TFA, over 30 min at a flow rate of 1 ml/min. One milliliter fractions were collected and those corresponding to PBAN-IR elution time (Iglesias et al., 1998) were pooled, dried down and stored at ⫺80 °C until western blot analysis. 2.3. Electrophoresis and western blot experiment

1

Nomenclature according to Raina and Ga¨ de (1988). 2 The sequence reported in this paper has been deposited in the GenBank database (accession no. AF401480).

Immunological detection was performed after nativePAGE. Native-PAGE was run on a vertical Mighty

F. Iglesias et al. / Insect Biochemistry and Molecular Biology 32 (2002) 901–908

Small II apparatus (Hoefer Scientific Instrument, San Francisco) (Jacquin-Joly et al., 1998). After nativePAGE, proteins were blotted on Immobilon-P (Millipore) overnight in a HSI Transphor unit in Tris 20 mM, Glycine 192 mM, pH=8.5, at 80 mA constant. Non-specific sites on the membranes were blocked for 3×40 min in Tris Buffer Saline (TBS) (20 mM Tris, 137 mM NaCl, pH=7.6) with 5% non-fat dry milk, briefly rinsed in TBS-T (TBS-0.1% Tween 20) and then incubated with a home-made Hez-PBAN antiserum (JacquinJoly and Descoins, 1996) (diluted 1/5000) overnight at 4 °C. After 3×30 min washing in TBS-T, membranes were incubated with secondary antibodies (horseradish peroxidase conjugated anti-rabbit Ig, dilution 1/10 000) for 1.5 h at room temperature. After 3×30 min washing in TBS-T, binding was detected using enhanced chemiluminescence kit (ECL, Amersham) and visualized after 3 min exposure on Hyperfilm MP (Amersham). The standard used for the immunodetection was BomPBAN-I (Peninsula Laboratories, U.K.) at 5 pmol per well. M. brassicae Br-SOG extract were also used as control. 2.4. RNA extraction and cDNA synthesis Total RNAs were extracted from 100 female Br-SOG with the Tri-Reagent (Euromedex). Single stranded 3⬘ready-cDNA and 5⬘-ready-cDNA were synthesized from 1 µg of total RNAs at 42 °C for 1.5 h using the SMART RACE cDNA Amplification Kit (Clontech) with 200 u of Superscript II (Gibco, BRL), and with 5’CDS-primer and SMART II Oligonucleotide for 5⬘ready-cDNA and with 3⬘CDS-primer for the 3⬘-readycDNA, according to the kit instructions. 2.5. Polymerase chain reaction Three PCR were performed in order to amplify the complete cDNA coding for Spl-PBAN. The first one was conducted using two degenerate primers to amplify an internal part of the cDNA, then 3⬘ and 5⬘ RACE-PCR were performed using the obtained part of the sequence. The 2 degenerate primers used for the first internal PCR were described in Jacquin-Joly et al. (1998) and consisted of sense DH primer :5⬘GSIYTITGGTTYGGN CC3⬘ and antisense PB primer 5⬘TACATYTCYTGRTCI GCNGG3⬘. This PCR was performed using approximately 1 ng of 3⬘-ready-cDNA and 5 units of Taq Polymerase (Promega) in the same conditions as for Mab-PBAN amplification (Jacquin-Joly et al., 1998). 3’RACE amplification was performed on 2.5 µl of 3⬘ready-cDNA with Universal Primer Mix (UPM, Clontech) as an antisense anchor primer vs. a sense gene specific primer designed according to the cDNA sequence obtained from the internal amplification:

903

3⬘RACE up primer 5⬘GCAGATGAACCTGAAAACCG AGTTACC3⬘ (Isoprim). 5’RACE amplification was performed on 2.5 µl of 5⬘ready-cDNA with Universal Primer Mix (UPM, Clontech) as a sense anchor primer vs. an antisense gene specific primer designed according to the cDNA sequence obtained from the internal amplification: 5⬘RACE low primer 5⬘TCATCAGCCAACCGTCTTCC CAATCGT3⬘ (Isoprim). For each 3⬘ and 5⬘ RACE PCR, 50 µl amplification mix were prepared according to the SMART RACE cDNA Amplification kit instructions using the Advantage 2 Polymerase mix (Clontech). Touchdown PCR was performed using hot-start as follows: after 1 min at 94 °C, five cycles of 30 s at 94 °C and 3 min at 72 °C, then five cycles of 30 s at 94 °C, 30 s at 70 °C and 3 min at 72 °C, then 25 cycles of 30 s at 94 °C, 30 s at 68 °C and 3 min at 72 °C, then 5 min at 72 °C. 2.6. Cloning and sequencing The amplified internal cDNA was purified after agarose electrophoresis using GenElute (Supelco) and ligated into the plasmid pCR-II using the TOPO cloning kit from Invitrogen (The Netherlands). After transformation, positive clones were digested with EcoRI (Biolabs) to screen for the presence of inserts. Recombinant plasmids were then isolated using Plasmid Midi kit from Qiagen and were subjected to automated sequencing with vector promotors by Genomexpress (France). 3⬘ and 5’ RACE amplifications were directly sequenced from the gene specific primer after elution from the agarose gel using QIAquick Gel Extraction Kit (Qiagen). Data base searches were performed with the BLAST program (NCBI) and sequence alignment with the ClustalW (NPS@ IBCR). Theoretical isoelectric points (Ip) were calculated using MWCALC from Infobiogen considering a free C-terminus.

3. Results 3.1. Western blot analyses After native-PAGE electrophoresis and electrotransfer on a PVDF membrane, we checked the quality of the hemolymph extracts by staining the membrane with Ponceau red [Fig. 1(A)]. Both scotophase and photophase extracts appeared to have the same protein amount, by using the same quantity of starting material and purification procedure. No protein bands were visible in either the Br-SOG extracts or the standards due to the very low quantities of proteins present in these extracts. Immunodetection was then performed by using polyclonal antibodies raised against synthetic Hez-PBAN, which showed to be specific for the corresponding pep-

904

F. Iglesias et al. / Insect Biochemistry and Molecular Biology 32 (2002) 901–908

Fig. 1. Western blot analyses. (A). Ponceau red staining of the PVDF membrane after native-PAGE and electrotransfert. (B). Immunological detection using anti-Hez-PBAN (1/5000) and Enhance ChemiLuminescent detection (ECL, Amersham) (exposure time: 3 min).

tide and cross-reacted with Bom-PBAN-I (Jacquin-Joly and Descoins, 1996) and Mab-PBAN (Jacquin-Joly et al., 1998). Using this Hez-PBAN antiserum, we were able to detect an immunoreactive peptide in female Br-SOG extracts of S. littoralis [Fig. 1(B)]. Synthetic peptide Bom-PBAN-I was also detected. S. littoralis IR peptide and Mab-PBAN had the same mobility on native-PAGE, whereas Bom-PBAN-I has a different electrophoretic mobility. Furthermore, we were able to detect in scotophase hemolymph extracts, but not in photophase, a PBANimmunoreactive band that migrated at the same position as the immunoreactive peptide present in S. littoralis BrSOG extract [Fig. 1(B)]. 3.2. cDNA cloning Using degenerate primers PB and DH, we were able to obtain an amplified DNA fragment of 300 bp. This DNA was cloned and sequenced. The deduced amino acid sequence showed an open reading frame with high sequence homology to known PBAN preprohormone sequences. The entire cDNA sequence was obtained by 3⬘ and 5⬘ RACE strategies. The total cDNA sequence and the corresponding amino acids are shown in Fig. 2. This cDNA consisted of 788 bases with an open reading

Fig. 2. Nucleotide sequence of the complete S. littoralis PBAN cDNA and deduced amino acid sequence. The suggested start ATG and stop TAA codons are in bold italics. Polyadenylation signal is shown in bold letters. Predicted endoproteolytic cleavage sites of the preprohormone are bracketed. Arrows below the nucleotide sequences represent the position of the different synthetic primers used in PCR.

frame of 572 bases encoding a 192 amino acid protein. As for the other PBAN preprohormones, it was assumed that the cDNA-deduced protein would be processed by endoproteolytic cleavages at basic sites to define the putative Spl-PBAN sequence and other neuropeptides. The putative Spl-PBAN consists of 33 amino acids, with a putative amidation site at G-157 that leads to L-156amide. Its calculated MW is 3822.2 d (⫺1 if amidated) with a Ip of 4.65. The deduced Spl-PBAN amino acid sequence is compared to the PBAN sequences from other species in Fig. 3. Spl-PBAN is very similar to the other PBAN sequences in the literature (Table 1) and shares with them the C-terminal fragment FSPRL-NH2. Four other peptides, flanked by potential monobasic and dibasic cleavage sites KK, RR, KR and R, were also deduced from the cDNA sequence and were called SplDH homologue, Spl-α, Spl-β and Spl-γ neuropeptides (NP), as long as they have been cloned from total brain extracts (Fig. 3, in boxes). These additional peptides showed homologies with putative peptides deduced from cDNA encoding PBAN in H. zea (Ma et al., 1994), B. mori (Sato et al., 1993), M. brassicae (Jacquin-Joly et al., 1998), H. assulta (Choi et al., 1998), A. ipsilon (Duportets et al., 1998), and Pss-PT, a pheromonotropic peptide isolated from Pseudaletia separata heads (Matsumoto et al., 1992a) (Table 1). This homology is even 100% between Spl-α-NP and Hez-, Hea-, Agi- and Mab-putative α-NP, as well as between Spl-β-NP and Mab-β-NP and also between Spl-γ-NP and Hez-, Hea-, Agi- and Mab-putative γ-NP (Table 1). All these three

F. Iglesias et al. / Insect Biochemistry and Molecular Biology 32 (2002) 901–908

905

Fig. 3. Alignment of the deduced amino acid sequences of the PBAN preprohormone of different species. Lyd-PBAN and Pss-PT protein sequences were also included. In boxes: the different putative amidated peptides cleaved after preprohormone proteolysis. In bold: the R, RR, KK, KR motifs for proteolysis. DH=diapause hormone; NP=neuropeptide.

additional peptides contain the C-terminal sequence F(S/T)P(R/K)L and a presumed amidated C-terminus, due to the presence of a glycine residue at the cleavage sites. A putative DH homologue is also present with high homologies with putative Agi-, Hea-, Hez-DH homologues and Bom-DH (Table 1).

4. Discussion The physiological mode of action of PBAN has long been a matter of controversy. Two apparently conflicting hypotheses coexist on how PBAN regulates sex pheromone biosynthesis in moths. One hypothesis (humoral route) suggests that PBAN is transferred from the SOG to the CC and then released into the hemolymph to stimulate pheromone biosynthesis by acting directly on

the pheromone gland (Raina, 1993). According to the second hypothesis (neural route), PBAN is transported through the VNC to the TAG, where it exerts its action by triggering the release of octopamine, which then stimulates the pheromone gland for pheromone production (Christensen et al., 1991, Teal et al., 1989). The studies so far conducted in S. littoralis (Marco et al., 1996) suggest that both humoral and neural routes are involved in PBAN regulation of sex pheromone production in this species. The humoral route was evidenced by the presence of PBAN-IR and pheromonotropic activity in the hemolymph of females only at the time of pheromone production. However, whether PBAN was responsible for both immunoreactivity and bioactivity could not be concluded in our previous studies. In agreement with results reported on M. brassicae (Iglesias et al., 1998) and H. zea (Ramaswamy et al., 1995), when the presence of PBAN-IR was investigated in scotophase

Table 1 Identity pourcentages between S. littoralis peptides and their homologues deduced from PBAN preprohormone sequences in different species. /: means data not available if the cDNA sequence is not known. Databank accession number and references are also given for each sequence Species

DH (%)

PBAN (%)

α-NP (%)

β-NP (%)

γ-NP (%)

Accession number

References

S. littoralis H. zea H. assulta A. ipsilon M. brassicae B. mori A. sp L. dispar P. separata

– 72 72 76 / 68 36 / /

– 87.9 87.9 90.1 93.5 72.7 42.2 84.8 /

– 100 100 100 100 85.7 100 / /

– 94.5 94.5 77.8 100 33.3 45 / 89

– 100 100 100 100 87.5 50 / /

AF401480 M80588 U96761 AJ009674 AF044079 D13437 AF395670 AAB32665 P25271

This publication Davis et al. (1992} Choi et al. (1998) Duportets et al. (1999) Jacquin-Joly et al. (1998) Sato et al. (1993) Lee et al. (2001) Masler et al. (1994) Matsumoto et al. (1992a, b)

906

F. Iglesias et al. / Insect Biochemistry and Molecular Biology 32 (2002) 901–908

female hemolymph from S. littoralis after HPLC fractionation (Iglesias et al., 1998), the most immunoreactive fraction had the same retention time as that of synthetic Hez-PBAN, but some other fractions were also immunoreactive. It could not be determined whether the immunoreactivity of the fraction with the retention time of Hez-PBAN was due to S. littoralis PBAN or to different cross-reacting peptide(s). The results of the western blot analysis reported here support that PBAN is present in the scotophase hemolymph of S. littoralis females, but not in photophase hemolymph (Fig. 1). Electrophoretic separation of prepurified hemolymph extracts yielded an immunoreactive band with the same mobility as M. brassicae and S. littoralis Br-SOG extracts, which corresponds to the electrophoretic mobility of Hez-PBAN (Jacquin-Joly et al., 1998), thus suggesting similar shapes and charges. Additionally, similar molecular weights (MW) can be inferred from our previous SDSPAGE analysis (Jacquin-Joly et al., 1998), which showed that the PBAN immunoreactive species of S. littoralis Br-SOG had a MW very similar to those of other PBANs. Further support for the identity of PBAN as the immunoreactive species present in the hemolymph of S. littoralis detected in the western blot comes from the molecular cloning reported here. The obtention of SplPBAN encoding cDNA sequence allowed us to deduce the amino acid sequence of Spl-PBAN and its physicochemical characteristics such as MW and Ip, consistent with the migration position of the observed IR band. Mab-, Hez- and Spl-PBAN theoretical Ip are exactly the same (Ip=4.65) and they share the same position in native-PAGE, whereas their Ip differ from that of BomPBAN (Ip=4.32) which migrates more (Fig. 1). These Ip differences could explain the different migration of the peptides in native-PAGE, where separation occurs according to shape and charge. The Spl-PBAN amino acid sequence has been aligned with all the known PBAN sequences (Fig. 3). They present a consensus sequence with a homologous domain at the C-terminal part: (D/E)SRX(K/R)YFSPRLNH2. Putative Spl-PBAN is highly homologous to other known PBAN peptides: from 93 to 87% within noctuids, 72% with Bom-PBAN, but only 42% with the tortricid moth Adoxophyes sp. (Table 1). As in the other peptides, amidation of the Spl-PBAN C-terminal Leu residue should occur, since this amidation has been shown to be essential for pheromonotropic activity of PBAN molecules (Kitamura et al., 1989; Raina et al., 1989). The obtention of the full length cDNA sequence allowed us to study the structure of the PBAN gene. SplPBAN encoding cDNA also encoded four other putative amidated peptides: Spl-DH homologue, Spl-α-NP, Splβ-NP and Spl-γ-NP. This organization is highly conserved among all the insect species so far studied (Kawano et al., 1992; Davis et al., 1992; Sato et al., 1993; Ma et al., 1994; Choi et al., 1998; Jacquin-Joly et

al., 1998; Duportets et al., 1998), affording peptides upon putative enzymatic cleavages of the preprohormone that predominantly occur at basic amino acid residues (for a review in invertebrates see Veenstra, 2000). Such a processing leads to the release of at least five peptides after cleavage at KR, KK, RR, and R sites. However, the cleavage sites have been only confirmed in a few cases: Bom-DH (KR site) (Sato et al., 1993), Bom-PBAN (Sato et al., 1993) and Hez-PBAN (Ma et al., 1994) (RR and R sites). The other sites, KK and monobasic R, have been suggested to be processed leading to the release of α-, β- and γ-NP, but they remain ambiguous, as discussed by Veenstra (2000), and need to be confirmed. In particular, the site KK has an aliphatic amino acid (V or I) in the +1 position in all the species studied, that is supposed to inhibit cleavage. The five derived peptides have the C-terminal sequence FXPRL-NH2 that has been shown to be associated with myotropic activity (Nachman and Holman, 1991; Fonagy et al., 1992; Kuniyoshi et al., 1992; Schoofs et al., 1992), embryonic diapause (Imai et al., 1991) and cuticular tanning (Matsumoto et al., 1990, 1992b), but their function remains unknown. One of the putative neuropeptides, Spl-β-NP, presents 89% homology to Pss-PT, the pheromonotropin of P. separata (Table 1). Pss-PT was not deduced from a cDNA sequence, but it was actually purified and sequenced, which supports the idea that these putative peptides arise from cleavage of the preprohormone. These NP peptides (Spl-α-NP, β-NP and γ-NP) are identical or highly conserved among noctuids, whereas they differ from BomSGNP, with only 33% identities between Spl-β-NP and Bom-β-SGNP (Table 1). These data show that differences in sequence identity are consistent with the phylogenetic distance between the species. S. littoralis, H. zea, M. brassicae , A. ipsilon and P. separata are all noctuid moths and share very high homology in their NP peptides. The bombicidae B. mori showed less conserved sequences, and even lower homologies were observed with DH, PBAN, β- and γ-NP homologues of the tortricid Adoxophyes (Table 1). A peptide sequence similar to Bom-DH is also located near the N-terminus of the deduced prepro-Spl-PBAN sequence (Fig. 3). This sequence appeared to have the common C-terminal pentapeptide motif FXPRL and a putative NH2. We do not know if this peptide is cleaved from the preprohormone in S. littoralis and the biological significance of this DH homologue is unknown in this species. Considering the six potential cleavage sites found in the preprohormone, the processing should lead in fact to the release of seven different peptides. In addition to the already described DH, PBAN and α-, β- γ-NP, there are two other putative peptides (between DH/α-NP and at the C-terminal, Fig. 3) that are not amidated and that did not match any known sequence in BLAST (NCBI)

F. Iglesias et al. / Insect Biochemistry and Molecular Biology 32 (2002) 901–908

search. However, their potential function cannot be excluded and remains to be investigated. When the presence of PBAN-IR was investigated in both Br-SOG and scotophase female hemolymph extracts from S. littoralis after HPLC fractionation (Iglesias et al., 1998), we noticed the presence of low levels of PBAN-IR in HPLC fractions other than that corresponding to Hez-PBAN. Our present results on cDNA organization in S. littoralis might explain the occurrence in both Br-SOG and hemolymph of other PBAN-encoding gene neuropeptides as those reported in H. zea (Ma et al., 1994). They all share the same Cterminus which is recognized by the antibodies previously developed in our laboratories, whose specificity is directed towards the C-end of PBAN, and can thus be detected by the ELISA. Furthermore, several pheromonotropic peptides can be present in the fraction corresponding to the elution time of Hez-PBAN both in BrSOG and hemolymph extracts of our previous study. The western blot presented here clarified and confirmed the observed PBAN-IR in the scotophase hemolymph: among all the peptides released after the preprohormone cleavage, only Spl-PBAN possess the physico-chemical characteristics that allowed a migration at the same position as Mab- or Hez-PBAN. The results presented in this article strongly support our previous hypothesis on a humoral route of PBAN. Taking into account the results obtained in previous studies, the neural route cannot be ruled out. However, the identity of the PBAN-immunoreactivity associated with nervous tissues, such as VNC, CC and TAG, is still an open question. Unfortunately, Western blot analyses, as performed with hemolymph extracts, are so far experimentally impracticable with the above mentioned tissues because of the large amounts of material required.

Acknowledgements This work was supported by French-Spanish PICASSO project No. 00700NH, CAICYT (grant AGF98-0844), Generalitat de Catalunya (grant 99SGR00187) and INRA funds. We thank Germa´ n La´ zaro for rearing S. littoralis.

References Christensen, T.A., Itagaky, H., Teal, P.E.A., Jasensky, R.D., Tumlinson, J.H., 1991. Innervation and neural regulation of the sex pheromone gland in female Heliothis moths. Proc Natl. Acad. Sci. USA 88, 4971–4975. Choi, M.Y., Tanaka, M., Kataoka, H., Boo, K.S., Tatsuki, S., 1998. Isolation and identification of the cDNA encoding the pheromone biosynthesis activating neuropeptide and additional neuropeptides

907

in the oriental tobacco budworm, Helicoverpa assulta (Lepidoptera:Noctuidae). Insect Biochem. Mol. Biol. 28, 759–766. Davis, M.T., Vakharia, V.N., Henry, J., Kempe, T.G., Raina, A.K., 1992. Molecular cloning of the pheromone biosynthesis-activating neuropeptide in Helicoverpa zea. Proc. Natl. Acad. Sci. USA 89, 142–146. Duportets, L., Gadenne, C., Dufour, M.C., Couillaud, F., 1998. The pheromone biosynthesis activating neuropeptide (PBAN) of the black cutworm moth, Agrotis ipsilon: immunohistochemistry molecular characterization and bioassay of its peptide sequence. Insect Biochem. Mol. Biol. 28, 591–599. Duportets, L., Gadenne, C., Couillaud, F., 1999. A cDNA, from Agrotis ipsilon, that encodes the pheromone biosynthesis activating neuropeptide (PBAN) and other FXPRL peptides. Peptides 20, 899–905. Fabria`s, G., Marco, M.P., Camps, F., 1994. Effect of the pheromone biosynthesis activating neuropeptide on sex pheromone biosynthesis in Spodoptera littoralis isolated glands. Arch. Insect Biochem. Physiol. 27, 77–87. Fonagy, A., Schoofs, L., Matsumoto, S., De Loof, A., Mitsui, T., 1992. Functional cross-reactivities of some locustamyotropins and Bombyx Pheromone Biosynthesis Activating Neuropeptide. J. Insect Physiol. 38, 651–657. Iglesias, F., Marco, M.P., Jacquin-Joly, E., Camps, F., Fabria`s, G., 1998. Regulation of sex pheromone biosynthesis in two noctuid species, S. littoralis and M. brassicae, may involve both PBAN and the Ventral Nerve Cord. Arch. Insect Biochem. Physiol. 37, 295–304. Imai, K., Konno, T., Nakazawa, Y., Komiya, T., Isobe, M., Koga, K., Goto, T., Yaginuma, T., Sakakibara, K., Hasegawa, K., Yamashita, O., 1991. Isolation and structure of diapause hormone of the silkworm Bombyx mori. Proc. Japan Acad. 67B, 98–101. Jacquin-Joly, E., Descoins, C., 1996. Identification of PBAN-like peptides in the Brain-Subesophageal ganglion complex of Lepidoptera using Western-blotting. Insect Biochem. Molec. Biol. 26, 209–216. Jacquin-Joly, E., Burnet, M., Franc¸ ois, M.C., Ammar, D., Nagnan-Le Meillour, P., Descoins, C., 1998. cDNA cloning and sequence determination of the pheromone biosynthesis activating neuropeptide of Mamestra brassicae: a new member of the PBAN family. Insect Biochem. Molec. Biol. 28, 251–258. Kawano, T., Kataoka, H., Nagasawa, H., Isogai, A., Suzuki, A., 1992. cDNA cloning and sequence determination of the pheromone biosynthesis activating neuropeptide of the silkworm, Bombyx mori. Biochem. Biophys. Res. Commun. 189, 221–226. Kitamura, A., Nagasawa, H., Kataoka, H., Inoue, T., Matsumoto, S., Ando, T., Suzuki, A., 1989. Amino acid sequence of pheromonebiosynthesis-activating neuropeptide (PBAN) of the silkworm, Bombyx mori. Biochem. Biophys. Res. Commun. 163, 520–526. Kuniyoshi, H., Nagasawa, H., Ando, T., Suzuki, A., Nachman, R.J., Holman, G.M., 1992. Cross-activity between Pheromone Biosynthesis Activating Neuropeptide (PBAN) and Myotropic Pyrokinin insect peptides. Biosci. Biotech. Biochem. 56, 167–168. Lee, J.M., Choi, M.Y., Han, K.S., Boo, K.S., 2001. Cloning of the cDNA encoding pheromone biosynthesis activating neuropeptide in Adoxophyes sp. (Lepidoptera: Tortricidae): a new member of the PBAN family. GenBank, Direct Submission. Ma, P.W.K., Knipple, D.C., Roelofs, W.L., 1994. Structural organization of the Helicoverpa zea gene encoding the precursor protein for pheromone biosynthesis-activating neuropeptide and other neuropeptides. Proc. Natl. Acad. Sci. USA 91, 6506–6510. Ma, P., Roelofs, W.L., Jurenka, R.A., 1996. Characterization of PBAN and PBAN-encoding gene neuropeptides in the central nervous system of the corn earworm moth, Helicoverpa zea. J. Insect Physiol. 42, 257–266. Marco, M.P., Fabria`s, G., Camps, F., 1995. Development of a highly

908

F. Iglesias et al. / Insect Biochemistry and Molecular Biology 32 (2002) 901–908

sensitive ELISA for the determination of PBAN and its application to the analysis of hemolymph in Spodoptera littoralis. Arch. Insect. Biochem. Physiol. 30, 369–381. Marco, M.P., Fabria`s, G., Lazaro, G., Camps, F., 1996. Evidence for both humoral and neural regulation of sex pheromone biosynthesis in Spodoptera littoralis. Arch. Insect. Biochem. Physiol. 31, 157–167. Masler, E.P., Raina, A.K., Wagner, R.M., Kochansky, J.P., 1994. Isolation and identification of a pheromonotropic neuropeptide from the brain-suboesophageal ganglion complex of Lymantria dispar: a new member of the PBAN family. Insect Biochem. Molec. Biol. 24, 829–836. Matsumoto, S., Kitamura, A., Nagasawa, H., Kataoka, H., Orikasa, C., Mitsui, A., Suzuki, A., 1990. Functional diversity of a neurohormone produced by the subesophageal ganglion: molecular identity of melanization and reddish coloration hormone and pheromone biosynthesis activating neuropeptide. J. Insect Physiol. 36, 427– 432. Matsumoto, S., Fonagy, A., Kurihara, M., Uchiumi, K., Nagamine, T., Chijimatsu, M., Mitsui, T., 1992a. Isolation and primary structure of a novel pheromonotropic neuropeptide structurally related to leucopyrokinin from the armyworm larvae, Pseudaletia separata. Biochem. Biophys. Res. Commun. 182, 534–539. Matsumoto, S., Yamashita, O., Fonagy, A., Kurihara, M., Uchiumi, K., Nagamine, T., Mitsui, T., 1992b. Functional diversity of a pheromonotropic neuropeptide: induction of cuticular melanization and embryonic diapause in lepidopteran insects by Pseudaletia pheromonotropin. J. Insect Physiol. 38, 847–851. Nachman, R.J., Holman, G.M., 1991. Myotropic insect neuropeptide families from the cockroach Leucophaea madera: structure-activity relationships. In: Menn, J.J., Kelly, T.J., Masler, E.P. (Eds.), Insect Neuropeptides: Chemistry, Biology and Action. American Chemical Society, Washington, DC, pp. 194–214. Poitout, S., Bues, R., 1974. Elevage de 28 espe`ces de le´ pidopte`res

Noctuidae et de 2 espe`ces d’Arctiidae sur milieu artificiel simplifie´ . Particularite´ selon les espe`ces. Ann. Zool. Ecol. Anim. 6, 431–441. Raina, A.K., 1993. Neuroendocrine control of sex pheromone biosynthesis in Lepidoptera. Ann. Rev. Entomol. 38, 329–349. Raina, A.K., Ga¨ de, G., 1988. Insect peptide nomenclature. Insect Biochem. 18, 785–787. Raina, A.K., Kempe, T.G., 1990. A pentapeptide of the C-terminal sequence of PBAN with pheromonotropic activity. Insect Biochem. 20, 849–851. Raina, A.K., Jaffe, H., Kempe, T.G., Keim, P., Blacher, R.W., Fales, H.M., Riley, C.T., Klun, J.A., Ridgway, R.L., Hayes, D.K., 1989. Identification of a neuropeptide hormone that regulates sex pheromone production in female moths. Science 244, 796–798. Ramaswamy, S.B., Jurenka, R.A., Linn, C.E., Roelofs, W.L., 1995. Evidence for the presence of a pheromonotropic factor in hemolymph and regulation of sex pheromone production in Helicoverpa zea. J. Insect Physiol. 41, 501–508. Sato, Y., Oguchi, M., Menjo, N., Imai, K., Komiya, T., Saito, H., Ikeda, M., Isobe, M., Yamashita, O., 1993. Precursor polyprotein for multiple neuropeptides secreted from the suboesophageal ganglion of the silkworm Bombyx mori: characterisation of the cDNA encoding diapause hormone presursor and identification of additional peptides. Proc. Natl. Acad. Sci. USA 90, 3251–3255. Schoofs, L., Holman, G.M., Hayes, T.K., Nachman, R.J., Kochansky, J.P., DeLoof, A., 1992. Isolation, identification and synthesis of locustamyotropin III and IV, two additional neuropeptides of Locusta migratoria: members of the locustamyotropin peptide family. Insect Biochem. Molec. Biol. 22, 447–452. Teal, P.E.A., Tumlinson, J.H., Oberlander, H., 1989. Neural regulation of sex pheromone biosynthesis in Heliothis moths. Proc Natl Acad Sci USA 86, 2488–2492. Veenstra, J.A., 2000. Mono- and dibasic proteolytic cleavage sites in insect neuroendocrine peptide precursors. Arch. Insect Biochem. Physiol. 43, 49–63.