Human fibulin-1D: Molecular cloning, expression and similarity with S1–5 protein, a new member of the fibulin gene family

Matrix Biology Vol. 15/1996/97, pp. 4 7 9 - 4 9 3 © 1997 by Gustav Fischer Verlag

Human Fibulin-1 D: Molecular Cloning, Expression and Similarity with $ 1 - 5 Protein, a New Member of the Fibulin Gene Family HUAN TRAN*, MAREVA MATTEI*, SVETLANA GODYNA* and W. S C O T T A R G R A V E S *+ * Biochemistry Department, American Red Cross, Rockville, Maryland USA and + Cell Biology and Anatomy Department, Medical University of South Carolina, Charleston, South Carolina, USA.

Abstract Fibulin-1 is an extracellular matrix (ECM) component of basement membranes and connective tissue elastic fibers, and a blood protein. Multiple forms of fibulin-1 that differ in their C-terminal regions are produced through the process of alternative splicing of their precursor RNA. Two transcripts of 2.4 and 2.7kb are the predominant fibulin-1 mRNAs expressed in human tissues and cultured cells. While the 2.4kb transcript had been shown to encode fibulin-lC, the 2.7kb transcript did not correspond to any of the previously identified human fibulin-1 variants. Herein, we report on the isolation and sequencing of cDNA corresponding to the 2.7 kb fibulin-1 transcript which encodes a novel, alternatively spliced form of human fibulin-I that we term the D form. The deduced amino acid sequence of the D form is identical in its first 566 residues to the three known fibulin-1 variants (fibulin-lA-C); however, it has a unique 137amino acid-C-terminal segment encoded by the alternatively spliced portion of its transcript. RNA hybridization analysis showed that the fibulin-lD transcript is coordinately expressed with that of fibulin-lC both in tissues and in cultured cells. Using antibodies specific to the unique C-terminal segment of fibulin-lD and -1C, both proteins were found to be expressed in human placenta. Recombinant fibulin-lD generated in transfected mammalian cells displayed similar ligand-binding properties as placenta-derived fibulin-1 and recombinant fibulin-lC, and it was capable of incorporating into cultured cell ECM in the absence of other fibulin-1 forms. A comparative sequence analysis revealed that the unique C-terminal region of fibulin-lD is similar to the C-terminal regions of fibulin-lC and fibulin-2. Furthermore, the C-terminal regions of fibulin-lC, -1D and -2 are similar to the C-terminal region of a recently described protein termed $1-5. In addition to this C-terminal similarity, $1-5 also contains repeated EGF-like modules and a conserved N-terminal element, thereby leading to the conclusion that $1-5 is a third member of the fibulin gene family. Key words: fibulin, protein $1-5.

Introduction The process of alternative splicing of transcripts derived from a single gene is a fundamental feature of eucaryotic gene expression. The usual end result of the process is the production of variant polypeptides having functional diver-

sity conferred by the variably spliced exons. The ECM l and plasma glycoprotein fibulin-1 have multiple variant forms 1 Abbreviations used: ECM, extracellular matrix; EGF, epidermal growth factor; Fg, fibrinogen; FN, fibronectin; MEM/EBSS, minimal essential medium/Earle's balanced sodium salt; PBS, phosphate buffered saline; PCR, polymerase chain reaction.

480

H. Tran et al.

produced through the process of alternative splicing of their precursor RNA (Argraves et al., 1990). The various alternatively-spliced transcripts (three have been identified in human to date, designated A, B and C) have 1707 nucleotides in common at their 5' end, but they have differing 3' segments. The translation products from these transcripts share a common 566amino acid-N-terminal segment and differ in their C-termini. It remains to be established whether the isoforms of fibulin-1 all have distinct functions and are expressed differentially. Interspecies homologues of fibulin-1 have been identified in human (Argraves et al., 1990), mouse (Kluge et al., 1990; Pan et al., 1993a) and chicken (Spence et al., 1992). Immunohistological analyses of adult and embryonic tissues have revealed fibulin-1 to be a widely expressed ECM protein often associated with basement membranes and connective tissue elastic fibers (Kluge et al., 1990; Spence et al., 1992; Roark et al. 1995). In the developing chicken and mouse embryo, prominent expression of fibulin-1 and its mRNA is seen at sites of epithelial-mesenchymal transitions such as endocardial cushions, developing myotomes, tooth and hair follicles, and neural crest (Spence et al., 1992; Zhang et al., 1993, Zhang et al., 1995; Bouchey et al., 1996; Zhang et al., 1996). These later findings have prompted speculation as to the importance of fibulin-I in organogenesis, particularly in the formation of heart valves and septa that derive from endocardial cushions. Fibulin-1 is also present in the plasma of both mouse and human at concentrations of 30-50btg/ml (Argraves et al., 1990; Kluge et al., 1990), and recent evidence suggests that it may have a role in hemostasis and thrombosis (Tran et al., 1995; Godyna et al., 1996). As a result of our efforts to characterize the expression of the human fibulin-1 mRNAs in cell lines and tissues, we observed a widely expressed transcript that hybridized with cDNA probes from the common regions of the fibulin-lA, B and C, but failed to hybridize with probes from the individual alternatively spliced segments. Based on these resuits, we speculated that this transcript might represent a novel alternatively spliced product of the human fibulin-1 gene. The present manuscript reports on the isolation and characterization of cDNA corresponding to this transcript and shows that it encodes a new variant of human fibulin1 that we term the D form.

Materials and Methods

Antibodies The fibulin-1 monoclonal antibodies 3 A l l and 5D12 have been described previously (Argraves et al., 1990). The epitope for the 3 A l l antibody maps to the N-terminal region of fibulin-1 within residues 30-153, while the epitope for the 5D12 antibody maps to the C-terminal region of fibulin-lC within residues 567-683 (data not shown). The

fibronectin (FN) monoclonal antibody IIIGG52H10 was prepared against the 42 kDa gelatin-binding fragment of FN (unpublished data, Argraves and Ingham). The 3All and 5D12 IgGs were purified by protein G-Sepharose (Pharmacia, Piscataway, NJ) chromatography. A rabbit polyclonal antibody (811) against fibulin-lD was made to the C-terminal portion of fibulin-lD (residues 567-703). This polypeptide was expressed in bacteria as a fusion protein with maltose-binding protein using the pMAL-2 expression vector (New England BioLabs, Beverly, MA).

Proteins Human placental fibulin-I was isolated from detergent extracts of term placenta by immunoaffinity chromatography using 3AI 1 lgG-Sepharose as previously described in Argraves et al. (1990). Recombinant human fibulin-I D and -C were immunoaffinity purified from serum-free conditioned culture medium of cells stably transfected with fibulin-lD or -C-expressing constructs (see below). Human FN was purified from plasma as described by Miekha et al. (1982). Human fibrinogen (Fg) was purchased from Enzyme Research Laboratories, Inc. (South Bend, IN). Ovalbumin was obtained from Sigma Chemical Co. (St. Louis, MO).

Isolation and sequencing of fibulin- 1D cDNA Total RNA (1 ~g) from human gingival fibroblasts was used with oligo-dT primer (200ng), RNasin (30U, Promega Biotech, Madison, WI), lmM deoxynucleotide triphosphates (Pharmacia, Piscataway, NJ) and Moloney murine leukemia virus reverse transcriptase (200U, Gibco BRL, Gaithersburg, MD) to synthesize eDNA. Polymerase chain reaction (PCR) amplification was performed using 1/25th of the cDNA product as template, deoxynucleotide triphosphates (0.25mM each), Taq DNA polymerase (2.5 U, Boehringer Mannheim, Indianapolis, IN), poly-deoxynucleotide adenosine (18 met, 800ng) as a downstream primer, and a 17-base oligonucleotide (800ng) whose sequence was derived from position 1657 to 1674 in the fib ulin-1 nucleotide sequence (Argraves et al., 1990). The following temperature parameters were cycled 35 times: I rain at 94°C, 2min at 42°C, and 3rain at 72°C. The reaction mixture was electrophoresed on a 1% agarose gel and the amplified product excised and purified using a Qiagen extraction system (Chatsworth, CA). The isolated DNA product was then ligated into the plasmid vector pCRII (lnvitrogen, San Diego, CA), and both strands were sequenced using an Applied BioSystems model 373A DNA Sequencer.

RNA isolation and hybridization analysis RNA was isolated from various cultured human cell lines by guanidinium isothiocyanate extraction followed by cen-

Molecular Cloning of Fibulin-lD trifugation in CsCI solutions, essentially according to the method of Ullrich et al. (1977). Ten ~tg aliquots of each RNA preparation were electrophoresed on 1% agarose gels containing 6% formaldehyde and then transferred to nitrocellulose membranes. The membranes were hybridized in 10% dextran sulfate, 4 0 % formamide, 4x SSC, 20ram Tris, pH 7.4, lx Denhardt's and 20~tg/ml salmon sperm DNA at 42 °C with cDNA probes radiolabeled with [~_~2p] dCTP using a QuickPrime Kit (Pharmacia). After hybridization, the membranes were washed twice with 2x SSC, 0.1% SDS at room temperature for 20rain, followed bv a wash with 0.2x SSC, 0.1% SDS at 55°C for 20rain and a final wash with 0.2x SSC, 0.1% SDS at 60°C for 20rain. The membranes were dried and used to expose Kodak XAR film a t - 7 0 °C.

Reverse transcriptase-PCR analysis of fibulin- 1A-D transcripts expressed in human tissues Human tissue poly A + RNAs were purchased from Clontech (Palo Alto, CA) and used to prepare cDNA using reverse transcriptase and random primers as described before (Argraves et al., 1990). cDNA preparations were analyzed for fibulin-1 mRNA by PCR as described in Argraves et al. (1990). The polymerase chain reaction amplification was performed as described above. Primer pairs specific for the cDNA of fibulin -1A, -B, -C and -D were taken from the following positions within the respective target DNA sequence: 1657-1673 and 2142-2159 for A, 1442-1458 and 1802-1818 for B, 1442-1458 and 1967-1983 for C, and 1183-1199 and 1807-1830 for D. The following temperature parameters were cycled 35 times for PCR: l rain at 94 °C, 2min at 50 °C and 3min at 72 °C. Control reactions were performed using aliquots of RNA to which no reverse transcriptase was added.

Expression of fibulin- 1D and -C in HT1080 fibrosarcoma cells Full length cDNA encoding fibulin-lD and -C were assembled from restriction fragments of PCR-generated cDNAs encoding N-terminal and C-terminal portions of each mRNA. Briefly, an EcoRI-AccI restriction digestion of a PCR product (nucleotides 1 to 1396) was done to obtain a fragment containing nucleotides 1 to 1380. AccI and EcoRI digestion of PCR products encoding C-terminal regions of C and D was done to obtain fragments that contained nucleotide residues extending from 1381 and containing the unique alternatively spliced segments of each form. The fragments were ligated into an EcoRI linearized pBluescript (SK-) vector (Stratagene, La Jolla, CA). Full length cDNAs for each form were excised by using Xhol and Xbal digestion and ligated into XhoI-Xbal-cleaved eucaryotic expression vector pcDNAINeo (Invitrogen, San Diego, CA). The resulting plasmids included 37bp of the 5' untranslated re-

481

gion of fibulin-1 mRNA, and either the 2200 bp or 2195 bp coding regions of fibulin-lC or -D, respectively, followed by 161 bp or 92bp of 3' untranslated region of fibulin-lC or -D, respectively. The integrity of each cDNA insert was confirmed by DNA sequencing analysis. The construct design placed the fibulin-1 cDNAs under the transcriptional control of the human cytomegalovirus promoter. The pcl)NAINeo-fibulin-ll) or -C plasmids were introduced into a non-fibulin-l-expressing cell line, human fibrosarcoma HT1080 cells (ATCC CCL-121), by using calcium phosphate transfection with reagents supplied in a kit (Gibco BRL). Tile cells were grown in complete medium containing 0.6mg/ml Geneticin (G418, Gibco BRL), and colonies of resistant cells were isolated after 4-6 weeks. The conditioned culture medium (serum-free, minimal essential medium/Earle's balanced sodium salt (MEM/EBSS), Hychme, Logan, UT), 100units/ml penicillin, 1001ug/ml streptomycin (Gibco BRL)) from clones of the isolated cells was screened by immunoblotting analysis using mouse monoclonal fibulin-1 antibody. Cell lines expressing highest levels of fibulin-1 were used for large scale protein purification. For this purpose, cells were grown to confluency in 150mm culture dishes (Corning, Corning, NY) in MEM/EBSS with 10 % (v/v) of bovine calf serum (Hyclone, I.ogan, UT), 100units/ml of penicillin, 100~tg/ml of streptomycin (Gibco BRI.) and 0.6 mg/ml of G418 (Gibco BRL). The medium was replaced with serum-free medium and the cells grown for 2-3 days. The medium was then collected, centrifuged at 5000xg and then the supernatant supplemented with pbenyhnethylsulfonyl fluoride (1 raM) and EDTA (5mxl). The medium was applied to a column of Sepharose CL4B, and the flow-through was applied to a column of anti-fibulin- 1 lgG-Sepharose. Bound fibulin- 1 was eluted with a solution of 4 M KSCN. After dialysis against TBS, the fibulin-l-containing solution was adsorbed on heparinSepharose and gelatin-Sepharose to remove any FN, as described previously (Godyna et al., 1994).

hnmunoblot analysis lmmunoblotting analysis was performed according to methods described in Tran et al. (1995).

Solid phase binding assays An ELISA was used to analyze the binding interaction of recombinant fibulin-lD or -C with FN and Fg, using methods described in Balbona et al. (1992). Briefly, microtiter wells were coated with either FN, Fg or ovalbumin (each at 3 ~tg/ml), unoccupied sites were blocked with 3 % non-fat dried milk, and the coated wells were incubated with varying concentrations of fibulin-I (recombinant fibulin-lC or -D or placental-derived fibulin-1). Bound fibulin-I was detected by using the fibulin-1 monoclonal antibody (3All). Bound antibodies were detected by using goat anti-mouse

482

H. Tran et al,

TTCCGCTGCCTGGCCTTCGAGTGCCCTGAGAACTACCGCCGCTCCGCAGCCACYGCTCCAGCAGGAGAAGACA 1726 F

R

C

L

A

F

E

C

P

E

N

Y

R

R

S

A

A

T

L

Q

Q

E

K

T

572

GACACGGTCCGCTGCATCAAGTCCTGCCGCCCCAACGATGTCACATGCGTGTTCGACCCCGTGCACACCATC1798 D

T

V

R

C

I

K

S

C

R

P

N

D V

T

C V

F

D

P

V

H

T

I

596

TCCCACACCGTCATCTCGCTGCCTACCTTCCGCGAGTTCACCCGCCCTGAAGAGATCATCTTCCTCCGGGCC1870 S

H

T

V

I

S

L

P

T

F

R

E

F

T

R

P

E

E

I

I

F

L

R

A

ATCACGCCACCGCATCCTGCCAGCCAGGCTAACAICATCTTCGACATCACGGAAGGGAACCTGCGGGACTCT I T P P H P A S Q A N I I F D I T E G N L R D S

620 1942 644

TTTGACATCATCAAGCGTTACATGGACGGCATGACCGTGGGTGTCGTGCGCCAGGTGCGGCCCATCGTGGGC 2014 F

D

I

I

K

R

Y

M

D

G

M

T

V

G

V

V

R

Q

V

R

P

I

V

G

668

CCATTTCATGCCGTCCTGAAGCTGGAGATGAACTATGTGGTCGGGGGCGTGGTTTCCCACCGAAATGTTGTC 2086 P

F

H A

V

L

K

L

E

M N

Y

V

V

G G V

V

S

H

R N

V

V

692

AACGTCCGCATCTTCGTCTCTGAGTACTGGTTCTGAGGGCTGGTCTGCCGCACAGCCGCAGGTGCACCTCCA 2158 N

V

R

I

F

V

S

E

Y

W

F

703

-

GGCCAAATCATTGCTGCCAGTGACTGTGGTCTGTACTTGTTTATACCCTCAGACTTTTTTAATGTTAGGTAT 2230 GTGTAGCATAAGGCCAACATGTATCAAGCTGAGCCAGATGAATAAGTCCATCTGATGTATTTTCGGTGTTTA2302 AAAAATGAGCCCAGTTGCTCAACTGTGTGGGTGAAAACCTTGCTCATTTTTTAATGC 2359 Fig.1. DNA and deduced amino acid sequences of the human fibulin-I I) ahernatively spliced region. The downward pointing arrow indicates the position of the splice junction site. Sequence to the left of thc arrow is identical to sequence present in the mRNAs cncoding all of the fibulin-I forms. Sequence to the right of the arrow corresponds to the alternatively spliced region of fibulin-1D. The nucleotide and amino acid numberings are relative to the full length fibulin-I sequences rcportcd in Argraves et al. (I 990). The 1)NA scqucncc for human fibulin-lD is present m Genbank under the accession number UO 1244.

lgG conjugated to horseradish peroxidase (BioRad Laboratories) and the substrate 3,3',5,5'-tetramethylbenzidine (Kierkegaard & Perry, Gaithersburg, MD).

Indirect immunofluorescent staining Transfected H T I 0 8 0 cells were seeded onto glass cover slips and grown to confluency in MEMIEBSS, 0.6mg/ml (]418, and 10 % bovine calf serum (absorbed on anti-fibulin-l-Sepharose to remove fibulin-1). To induce FN matrix assembly, cells were treated with dexamethasone (1 O0 rex1 in MEM/EBSS) (Sigma) as described by McKeown-lxmgo and Etzler (1987). Coverslips with bound cells were washed with Dulbecco's phosphate buffered saline (PBS) and fixed with 3.7 % paraformaldehyde (Fluka AG, Buchs, Switzerland), PBS for 30 rain at ft. The coverslips were then washed with PBS, incubated in 3 % normal goat serum, PBS (PBS-serum) for 1 h at rt and incubated with either fibulin-1 monoclonal antibody (3A11) or FN monoclonal antibody (IIIGG52H1 O) in PBS-serum for 2 h at 37 °C. The coverslips were washed and incubated with goat antimouse IgG-fluorescem (Cappel Laboratories, Gaithersburg, MD) in PBS-serum for 20 min at room temperature and examined/photographed using an ()lympus BHS epifluorescent microscope.

Results The 2.7 kb film~in-1 transcript encodes a novel/brnz of fibulin- 1 RNA hybridization analyses had previously revealed that RNA prcparations fr(ml different cell lines (including gingival fibroblasts, and WI-38- and IMR-90-lung fibroblasts) contained 2.4 and 2.7 kb transcripts that hybridized with cDNA probes derived from the overlapping regions of fibulin-lA, B and C. However, the 2.7kb transcript did not hybridize with eDNA probes from the alternatively spliced domains of the three known forras. We therefore tested the hypothesis that the 2.7 kb transcript encoded a novel alternatively sliced segment at its 3' end, like the other known splice variants. In order to isolate a cDNA encoding the putative alternatively spliced segment (hereafter referred to as the D form), we performed the rapid amplification ot c l ) N A ends protocol (Frohman, ct al. 1988). Using oligodA as a downstream primer and primers based on sequence from a region 5' to the splice junction common to fibulm1A, B, and C, PCR was performed with gmgival fibroblast cDNA as the template. This reaction yielded two major products of ~700 bp which were subcloned and sequenced. Shown in Figure 1 is the nucleic acid and deduced ammo acid sequence of a 704bp cl)NA. At the ,i" end is the se-

Molecular Cloning of Fibulin-lD quence of the synthetic primer followed by 34 residues that are identical to sequence preceding the splice site in fibulin1A, B and C. Immediately following these overlapping residues is a 685base stretch that does not correspond to sequences found in any of the three known splice variants of fibulin-1 or to any sequence in the Genbank database. The results indicate that the 704 bp cDNA has 5' sequence common to the three other fibulin-1 cDNAs, and at precisely the same position that the others diverge from one another, it too diverges. A second 748 bp cDNA was also sequenced and found to be completely overlapping the 704 bp cDNA. The 748 bp cDNA, however, extended 44 bp further toward the 5' end of the 704 bp cDNA, a result consistent with the difference in the positions of the primers used to generate each cDNA. These findings support the hypothesis that the 704 bp and 748 bp cDNAs were derived from a novel alternatively-spliced fibulin-1 mRNA. RNA hybridization analysis was performed using the 704 bp cDNA as a probe; as a result, a single 2.7kb transcript present in total gingival RNA was detected (Fig. 2, lane 1). This transcript corresponded in size to the larger of the two transcripts that were detectable using a cDNA probe from a region common to fibulin-lA, B and C (Fig. 2, lane 3). The smaller 2.4kb transcript corresponded in size to one detectable using a probe from the alternatively spliced segment of fibulin-lC (Fig. 2, lane 2). The results indicate that the 2.7kb fibulin-lD transcript contains an alternatively spliced segment corresponding to 3' portions of the two independently isolated 748 and 704 bp cDNAs.

Comparative sequence analysis of fibulin-lD Using the deduced amino acid sequence from the alternatively spliced segment of fibulin-lD mRNA, we searched the protein databases using the computer program BLASTP. The results showed that the D-specific C-terminal sequence was highly related (89 % identity over 137 residues) to the C-terminal portion of a murine fibulin-1 (Pan et al., 1993a). The high degree of similarity suggests that the human and mouse proteins are interspecies homologues. In addition to this relationship, the search showed that the fibulin-lD C-terminal region was similar to C-terminal regions of fibulin-lC and fibulin-2 (Pan et al., 1993b; Zhang et al., 1994). Shown in Figure 3 is an alignment of the C-terminal domain sequences of fibulin-lD, fibulin-lC and fibulin-2 with the corresponding percent similarity and identity values presented in Table I. The similarity between the C-terminal regions defines a fibulin-type module that is common to members of this family of proteins. The database search also revealed a similarity between the C-terminal regions of fibulin family members and the C-terminal region of a recently identified human protein referred to as S1-5 (Lecka-Czernik et al., 1995) (see Table I). In addition, the $1-5 protein has a series of EGF-like repeats that precede its C-terminal region, as do all members

1

28S

2

483

3

"

-2.7

kb

- 2.4 kb

18S

"

Fig. 2. Detection of fibulin-lD transcript by RNA hybridization analysis. Total RNA (10~g) from human gingival fibroblasts was electrophoresed on a 0.8 % agarose, 6 % formaldehyde gel and transferred to nitrocellulose membrane. The membrane was hybridized separately with a 32p-labeled cDNA corresponding to the alternatively spliced portion of fibulimlD (lane 1), a cDNA segment from the alternatively spliced portion of fibulin-lC (lane 2), and a cDNA from a region common to the known fibulin-1 variants (lane 3). Positions of the 18S and 28S ribosomal RNAs are indicated on the left. of the fibulin family. $1-5 and fibulin-1 also have an element that lies N-terminally to their first EGF-like modules (EGF-adjoining segment 1) and that shows 40 % similarity over 32 residues. Shown in Figure 3 is the alignment of the $1-5 protein with the complete sequence of fibulin-lD and the C-terminal regions of fibulin-lC and fibulin-2. Figure 4 shows a schematic diagram depicting the arrangement of structural modules in each of the three proteins. Differences exist in the number of EGF-like repeats that the three proteins contain as well as in the presence or absence of several other domains. For example, fibulin-1, fibulin-2 and $1-5 have 9, 10 and 6 EGF-like repeats, respectively. Fibulin-1 and 2 have three complement-like modules, while S1-5 lacks such modules. Fibulin-2 has two domains designated as the N-terminal cysteine-rich and the cysteine-free subdomains (Pan et al., 1993b) that are not present either in fibulin-1 or in $1-5. Inserted within the first EGF-like repeat of $1-5 is an 86-residue segment. While such an inser-

484

H . T r a n et a l .

--

I

=

I

I

I .

(.9 0

>

Z

~-

©Z

~

©

(D

O0 ~

<

m

J

0

-a

>- >-

U.

O 0

0

-~

£90

~

uu x~

_a_

.

.

.

.

o

.

.

.

.

.

.

.

'

,

.i

. . . . . .

w

0

II

0 0 0

0 > '

0

o w O

~ Z O

I

I

000 I

d

u.

-2~

u.

r~

i

I

b-

m

~z<

,

.

tt)

u9

<~

W

0 0 0

oo

o

-~

Oz

o

O~

c

54 u~

o

I

6

0

0 ~ 0

e

e66

z> e

I

<~

I

<~

OQ

D

0

0

0

0

0

0

~

g

e

6

e

g

g

e

~ Q

>

'

O0

Fig. 3. Alignment of the fibulin- 1D deduced amino acid sequence with the C-terminal domain sequences of fibulin- 1C, fibulin-2 and the complete sequence of $1-5 protein. Identical residues are indicated by black boxes, while chemically similar residues are indicated bx. gray boxes. The complement (anaphylatoxin)-like repeat domain is indicated by a Roman numeral 1, the EGF-like repeat containing re gions are indicated by a Roman numeral 1I, and the-C terminal regions are indicated by a Roman numeral 11I.

Molecular Cloning of Fibulin-lD tion is not present in either fibulin-1 or -2, EGF-like repeats contained within ECM proteins laminin-1 and perlecan do contain such an insertion (Schulze et al., 1995; Schulze et al., 1996). It is noteworthy that fibulin-1, -2 and S-15 protein have EGF-like repeats that contain potential Asn/Asp hydroxylation sites (Stenflo et al., 1988), and in each protein the four EGF-like repeats that precede the last EGF-like module contain hydroxylation sequences.

Fibulin-1D m R N A expression in cultured cell lines Using the 704 bp cDNA as a probe, we evaluated RNA preparations from various cell lines for the presence of the fibulin-lD transcript. As shown in Figure 5 (upper panel), the 2.7kb fibulin-lD mRNA was expressed by several types of cultured human cells, including WI-38-, VA-13-, IMR-90- and gingival fibroblasts, BeWo choriocarcinoma, A431 epidermal carcinoma, HEP-G2 hepatocellular carcinoma, WISH amnion, and MG63 osteosarcoma cells. Several cell lines did not express detectable levels of fibulin-lD mRNA, including umbilical vein endothelial, A375P melanoma, U937 histiocytic lymphoma, and HT1080 fibrosarcoma cells. When a cDNA probe from the region common to all the fibulins was used to probe the same RNA preparations, the results revealed that the fibulin-lD transcript was coordinately expressed with the 2.4 kb fibulin-lC transcript in all of the fibulin-1 expressing cell lines (Fig. 5, middle panel). In most cases, the relative amounts of the two transcripts expressed by the various cells were similar. The results indicate that fibulin-lD and C transcripts are co-expressed to a similar level by many types of cells.

Fibulin-1D m R N A expression in human tissues To evaluate RNA preparations from different human tissues for the expression of fibulin-lD mRNA, and to compare its expression to that of the other fibulin-1 messengers, we performed RT-PCR using primers specific for each form. As shown in Figure 6, a RT-PCR product of the size expected for the D-specific primers was obtained from all human tissue RNA preparations that were tested. Control reactions using the cDNA templates alone, or the cDNA

485

templates plus each primer separately, gave no products (data not shown). Using fibulin-lC-specific primers, products of the expected size were obtained from most of the tissue RNAs available. Although the assay was not designed to be quantitative, the levels of RT-PCR products corresponding to fibulin-lD and C were similar in all except skeletal muscle, heart and lung, where the fibulin-lD product was detectable; however, the fibulin-lC product was only slightly detectable. By contrast, the results using the fibulin-lA- and B-specific primers showed that the product corresponding to these two forms was obtained only from placental RNA. The results indicate that the fibulin-lD and C mRNAs are widely expressed in human tissues, whereas fibulin-lA and B are highly restricted in their pattern of expression, with placenta being the only known site of expression.

Fibulin-lD protein is expressed by human placenta An antiserum (811) was raised against a bacterially-expressed polypeptide corresponding to the C-terminal domain (residues 567-703) of fibulin-lD. This antiserum was used to establish that the newly identified fibulin-lD mRNA is indeed translated in vivo. Fibulin-1 preparations isolated from placental extracts, using a monoclonal fibulin-1 antibody (3All), were electrophoresed on SDS-containing polyacrylamide gels, transferred to nitrocellulose and probed with the fibulin-lD antiserum. As shown in Figure 7, the fibulin-lD antiserum reacted with a -100 kDa polypeptide present in the placental fibulin-1 preparations. To demonstrate specificity of the fibulin-lD antiserum, it was also incubated with preparations of fibulin-1D and C that were expressed in stably transfected human cell lines (see below). The results show that the fibulin-I D antiserum reacted with recombinant fibulin-lD (Fig. 7, panel C) but not with recombinant fibulin-lC. The fibulin-lC specific monoclonal antibody, 5D12, did not react with recombinant fibulin-lD (Fig. 7, panel B). The results indicate that fibulin-lD protein is expressed in human term placenta along with fibulin-lC, consistent with the expression of their respective transcripts as described above.

Table I. Sequence identity and similarity between the carboxy terminal regions of fibulin-lC, fibulin-lD, fibulin-2 and S1-5 protein. Percent Identity Fibulin-lC Percent Similarity

Fibulin-lC Fibulin- 1D Fibulin-2 S1-5

32.17% 59.66 % 36.69%

Fibulin- 1D

Fibulin-2

81-5

24.47%

47.05% 17.48 %

28.05% ! 9.75 % 17.27%

25.17% 28.03%

28.06%

Amino acid residues 567-683 from human fibulin-lC (Argraves et al., 1990), residues 567-703 from human fibulin-lD, residues 1040-1157 from human fibulin-2 (Zhang et al. 1994) and residues 376-493 from human $1-5 protein (Lecka-Czernik et al., 1995) were used in the sequence comparison.

depicting

#

the xrmgemcnt

Cys-free domain

Fig,4.S&ematic diagram

_

#

m

Complement repeat

Cys-rich domain

I)

Signal peptide

Fibulin-3

Fibulin-2

Fibulin-I

0

Segment 2

Segment 1

of structural elements with iibulinmIAmD, fib&-2

EGF-adjoining

EGF-adjoining

site

site

COOH

COOH

I)

Potential AsnlAsp hydroxylation site

Potential 0-glycosylation

Potential N-glycosylation

Fibulin-type module

137

-_COOH

and thr Sl-.5 protein iflbulin-3).

7

EGF-like repeat with insertion 7

EGF-like repeat

. .

.

COOH (566)

COOH .. :: 35

C.

z.

Molecular Cloning of Fibulin-lD

12345

487

6 7 8 9 10 11 12 13 14 -28S

-18S

-28S

-18S

-28S

-18S Fig. 5. Analysis of the expression of the fibulin-lD transcript in various cultured human cell lines. Total RNA isolated from A375P melanoma cells (lane 1), U937 histiocytic lymphoma cells (lane 2), umbilical vein endothelial cells (lane 3), HTI080 fibrosarcoma cells (lane 4), BeWo choriocarcinoma cells (lane 5), placenta (lane 6), A431 epidermal carcinoma cells (lane 7), HepG2 hepatocellular carcinoma cells (lane 8), WISH amnion cells (lane 9), MG63 osteosarcoma cells (lane 10), VA13 (SV-40 transformed WI-38 fibroblasts) (lane 11) and WI-38 lung fibroblasts (lane 12). IMR90 lung fibroblasts (lane 13) and gingival fibroblasts (lane 14) were hybridized with 32Pqabeled 704bp cDNA (fibulin-1D alternatively spliced region) (upper panel), or a labeled cDNA from a region common to all the fibulinI forms (middle panel/. The lower panel shows the ethidium bromide stained filter before hybridization. Positions of the 18S and 28S ribosomal RNAs are indicated on the right.

Fibulin-1D can bind to fibronectin and fibrinogen Recombinant fibulin-lD was evaluated for its ability to bind to two known fibulin-1 ligands, FN and Fg. As shown in Figure 8, recombinant fibulin-lD bound to wells coated with either FN or Fg but not to wells coated with ovalburain. By comparison with recombinant fibulin-lC and placental fibulin-1, fibulin-1D displayed similar relative binding affinity for each protein. As has been experienced previously with studies of in vitro binding of fibulin-1 to FN and Fg (Balbona et al., 1992, Tran et al., 1995), saturable binding was not achieved. This is attributed to the fact that fibulin-1 can self-associate (Balbona et al., 1992). The results

indicate that fibulin-lD is capable of binding to FN and Fg with similar affinity as placenta-derived fibulin-1 and recombinant fibulin-lC. Furthermore, it is evident that the fibulin-lC and D forms are capable of independently binding F N and Fg and do not require a heteromeric complex of fibulin- 1 forms. Fibulin-1D can incorporate into extracellular matrix As another measure of its functionality, the ability of fibu l i n - l D to incorporate into ECM was evaluated. HT1080 cells did not express fibulin-1 m R N A (Fig. 5) or protein, and they were therefore an ideal host for fibulin-lD-ex-

D

C

B

A

Fig. 6. RT-PCR analysis of hnman tissue RNA preparations for fibulin-1A-D transcripts. Pairs of synthetic oligonucleotide primers taken from regions upstream and downstream of the splice site (position 1707) fibulin-lA (panel A), -IB (pallei B), -1C (panel C), and -ID (panel D) were used in PCR to amplify cDNAs prepared from various humall tissues poly A + RNA. The expected sizes for the amplification product from each primer pair were 502 bp, 376 bp, 542 bp and 647 bp, respectively. The products were electroph{~rt's~'d on 1% agarose gels and stained with ethidium bromide. Molecular weight standards shown in lane 1 are from a Hae I11 digest of (DX 174 I)NA; the fragment sizes are illdicatcd on the left in bp.

872603-

603-

310-

603-

603-

t ,-r

Molecular Cloning of Fibulin-lD

A 1 200

-

116

-

B 2

3

4

1

489

C 2

3

4

1

2

3

4

97-

6645Fig. 7. Immunological detection of fibulin-lD in placental-derived fibulin-1 preparations. Recombinant fibulin-1D (lane 2), -1C (lane 3), placental derived fibulin-1 (lane 4) and molecular weight standards (lane 1) were electrophoresed oll a SDS-containing 7.5 % polyacrylamide gel under reducing conditions and transferred to nitrocellulose paper. Duplicate filters were stained with either Ponceau S (panel A), fibulin-lC monoclonal antibody 5D12 (panel B) or fibulin-lD specific polyclonal 811 (panel C). The data shown are a representative three experiments.

pressing constructs. We have previously demonstrated that fibulin-1, added exogenously to HT1080 cells, incorporated into the ECM after treatment of the cells with dexamethasone (Godyna et al., 1994). This is consistent with the fact that fibulin-1 matrix incorporation is dependent on FN matrix assembly, and HT1080 cells only assemble FN following dexamethasone treatment (McKeown-Longo and Etzlet, 1987). As shown in Figure 9, fibulin-lD or C expressed by transfected HT1080 cells did not incorporate into immunofluorescently-detectable ECM fibers when the cells were grown in the absence of dexamethasone (Fig. 9, panels E and I). Similarly, FN expressed by these cells also failed to incorporate into ECM in the absence of dexamethasone (Fig. 9, panels C, G and K). After dexamethasone treatment, however, the fibulin-lD and C expressed by the transfected cells became incorporated into ECM fibers detectable by using fibulin-1 monoclonal antibody (Fig. 9, panels F and J). In cells transfected with the vector alone, no fibulin-1 immunostaining was detected in the presence or absence of dexamethasone treatment (Fig. 8, panels A and B). The fibulin-lD, C and vector-transfected cell lines each incorporated FN into ECM after treatment with dexamethasone (Fig. 9, panels D, H and L). These results indicate that fibulin-lD and C are individually capable of incorporating into ECM in the presence of FN matrix assembly.

Discussion Fibulin-1, like several other ECM proteins such as FN (Schwarzbauer et al., 1983) and tenascin (Erickson and Bourdon, 1989), has multiple isoforms that are produced through the process of alternative splicing of pre-mRNA. Herein we describe the characterization of an alternatively spliced 2.7kb transcript encoding a novel form of human fibulin-1, fibulin-lD. The D protein has the first 566 amino acids in common with the other alternative spliced forms (A-C) but differs in its carboxyl terminus, having a unique 137 amino acid segment. The deduced amino acid sequence of the entire fibulin-lD polypeptide has a molecular mass of 77,274 daltons, 2,811 daltons larger than fibulin-I C (M r =74,463). Fibulin-lD represents the fourth alternativelyspliced human form thus far identified; however, based on transcriptional abundance and pattern of expression, it represents a predominant form ahmg with fibulin-lC. The transcripts for the fibulin-lA and B isoforms are rare, having been detected only in placental RNA preparations. The 2.7kb fibulin-lD transcript was detected in several types of fibroblasts, epithelial and tumor cell RNA preparations. The D transcript was consistently found to be coordinately expressed along with the 2.4 kb fibulin-I C mRNA. Neither transcript, however, was detectable in RNA from umbilical vein endothelial cells or the melanoma line

0.0

1

.I

m

........

........

100

I

........

I

,

1000

[Fibulin-1], nM

10

I

0.0

0.4

0.8

0.8

0.4

1.2

1.6

1.2

Fibronectin Fibrinogen Ovalbumin

2.0

1

I,,I--,

l • •

B

10

.... I

........

100

I

........

1000

I

[rFibulin-lC], nM

,~

Fibronectin Fibrinogen

,

,,

i

1

•

10

100

Fibronectin

1000

[rFibulin-1 D], nM

C _

Fig. 8. Fibulm-11) binding to fibronectin and fibrinogen in solid phase binding assavs. Microtiter wells were coated with FN, Fg and ovalbumin (each ar 3 pg/ml). Tile coated wells wcrc incubated with varying concentrations of placenta derived fibulin-1 (panel A), recombinant human fibulin-1C (panel B) or recombinant human fibulm-lD (panel (7). Bound fibulin- 1 isoforms wcrc detected using the monoclonal libulin- 1 antibody 3A I 1 followed b) peroxidase conjugated goat anti-rabbit IgG and the peroxidase substratc TMB. The data shown are representative o f six experiments.

<

..(3 O

tO I.O ¢O (l.} O c"

E

• • 1.6 -A

2.0

A

-H

-r

~ O

J

F

B

+ Dex

II

I'(

@

C

- Dex

L

D

+ Dex

Anti-Fibronectin I

Fig.9. Fibulin-lD expressed by transfected HTI080 cells is incorporated into ECM following dexamethasone induction. Confluent monolayers of HTI080 cells transfected with either pcDNAINeo-fibulin- ID (hFiblD) (panels I-L), pcl)NAINc'o-fibulin- 1C (hFiblC) (panels E-H) or pcDNAINeo vector (Neo) (panels A-D) were treated with (B, F, J, D, H and I.) or without (A, E, 1, C, G and K) 100 nxt dexamethasone for 72h. Cell layers were then fixed with 3.7 % paraformaldehyde and stained with either monoclonal anti-fibulin-I (A, B, E, F, 1 and J) or anti-FN (C, D, (;, H, K and L), and fluorescein conjugated-goat anti-mouse IgG.

hFiblD

hFiblC

Neo

- Dex

Anti-Fibulin-1

x,D

-Ix

i

¢-

©

¢_.

492

H. Tran et al.

A375P. The histiocytic lymphoma line U937 did not express fibulin-1 transcripts, nor did other lymphomyloid lines, including Molt-4 lymphoblastic leukemia, KG-1 myeloblasts and peripheral blood monocytes (not shown). These latter cells, like circulating blood cells, typically do not produce an ECM. The fibrosarcoma cell line H T I 0 8 0 , which produces only small amounts of FN and is incapable of assembling a FN matrix (Oliver et al., 1983; McKeownLongo and Etzler, 1987), also fails to express the fibulin-1 mRNAs. When fibulin-lD or C expressing plasmid constructs was introduced into HT1080 cells, the expressed fibulins incorporated into ECM after the cells were induced to assemble a FN matrix by treatment with dexamethasone. This is consistent with the paradigm that fibulin- 1 incorporation into ECM requires an ongoing process of FN matrix assembly (Godyna et al., 1994). Comparative sequence analysis of the 137amino acid segment encoded by the alternatively spliced portion of the fibulin-lD transcript revealed that it was similar to the Cterminal regions of fibulin-I C and fibulin-2. The conservation between these C-terminal regions defines a novel "fibulin-type module" having globular structure as revealed by rotary shadowing (Sasaki et al., 1995). Database analysis revealed that such a fibulin-type module is also present in the C-terminal region of the protein referred to as S1-5 (Lecka-Czernik et al., 1995). In addition, $1-5 contains repeated EGF-like modules arranged amino terminally to the fibulin-type module, just as in fibulins 1 and 2, and an EGF-adjoining segment similar to that present in fibulin-1. The structural similarity between the fibulins and $1-5 leads us to speculate that $1-5 may represent a novel, third, member of the fibulin gene family (fibulin-3). Rather little is known about S 1-5 other than that it is widely expressed (Ikegawa et al., 1996) and that its expression is enhanced in senescent and quiescent cells (Lecka-Czernik et al., 1995). it remains to be determined if S1-5 is associated with ECM like the other fibulins. During the course of our work on this project, an alternatively spliced form of mouse fibulin-1 was described (Pan et al., 1993a). Comparative sequence analysis indicates that the C-terminal amino acid sequence of the mouse protein is 89 % identical to the C-terminal portion of human fibulin1D and of the same length (137 residues). This high degree of similarity suggests that the human and mouse proteins are interspecies homologues. Importantly, while our biochemical studies showed no difference in the ability of fibul i n - l D and fibulin-lC to bind to either FN or Fg, Sasaki et al. (1995) showed that the mouse fibulin-ID had 100-fold lower affinity for nidogen as compared to fibulin-IC. This evidence indicates that the alternative splicing of the C-terminal domain of fibulin- 1 results in structural variants having distinct ligand binding activities and, therefore, potentially distinct functions.

Acknowledgements The authors wish to thank Dr. Isaiah Fiddler, MD Anderson Cancer Center, Houston, Texas, for providing us with the melanoma line A375R This work was supported by grant GM 42 912 from the National Institutes of Health.

References Argraves, W.S., Tran, H., Burgess, W.H. and Dickerson~ K.: Fibulin is an extracellular matrix and plasma glycoprotcin with repeated domain structure J. Cell Biol. 111 : 3155-3164, 1990. Balbona, K., Tran, H., Godyna, S., Ingham, K.C., Strickland, D.K. and Argraves, W.S.: Fibulin binds to itself and to the CI-terminal heparin-binding region of fibr(mectin. J. Biol. Chem. 267: 20120-20125, 1992. Bouchey, D., Argraves, W.S. and Little, CD.: Fibulm I, vitronectin, and fibronectin expression during avian cardiac valve and septa development. Anat. Rec. 244: 540-551,1996. Erickson, H.P. and Bourdon, M.A.: Tenascin: an extracellular matrix protein prominent in specialized embryonic tissues and tumors. Annu. Rev. Cell. Biol. 5: 71-92, 1989. Frohman, M.A., Dush, M.K. and Martin, G.R.: Rapid production of full-length cDNAs from rare transcripts: Amplification using a single gene-specific oligonucleotide primer. Proc. Natl. Acad. Sci. USA 85: 8998-9002,1988. Godyna, S., Mann, D.M. and Argraves, W.S.: A quantitative analysis of the incorporation of fibulin-1 into extracellular matrix indicates that fibronectin is required. Matrix Biol. 14: 467-477,1994. Godyna, S., Diaz-Ricart, M. and Argraves, W.S.: Fibulin-I inedi ates platelet adhesion via a bridge of fibrinngen. Blood 88: 2569-2577,1996. Ikegawa, S., Toda, T., Okui, K. and Nakamura, Y.: Structure and chromosomal assignment of the human S1-5 gene (FBLN) that is highly homologous to fibrillin. Genomics 35: 590-592, 1996 Kluge, M., Mann, K., Dziadek, M. and Timpl, R.: Characterization of a novel calcium-binding 90-kDa glycoprotein (BM-90) shared by basement membranes and serum. Eur. J. Biochem. 193:651-659, 1990. Lecka-Czernik, B., Lumpkin, C.K., Jr. and Goldstein, S.: An overexpressed gene transcript in senescent and quiescent human fibroblasts encoding a novel protein in the epidermal growth factor-like repeat family stimulates DNA synthesis. Mol. Cell. Biol. 15: 120-8,1995. McKeown-Longo, P.J. and Etzler, C.A.: Induction of fibrnnectin matrix assembly in human fibrosarcoma cells by dexamethasone. J. Cell Biol. 104: 601-610, 1987. Miekka, S.l., lngham, K.C. and Menache, D.: Rapid methods for isolation of human plasma fibronectin. Thromb. Res. 27: 1-14, 1982. ()liver, N., Newby, R.E, Furcht, L.T.and Bourgeois, 8.: Regulation of fibronectin biosynthesis by glucocorticoids in human fibrosarcoma cells and normal fibroblasts. Cell 33: 287-296, 19813. Pan, T.-C., Klugc, M., Zhang, R. Z., Mayer, U., Timpl, R. and Chu, M.-L.: Sequence of extracelhllar mouse protein BM 90/fibulin and its calcium dependent binding to other basementmembrane/igands. Eur. J. Biochem. 215: 733-740, 1993a. Pan, "[:-C., Sasaki, T., Zhang, R.-Z., Fassler, R., Timpl, R. and Chu, M.-1,.: Structure and expression of fibulin-2, a novel extracellular matrix protein with multiplc EGF-like repeats and con sensus motifs for calcium binding. I. Cell Biol. 123:1269-1277, 1993b.

Molecular Cloning of Fibulin-lD Roark, E.E, Keen, D.R., Haudenschild, C.C., Godyna, S., Little, C.D. and Argraves, W.S.: The association of human fibulin-1 with elastic fibers: an immunohistological, ultrastructural, and RNA study. J. Histochem. Cytochem. 43: 401-411, 1995. 8asaki, T., Kostka, G., Gohring, W., Wiedemann, H., Mann, K., Chu, M.-L. and Timpl, R.: Structural characterization of two variants of fibulin-I that differ in nidogen affinity. J. Mol. Biol. 245: 241-250,1995. Schulze, B., Mann, K., Battistutta, R., Wiedemann, H. and Timpl, R.: Structural properties of recombinant domain III-3 of perlecan containing a globular domain inserted into an epidermalgrowth-factor-like motif. Eur. J. Biochem. 231 : 551-556, 1995. Schulze, B., Mann, K., Poschl, E., Yamada, Y. and Timpl, R.: Structural and functional analysis of the globular domain IVa of the laminin 0~1 chain and its impact on an adjacent RGD site. Biochem. J. 314: 847-851, 1996. Schwarzbauer, J.E., Tamkun, J.W., Lemischka, I.R. and Hynes R.O.: Three different fibronectin mRNAs arise by alternative splicing within the coding region. Cell 35: 421-431, 1983. Spence, S.G., Argraves, W.S., Wakers, L., Hungerford, J.E. and Little C.D.: Fibulin is localized at sites of epithelial-mesenchyreal transitions in the early avian embryo. Dev. Biol. 151: 473-484, 1992. Stenflo, J., Ohlin, A.K., Owen, W.G. and Schneider, W.J.: Beta-hydroxyaspartic acid or beta-hydroxyasparagine in bovine low density lipoprotein receptor and in bovine thrombomodulin. J. Biol. Chem. 26.3: 21-24, 1988. Tran, H., Tanaka, A., Litvinovich, S.V., Medved, L.V., Haudenschild, C.C. and Argraves, W.S.: The interaction of fibulin-I with fibrinogen: A potential role in hemostasis and thrombosis. J. Biol. Chem. 270: 19458-19464, 1995.

493

Ullrich, A., Shine J., Chirgwin, J., Pictet, R., Tischer, E., Rutter, W.J. and Goodman, H.M.: Rat insulin gene: Construction of plasmids containing the coding sequences. Science 196: 1313,1977. Zhang, H.-Y., Chu, M.-L., Pan, T.-C., Sasaki, T., Timpl, R. and Ekblom, P.: Extracellular matrix protein fibulin-2 is expressed in the embryonic endocardial cushion tissue and is a prominent component of valves in adult heart. Dev. Biol. 167: 18-26, 1995. Zhang, H.-Y., Kluge, M., Timpl, R., Chu, M-L. and Ekblom, P.: The extracellular matrix glycoproteins BM-90 and tenascin are expressed in the mesenchyme at sites of endothelial-mesenchymal conversion in the embryonic mouse heart. Differentiation 52:211-220,1993.

Zhang, R.-Z., Pan, T.-C., Zhang, Z.-Y., Mattei, M.-G., Timpl, R. and Chu, M.-L.: Fibulin-2 (FB1.N2): human eDNA sequence, mRNA expression, and mapping of the gene on human and mouse chromosomes. Genomics 22: 425-430,1994. Zhang, H.-Y., Timpl, R., Sasaki, T., Chu, M.-L. and Ekblom, P.: Fibulin-1 and fibulin-2 expression during organogenesis in the development of mouse embryos. Devel. Dynam. 205: 348-364,1996.

Dr. W. Scott Argraves, Cell Biology and Anatomy Department, Medical University of South Carolina, 171 Ashley Avenue, Charleston, SC 29425-2204

Received: October 3, 1993; accepted November 21, 1996