Cloning, Mapping, andin VivoLocalization of a Human Member of the PKCI-1 Protein Family (PRKCNH1)

GENOMICS

36, 151–156 (1996) 0435

ARTICLE NO.

Cloning, Mapping, and in Vivo Localization of a Human Member of the PKCI-1 Protein Family (PRKCNH1) PIUS M. BRZOSKA,* HONGYING CHEN,* NIKKI A. LEVIN,* WEN-LIN KUO,† COLIN COLLINS,† KAREN K. FU,* JOE W. GRAY,† AND MICHAEL F. CHRISTMAN*,1 *Department of Radiation Oncology and †Division of Molecular Cytometry in the Department of Laboratory Medicine, University of California, San Francisco, California 94143 Received January 9, 1996; accepted March 19, 1996

Protein kinase C (PKC) is a family of serine/threonine kinases that participate in signal transduction events (Hug and Sarre, 1993; Nishizuka, 1992). Ten isozymes that respond to a variety of hormonal stimuli have been described, some of which are dependent on Ca2/ and lipids for activity (Nishizuka, 1992). Upon activation, PKC becomes associated with a particulate fraction (Kraft and Anderson, 1983), consisting of membrane lipids and cytoskeletal elements (Mochly-Rosen, 1995). Specific protein receptors have been described at those loci that act as docking sites for PKC (Ron et al., 1994). Several findings suggest that PKC-mediated signal transduction events are important in the cellular response to ionizing radiation. The transcriptional induction of TNFa by ionizing radiation involves induction of phospholipase A2 activity and subsequent activation of PKC activity (Hallahan et al., 1994). PKC inhibitors lead to enhanced sensitivity toward ionizing radiation (Kim et al., 1992) and to a failure

to induce the p53 protein (Khanna and Lavin, 1993), which is normally induced by ionizing radiation (Kastan et al., 1992). The upregulation of p53 is also deficient in cell lines from patients with the autosomal inherited disease Ataxia-telangiectasia (AT), which causes neuronal degeneration, cancer proneness, and ionizing radiation sensitivity (Kastan et al., 1992). The level of the PKCe isoform is increased by ionizing radiation (Kim et al., 1992). We have found that a gene product that suppresses the radiation sensitivity of AT cell lines, ATDC, physically interacts with a putative PKC inhibitor, hPKCI-12 (Brzoska et al., 1995). This interaction suggests that ATDC may suppress the radiation sensitivity of AT lines by modulating the activity of PKC via hPKCI1. Therefore, hPKCI-1 may play a central role in radiation-induced signal transduction. PKCI-1s constitute a family of 13-kDa proteins that has been identified in many different species (Robinson and Aitken, 1994). Protein kinase C-inhibiting activity was purified from bovine brain based on its ability to inhibit bovine brain PKC in vitro (McDonald and Walsh, 1985a,b). Subsequently, another protein in the preparation was identified as the major PKC inhibiting activity (Fraser and Walsh, 1991), but others have reported that PKCI-1 does indeed inhibit PKC synergistically in the presence of 14-3-3 proteins (Robinson et al., 1995). Thus, the role of PKCI-1 in regulating PKC activity remains unclear, as does the biological function of the protein. Bovine PKCI-1 is a dimeric heat stable protein with a Zn2/ binding domain (Mozier et al., 1991). The amino acid sequence of bovine PKCI-1 has been determined (Pearson et al., 1990). Here, we report the sequence of a full-length cDNA encoding human PKCI-1, its map position on 5q31.2, and its localization to cytoskeleton structures in a human fibroblast cell line. Association of hPKCI-1 with the cytoskeleton supports a postulated role for

1 To whom correspondence should be addressed. Telephone: (415) 476-9084. Fax: (415) 476-9069. E-mail: [email protected].

2 The HGMW-approved symbol for the gene described in this paper is PRKCNH1.

We report here the complete cDNA sequence, genomic mapping, and immunolocalization of the first human member of the protein kinase C inhibitor (PKCI1) gene family. The predicted human protein (hPKCI1) is 96% identical to bovine and 53% identical to maize members, indicating the great evolutionary conservation of this protein family. The hPKCI-1 gene (HGMVapproved symbol PRKCNH1) maps to human chromosome 5q31.2 by fluorescence in situ hybridization. Indirect immunofluorescence shows that hPKCI-1 localizes to cytoskeletal structures in the cytoplasm of a human fibroblast cell line and is largely excluded from the nucleus. The cytoplasmic localization of hPKCI1 is consistent with a postulated role in mediating a membrane-derived signal in response to ionizing radiation. q 1996 Academic Press, Inc.

INTRODUCTION

151

AID

Genom 4144

/

6r1b$$$561

07-26-96 15:52:35

0888-7543/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.

gnma

AP: Genomics

152

BRZOSKA ET AL.

the protein in mediating PKC activity in response to a membrane-derived signal generated by ionizing radiation. MATERIALS AND METHODS Cell lines and growth conditions. LM217 is a human fibroblast cell line transformed with SV40 (Kapp et al., 1992). Cells were grown in DMEH21 medium supplemented with 10% fetal bovine serum at 377C under 5% CO2 . hPKCI-1 cloning. An incomplete cDNA encoding hPKCI-1 was isolated (Brzoska et al., 1995) from a HeLa cDNA library (Gyuris et al., 1993). This cDNA encodes the 80 C-terminal amino acids of hPKCI-1 (Brzoska et al., 1995). To obtain the full-length hPKCI-1 cDNA by PCR, we used the primer GTGCTTAACCAGGAG, which is complementary to a region immediately 3 * of the site of the coding region of hPKCI-1 and which includes the stop codon (TAA), and the primer GAGATGCCTCCTACCC, which is complementary to the vector on the 5* side of the EcoRI cloning site in the vector. The HeLa cDNA library CL-1 was cut with NotI, and a PCR analysis was performed using Taq polymerase. The resulting 450-bp fragment was cut with EcoRI, which restricts the 5* end of the fragment but not the 3* end, and was cloned into the vector pSPT18 (BoehringerMannheim) linearized with EcoRI and SmaI. The PCR product has the same size as the cloned fragment, judged by gel electrophoresis. The resulting plasmid pCB624 was used to sequence the 133 nucleotides of the human sequence missing in the original isolate. Both strands of the cDNA were sequenced using Sequenase (USB). Localization of hPKCI-1 by indirect immunofluorescence. To epitope tag hPKCI-1 with the HA epitope (Kolodziej and Young, 1991), we used (1) the primer CCGAATTCTTAAGCGTAGTCTGGGACGTCGTATGGGTAACCAGGAGGCCAATGCAT at the 3 * end of the hPKCI-1 open reading frame, in which the stop codon of the cDNA was replaced, in frame, by the sequence of the HA epitope followed by a stop codon and the restriction site EcoRI and (2) a second primer, CCGAATTCCCGCCATGGCAGATGAGATTGCC, which is complementary to the initiation codon ATG of hPKCI-1 preceded by an mRNA consensus translation start site and an EcoRI site. A PCR amplificationusing pCB624 linearized with EcoRI was performed with the above primers. The resulting product was digested with EcoRI and cloned into the expression vector pCD2E linearized with EcoRI. The sequence of this construct (pCB655) was confirmed by DNA sequencing. In pCB655 the hPKCI-1-HA cDNA is expressed from the SV40 promotor. pCB655 was transfected into LM217 or AT5BIVA using a calcium-phosphate transfection kit (BRL). After 3 days of incubation to allow phenotypic expression, the cells were fixed in cold acetone, and immunostaining was performed using a monoclonal antibody against the HA epitope (Babco; dilution 1:500) and a secondary antibody coupled to FITC (Caltag; dilution 1:500). No signal was observed using secondary antibody alone or in cells transfected with the construct in which hPKCI-1-HA was cloned in the antisense orientation with respect to the SV40 promotor. Immunofluorescence was performed using a Zeiss Axioplan microscope and either a 64X or a 100X objective lens. Mapping of hPKCI-1. A genomic clone of hPKCI-1 was isolated from a human genomic P1 library (Shepherd et al., 1994) using PCR (primers CGTTTTGGGGATAATTTTC and TTAGCCATGCAACAATGTC) as described (Stokke et al., 1995). hPKCI-1-containing P1 DNA was extracted and labeled by nick-translation with digoxigenin–dUTP (Boehringer-Mannheim) to give fragment lengths of Ç0.3–0.6 kb under nondenaturing conditions. Labeled probe was then hybridized to normal human lymphocyte metaphase preparations as described previously (Stokke et al., 1995) with a slight modification. The slides were denatured at 707C for 3 min in 70% formamide/21 SSC, followed by dehydration in 70/85/100% ethanol. The hybridization mixture contained 40 ng of labeled probe and 10 mg human Cot-1 DNA (BRL) in 10 ml of 50% formamide/21 SSC/10% dextran sulfate. This mixture was denatured at 707C for 5 min, allowed to reanneal at 377C for 30 min, applied to the slides, and

AID

Genom 4144

/

6r1b$$$561

07-26-96 15:52:35

FIG. 1. Nucleotide and predicted protein sequence of hPKCI-1. A truncated hPKCI-1 cDNA was isolated from a HeLa cDNA library and sequenced. The full-length cDNA was isolated by PCR using primers complementary to the 3* end of the cDNA and to vector sequences beyond the 5* end of the cDNA. The sequence of the original truncated hPKCI-1 cDNA is underlined. Boldface letters indicate the putative amino acid sequence. The numbers on the left indicate the nucleotide; those on the right indicate the amino acid. incubated overnight at 377C. Slides were washed for 5 min each in 31 SSC at 707C, 41 SSC at 377C, and 41 SSC/0.1% Triton X-100 at 377C. The slide was then blocked in wash buffer with 5% dry milk/ 0.1% sodium azide (blocking buffer) at 377C for 5 min. The hybridized probe was then detected with FITC–anti-digoxigenin (1:200 in blocking buffer; Boehringer-Mannheim) at 377C for 10 min in the dark. The slide was then washed for 5 min each in 41 SSC at 377C, 21 SSC at room temperature, and water at room temperature. Finally, the slide was counterstained with 0.05 mg/ml propidium iodide and 0.4 mM DAPI in anti-fade solution. The chromosomal location of the probes was determined by digital image microscopy following fluorescence in situ hybridization (FISH) and localized by the fractional length from the p-terminus (FLpter) as described previously (Stokke et al., 1995).

RESULTS

Cloning of a Human Homologue of PKCI-1 During our search for proteins that interact with the AT complementing protein ATDC (Brzoska et al., 1995), we isolated a truncated cDNA that showed 95% amino acid identity to bovine PKCI-1, a putative inhibitor of protein kinase C (McDonald and Walsh, 1985a). Using PCR we have isolated a full-length cDNA encoding the hPKCI-1 protein. Figure 1 shows the complete nucleotide sequence of the full-length hPKCI-1 cDNA.

gnma

AP: Genomics

CLONING, MAPPING, AND LOCALIZATION OF hPKCI-1

153

FIG. 2. Map position of hPKCI-1 determined by FISH. hPKCI-1 was mapped to chromosome 5q31.2 by fluorescence in situ hybridization(FISH) using P1 genomic clones isolated by PCR from a genomic library. A representative metaphase is shown, with chromosome 5 signals shown in the insets.

The putative translation start ATG is at nucleotide 43 based on the peptide sequence alignment to the bovine PKCI-1 protein. Expression of this cDNA in a reticulocyte expression system resulted in production of a protein of apparent molecular weight 18 kDa as determined by mobility in SDS/PAGE, which corresponds to the apparent molecular weight of bovine PKCI-1. Transient expression of hPKCI-1 from pUHD10-3 (Gossen and Bujard, 1992) in a fibroblast line could be detected following transfection with a polyclonal antibody against the bovine PKCI-1 (data not shown). This indicates that our clone is likely to contain the entire region of hPKCI-1. The presence of a poly(A) tail at the 3* end indicates that our clone is likely to contain the complete 3*-untranslated region as well. hPKCI-1 Maps to 5q31.2 To map hPKCI-1 on the human genome, we isolated three genomic clones from a P1 phage library by PCR. Restriction mapping and Southern hybridization indicated that the three P1 phages were overlapping (not shown). One of the clones was used to map hPKCI-1 by FISH. Figure 2 shows a metaphase hybridization

AID

Genom 4144

/

6r1b$$$561

07-26-96 15:52:35

with a P1 genomic clone carrying the hPKCI-1 gene. The hybridization signal was analyzed using a digital analysis system (Stokke et al., 1995). hPKCI-1 maps to 5q31.2. Localization of hPKCI-1 by Indirect Immunofluorescence We have suggested that ATDC may stimulate PKC signaling that normally responds to ionizing radiation but that is defective in AT (Brzoska et al., 1995). We have shown that ATDC localizes to the cytoskeleton where some isoforms of PKC translocate following activation. If ATDC interacts with hPKCI-1 in vivo, we expect hPKCI-1 to localize to the cytoplasm and possibly to the cytoskeleton. To address this question we constructed an epitope-tagged hPKCI-1 using the 9-amino-acid epitope of the flu virus (HA tag; Field et al., 1988). We transfected SV40-immortalized human fibroblast cells with a construct that encodes hPKCI-1-HA expressed from the SV40 promotor. After 3 days the cells were fixed and stained using a monoclonal antibody against the HA epitope and a secondary anti-

gnma

AP: Genomics

154

BRZOSKA ET AL.

FIG. 3. hPKCI-1 localization. Using an HA epitope-tagged version of hPKCI-1, the protein was localized in a human fibroblast cell line by indirect immunofluorescence using a monoclonal antibody against the HA epitope tag and an FITC-labeled secondary antibody (Brzoska et al., 1995).

body conjugated to FITC. Examination of transfected cells by fluorescence microscopy revealed that hPKCI-1 localizes to cytoskeleton-like structures in the cytoplasm (Fig. 3). Only 1 in 10,000 cells expressed hPKCI-1, most likely due to the low transfection efficiency in nonsynchronized cell lines (Kapp and Painter, 1989). No signal was observed under our conditions in nontransfected cells, as evidenced by the lack of staining in surrounding cells (not shown). Transfection with a construct in which hPKCI-1 is cloned in the antisense orientation with respect to the SV40 promoter gave no signal by fluorescence microscopy. We photographed over 50 individual transfected cells. A control localization using

AID

Genom 4144

/

6r1b$$$561

07-26-96 15:52:35

HA-tagged ATDC showed a different pattern of localization, indicating that the pattern observed for hPKCI-1-HA is specific. X-radiation (5 Gy) or stimulation of PKC with PMA (phorbol ester-myristoylacetate) did not affect hPKCI-1 expression of localization for up to 24 h after irradiation in a wildtype fibroblast line, an AT line, or an AT line that overproduces ATDC (not shown). DISCUSSION

We report here the identification of the first human member of the growing PKCI-1 family of proteins. hPKCI-1 is 96% identical to the bovine protein and 53%

gnma

AP: Genomics

CLONING, MAPPING, AND LOCALIZATION OF hPKCI-1

identical to the maize protein, demonstrating a high level of evolutionary conservation. hPKCI-1 maps to human chromosome 5q31.2 and is localized to filamentous structures in the cytoplasm of transformed human fibroblast cell lines. The activity of PKCI-1s as bona fide inhibitors of PKC is currently unclear. The bovine protein was identified as a heat stabile PKC inhibitor in vitro, but the primary PKC-inhibitory activity in brain was subsequently shown to be heat labile (Fraser and Walsh, 1991). However, recent evidence suggests that PKCI-1 does indeed inhibit PKCs, but that this activity may require the presence of 14-3-3 proteins (Robinson and Aitken, 1994). In addition, injection of purified bovine PKCI-1 has been demonstrated to inhibit PKC-mediated release of calcium in nerve cells, supporting the putative PKC inhibitory activity (Rane et al., 1989). Localization of hPKCI-1 to filamentous structures in the cytoplasm would be consistent with a postulated role in signal transduction from the membrane to the nucleus. hPKCI-1 and ATDC do not appear to colocalize precisely, as ATDC is located primarily on vimentin filaments (Brzoska et al., 1995). However, it may be that a fraction of the total hPKCI-1 is associated with ATDC in vivo. The physiological functions of PKCI-1 are also not known, although they are likely to be diverse. Our previous results suggest that hPKCI-1 may be a component of an ionizing radiation signaling pathway, since it physically interacts with an AT complementing protein, ATDC (Brzoska et al., 1995). The primary defect in AT has recently been shown to result from mutations in a PI3-kinase-like protein, supporting the notion that signal transduction in response to ionizing radiation is defective in AT. Several isoforms of PKC are known to act downstream from PI3 kinases in signaling pathways. One model for the role of hPKCI-1 is that it may sequester or inactivate PKC until radiation activates the pathway. In such a model ATDC would activate PKC by sequestration of hPKCI-1. We are currently testing this possibility in an in vitro system. To address further the question of physiological function of hPKCI1, we are in the process of constructing cell lines that inducibly overexpress hPKCI-1 to examine the effects on PKC activity and radiation signal transduction. A distantly related member of the PKCI-1 gene family called FHIT was recently found to act as a likely tumor suppressor in several different tumor types, including esophageal, stomach, and colon carcinomas (Ohta et al., 1996). FHIT is most closely related to the Schizosaccharomyces pombe Ap4A hydrolase gene product and may encode a human Ap4A hydrolase. However, the homology with hPKCI-1 is limited (38% similarity), making it unclear whether the proteins perform similar in vivo functions. ACKNOWLEDGMENTS We thank M. P. Walsh for providing us with polyclonal antibodies against bovine PKCI-1 and Pragati Bakshi for help in preparing this

AID

Genom 4144

/

6r1b$$$561

07-26-96 15:52:35

155

manuscript. This work was supported by grants to M.F.C. from the AT Children’s Project and the American Cancer Society. Note added in proof. Recently, the three dimensional structure of PKCI-1 has been solved providing a model for the folding of this family of proteins (Lima et al., 1996, Proc. Natl. Acad. Sci. (U.S.A.) 93: 5357).

REFERENCES Brzoska, P. M., Chen, H., Zhu, Y., Levin, N. A., Disatnik, M.-H., Mochly-Rosen, D., Murnane, J. P., and Christman, M. F. (1995). The product of the ataxia-telangiectasia group D complementing gene, ATDC, interacts with a protein kinase C substrate and inhibitor. Proc. Natl. Acad. Sci. USA 29: 7824–7828. Field, J., Nikawa, J., Broek, D., MacDonald, B., Rodgers, L., Wilson, I. A., Lerner, R. A., and Wigler, M. (1988). Purification of a RASresponsive adenylyl cyclase complex from Saccharomyces cerevisiae by use of an epitope addition method. Mol. Cell. Biol. 8: 2159– 2165. Fraser, E. D., and Walsh, M. P. (1991). The major endogenous bovine brain protein kinase C inhibitor is a heat-labile protein. FEBS Lett. 294: 285–289. Gossen, M., and Bujard, H. (1992). Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA 89: 5547–5551. Gyuris, J., Golemis, E., Chertkov, H., and Brent, R. (1993). Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 75: 791–803. Hallahan, D. E., Virudachalam, S., Kuchibhotla, J., Kufe, D. W., and Weichselbaum, R. R. (1994). Membrane-derived second messenger regulates x-ray-mediated tumor necrosis factor alpha gene induction. Proc. Natl. Acad. Sci. USA 91: 4897–4901. Hug, H., and Sarre, T. F. (1993). Protein kinase C isoenzymes: Divergence in signal transduction? Biochem. J. 329–343. Kapp, L. N., and Painter, R. B. (1989). Stable radioresistance in ataxia-telangiectasia cells containing DNA from normal human cells. Int. J. Radiat. Biol. 56: 667–675. Kapp, L. N., Painter, R. B., Yu, L. C., van, L. N., Richard, C. III, James, M. R., Cox, D. R., and Murnane, J. P. (1992). Cloning of a candidate gene for ataxia-telangiectasia group D. Am. J. Hum. Genet. 51: 45–54. Kastan, M. B., Zhan, Q., el, D. W., Carrier, F., Jacks, T., Walsh, W. V., Plunkett, B. S., Vogelstein, B., and Fornace, A. J. (1992). A mammalian cell cycle checkpoint pathway utilizing p53 and GADD45 is defective in ataxia-telangiectasia. Cell 71: 587–597. Khanna, K. K., and Lavin, M. F. (1993). Ionizing radiation and UV induction of p53 protein by different pathways in ataxia-telangiectasia cells. Oncogene 8: 3307–3312. Kim, C. Y., Giaccia, A. J., Strulovici, B., and Brown, J. M. (1992). Differential expression of protein kinase C epsilon protein in lung cancer cell lines by ionising radiation. Br. J. Cancer 66: 844–849. Kolodziej, P. A., and Young, R. A. (1991). Epitope tagging and protein surveillance. Methods Enzymol. 194: 508–519. Kraft, A. S., and Anderson, W. B. (1983). Phorbol esters increase the amount of Ca2/, phospholipid-dependent protein kinase associated with plasma membrane. Nature 301: 621–623. McDonald, J. R., and Walsh, M. P. (1985a). Ca2/-binding proteins from bovine brain including a potent inhibitor of protein kinase C. Biochem. J. 232: 559–567. McDonald, J. R., and Walsh, M. P. (1985b). Inhibition of the Ca2/and phospholipid-dependent protein kinase by a novel Mr 17,000 Ca2/-binding protein. Biochem. Biophys. Res. Commun. 129: 603– 610. Mochly-Rosen, D. (1995). Localization of protein kinases by anchoring proteins: A theme in signal transduction. Science 268: 247– 251.

gnma

AP: Genomics

156

BRZOSKA ET AL.

Mozier, N. M., Walsh, M. P., and Pearson, J. D. (1991). Characterization of a novel zinc binding site of protein kinase C inhibitor-1. FEBS Lett. 279: 14–18. Nishizuka, Y. (1992). Intracellular signaling by hydrolysis of phospholipids and activation of protein kinase C. Science 258: 607– 614. Ohta, M., Inoue, H., Cotticell, M. G., Kastury, K., Baffa, R., Palazzo, J., Siprashvili, Z., Mori, M., McCue, P., Druck, T., Croce, C. M., and Huebner, K. (1996). The FHIT gene, spanning the chromosome 3p14.2 Fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell 84: 587– 597. Pearson, J. D., DeWald, D. B., Mathews, W. R., Mozier, N. M., Zurcher, N. H., Heinrikson, R. L., Morris, M. A., McCubbin, W. D., McDonald, J. R., Fraser, E. D., et al. (1990). Amino acid sequence and characterization of a protein inhibitor of protein kinase C. J. Biol. Chem. 265: 4583–4591. Rane, S. G., Walsh, M. P., McDonald, J. R., and Dunlap, K. (1989). Specific inhibitors of protein kinase C block transmitter-induced modulation of sensory neuron calcium current. Neuron 3: 239– 245.

AID

Genom 4144

/

6r1b$$$561

07-26-96 15:52:35

Robinson, K., and Aitken, A. (1994). Identification of a new protein family which includes bovine protein kinase C inhibitor-1. Br. J. Lett. 662–664. Robinson, K., Jones, D., Howell, S., Soneji, Y., Martin, S., and Aitken, A. (1995). Expression and characterization of maize ZBP14, a member of a new family of zinc-binding proteins. Biochem. J. 267– 272. Ron, D., Chen, C. H., Caldwell, J., Jamieson, L., Orr, E., and Mochly, R. D. (1994). Cloning of an intracellular receptor for protein kinase C: A homolog of the beta subunit of G proteins. Proc. Natl. Acad. Sci. USA 91: 839–843. Shepherd, N. S., Pfrogner, B. D., Coulby, J. N., Ackerman, S. L., Vaidyanathan, G., Sauer, R. H., Balkenhol, T. C., and Sternberg, N. (1994). Preparation and screening of an arrayed human genomic library generated with the P1 cloning system. Proc. Natl. Acad. Sci. USA 91: 2629–2633. Stokke, T., Collins, C., Kuo, W. L., Kowbel, D., Shadravan, F., Tanner, M., Kallioniemi, A., Kallioniemi, O. P., Pinkel, D., Deaven, L., et al. (1995). A physical map of chromosome 20 established using fluorescence in situ hybridization and digital image analysis. Genomics 26: 134–137.

gnma

AP: Genomics