A new phosphotriesterase from Sulfolobus acidocaldarius and its comparison with the homologue from Sulfolobus solfataricus

Biochimie 89 (2007) 625e636 www.elsevier.com/locate/biochi

A new phosphotriesterase from Sulfolobus acidocaldarius and its comparison with the homologue from Sulfolobus solfataricus Elena Porzio1, Luigia Merone1, Luigi Mandrich, Mose` Rossi, Giuseppe Manco* Istituto di Biochimica delle Proteine, Consiglio Nazionale delle Ricerche, via P. Castellino 111, 80131 Naples, Italy Received 4 October 2006; accepted 22 January 2007 Available online 27 January 2007

Abstract The phosphotriesterase PTE, identified in the soil bacterium Pseudomonas diminuta, is thought to have evolved in the last several decades to degrade the pesticide paraoxon with proficiency approaching the limit of substrate diffusion (kcat/KM of 4  107 M1 s1). It belongs to the amidohydrolase superfamily, but its evolutionary origin remains obscure. The enzyme has important potentiality in the field of the organophosphate decontamination. Recently we reported on the characterization of an archaeal member of the amidohydrolase superfamily, namely Sulfolobus solfataricus, showing low but significant and extremely thermostable paraoxonase activity (kcat/KM of 4  103 M1 s1). Looking for other thermostable phosphotriesterases we assayed, among others, crude extracts of Sulfolobus acidocaldarius and detected activity. Since the genome of S. acidocaldarius has been recently reported, we identified there an open reading frame highly related to the S. solfataricus enzyme. The gene was cloned, the protein overexpressed in Escherichia coli, purified, and proven to have paraoxonase activity. A comparative analysis detected some significant differences between the two archaeal enzymes. Ó 2007 Elsevier Masson SAS. All rights reserved. Keywords: Organophosphates; Pesticides; Sulfolobus acidocaldarius; Thermostability

1. Introduction In the last few years the environmental decontamination of organophosphates (OPs) has attracted an overwhelming interest. OPs are toxic compounds for all vertebrates because they irreversibly inhibit acetylcholinesterase, a key enzyme of the nervous system. They have been distributed globally since the end of World War II and their toxic properties have also been exploited for the development of chemical warfare agents such as sarin, soman and VX as well as for the production of agricultural insecticides [1]. Their general structure is shown in Scheme 1. The phosphorus is linked by a double bond to either an oxygen atom, in oxon-OPs, or to a sulphur atom, in thion-OPs, and by an ester linkage to phenoxy or other groups. * Corresponding author. Tel.: þ39 081 613 2296; fax: þ39 081 613 2248. E-mail address: [email protected] (G. Manco). 1 These two authors contributed equally to this work. 0300-9084/$ - see front matter Ó 2007 Elsevier Masson SAS. All rights reserved. doi:10.1016/j.biochi.2007.01.007

Enzymatic detoxification of OPs has become the subject of many studies because alternative methods of removing them, such as bleach treatments and incineration are impractical due to high costs or environmental concerns ([2] and references therein). For this application, bacterial OP hydrolases are more interesting due to their broader substrate specificity and higher catalytic rate. Enzymes that catalyse the hydrolysis of phosphoester bonds in OPs are known from several different microbial species. These enzymes are called phosphotriesterases (PTE; EC 3.1.8.1), organophosphorous hydrolases (OPH), organo-phosphate-degrading enzymes (OPD), parathion hydrolases [3] or paraoxonase (SsoPox) [4]. A different class of enzymes able to degrade more specifically nerve gasses are prolidases identified in Alteromonas spp. [5,6]. In general, bacteria are not affected by the presence of OPs since they do not enter into the cell [7]. However, pesticides could be a good carbon source for some bacteria [1,6]. Therefore, several bacterial strains have been identified that are able

E. Porzio et al. / Biochimie 89 (2007) 625e636

626

X

P

Z

R R' Scheme 1. General structure of an organophosphate. X: oxygen or sulphur atom; R/R0 : alkoxy groups; Z: phenoxy or fluorine group.

to hydrolyse a large range of OPs including chemical warfare agents. In fact, the genes for OP hydrolyses, opd (organo phosphate degradation) genes, were found in Pseudomonas diminuta [8], Flavobacterium spp. [9] and Agrobacterium radiobacter [10]. In those organisms, the opd genes were located on a large plasmid and seem to be part of a transposable element [11,12]. In Archaea, there are no reports. Preliminary data from our laboratory suggest that growth inhibition occurs at paraoxon concentrations of less than 1 mM (G.M. and T.F., unpublished). OP hydrolysing enzymes are members of the amidohydrolases superfamily [13] a group of enzymes sharing the same (b/a)8-barrel structural fold and catalysing hydrolysis of a broad range of compounds with different chemical properties (phosphoesters, esters, amides, etc.). In the superfamily, seven subtypes have been distinguished and they are different in term of the aminoacidic consensus that coordinates the mononuclear or binuclear metal centre, but an unambiguous correlation does not exist for catalytic properties in every subtype. Phosphotriesterase PTE from Pseudomonas diminuta belongs to the subtype I [13]. This enzyme is the most efficient phosphotriesterase identified so far. Structurally it is a homodimeric (b/a)8-barrel with a binuclear metal centre located at the C-terminal end of the barrel [14e18]. The catalytic centre is composed of two closely spaced divalent cations ligated to the protein via direct interactions with four histidines, one aspartate and a carboxylated lysine residue [19]. Functionally, the PTE shows high catalytic rate, near the diffusion limit, and high specificity for organophosphate triester compounds [20]. No activity was detectable with phosphate monoesters or di-esters, nor with usual substrates of esterases and proteases [14,21,22]. However, recently weak esterase and lactonase promiscuous activities were reported [23]. The reaction mechanism has been studied thoroughly through structural and kinetic studies: the reaction proceeds via an SN2-like mechanism in which the metal centre enables a hydroxide ion (bridged to the two metal ions) to attack the electrophilic phosphorous of the substrate [24,25]. In Escherichia coli and some other organisms, a family of phosphotriesterase-related proteins (PHP) has been identified [3,26]. This family has been suggested to represent archetypal type of enzymes from which PTEs evolved [3]. The sequence identity with the Pseudomonas enzyme was low but significant (less than 30%) as confirmed by the fact that the 3D structure ˚ resolution, was very similar to of this protein, solved at 1.7 A the PTE structure. Two Zn2þ ions were observed in the structure and residues involved in their coordination were quite

well conserved except for K169 of PTE that in ePHP was substituted with E125. Given this metal centre structure, this family has been classified as subtype II [13]. No activity was initially detected with any tested substrate for the E. coli member of this family [26]. Subsequent studies reported a weak esterase activity and weak paraoxonase activity in an ePHP mutant [23]. No data are available on other members of the family. Currently only two thermophilic members of the superfamily with known 3D structure are available from Thermotoga maritime [13]. The first protein (Tm0667) perhaps catalyses the nucleic acids hydrolysis, while the second (Tm0936) probably catalyses a hydrolytic substitution within a heteroaromatic base [27]. A protein from hyperthermophilic archaeon Sulfolobus solfataricus, SsoPox, has been recently cloned and characterized [4]: it displays about 30% sequence identity with PTE and, in particular, all amino acids coordinated to the binuclear centre are conserved. A model of the 3D structure of SsoPox was constructed on the basis of PTE structure [28]. Having those characteristics, SsoPox can be ascribed to the subtype I of the amidohydrolases superfamily according to the classification of Seibert and Raushel [13]. It has been observed that SsoPox catalyses the hydrolysis of paraoxon and other pesticides with a low proficiency, but with KM value similar to PTE. Similarly to the Pseudomonas PTE, its activity depends on the presence of metal ions, and the higher activity has been observed with Cd2þ [28]. SsoPox proved to have an exceptional thermal stability with denaturation half-life of 4 h and 90 min at 95  C and 100  C, respectively. The intrinsic thermal stability of an enzyme is a property of great interest for any biotechnological application. In fact, high thermal stability is usually linked to resistance to other harsh conditions such as the presence of solvents, detergents, proteases etc. Different stabilization procedures have been described such as immobilization on different matrices. In general, kinetic properties of an enzyme change due to the immobilization procedure. Indeed, mesophilic PTE loses a good part of its activity when it is immobilized on a polyurethane matrix [29]; thus, a protein intrinsically stable could be more suitable for biotechnological applications. Furthermore, an intrinsically thermostable paraoxonase could be a convenient alternative in other systems such as the display on the cell surface; complex stabilization systems have been proposed in order to achieve this objective for the mesophilic PTE [30]. Recently the complete genome of Sulfolobus acidocaldarius has been published [31]. Preliminary analyses on crude extracts from S. acidocaldarius displayed a paraoxonase activity higher than the paraoxonase activity found in the crude extract from S. solfataricus. Moreover, a sequence search analysis allowed the identification of a putative homologue (SACI2140) of SsoPox. These preliminary data encouraged us to clone and characterize this second thermophilic protein probably endowed with paraoxonase activity. Here we report the cloning of this gene from S. acidocaldarius genome, its biochemical characterization and a model of its structure based on the PTE structure.

E. Porzio et al. / Biochimie 89 (2007) 625e636

627

2. Materials and methods

2.5. Cloning and expression

2.1. Chemicals

A 948-bp fragment, containing the entire ORF SACI2140 (Sacpox), was amplified using the S. acidocaldarius genomic DNA. To insert the entire gene into the NdeIePstI sites of plasmid pT7-7 it was necessary to remove from the coding sequence an NdeI restriction site positioned at 180 bp from the 50 start of the gene. The strategy adopted was to change the nucleotide T at the 180 bp position into G in order to have a silent mutation in the gene. To obtain this result, two fragments of 209 and 803 bp, overlapping in the region of mutation, were amplified by PCR using genomic DNA as the template (300 ng), recombinant Vent DNA polymerase (2 U) and opportunely designed oligonucleotides. In detail, to amplify the fragment of 209 bp the primer Sac50 NdeI50 /30 was used to introduce also an NdeI restriction site (underlined) upstream of the gene (ATAATATACTCATATGACAAAAATTCCTCTTG), whereas the primer Sac180AG30 /50 was designed to remove the inner NdeI restriction site (underlined) in the 180 bp position (CGATGGTCTTAACACCGTATGACATTATTGTC). To amplify the other part of the gene (803 bp) the primer Sac180TC50 /30 (complementary of Sac180AG30 /50 ) was used (GACAATAATGTCATACGGTGTTAAGACCATCG), whereas Sac30 PstI30 /50 was designed to introduce a PstI restriction site (underlined) downstream of the stop codon of Sacpox (AAACTGCAGATAATCTAAACTAACTAAATAGTCTAG). Both fragments were amplified by the same PCR cycle (2 min 95  C, 1 min 45  C, 1 min 72  C; for 30 cycles). The PCR products, eluted from agarose gel, were used as templates in a second PCR cycle to obtain the entire gene Sacpox with mutate base at the 180 bp position. In particular the same quantity of both overlapping fragments (70 ng) was amplified in a 35-cycle PCR (1 min 95  C, 1 min 50  C, 1, 5 min 72  C) with recombinant Vent DNA polymerase (2 U) and external oligonucleotides Sac50 NdeI and Sac30 PstI as the forward and reverse primers, respectively. Classical cloning strategies were performed to obtain the pT7-7eSacpox construct. The cloned fragment was completely sequenced to verify that only the desired mutations were introduced during amplification. Subsequently the pT7-7eSacpox construct was transformed in E. coli BL21(DE3) cells to express the protein SacPox as reported before [4,33]. The quantitative production of the protein was performed as described in Merone et al. [4] with the exception of metal ion type (CdCl2) used in the induction phase.

p-Nitrophenyl ( pNP) butanoate, b-naphthylacetate, paraoxon (di-ethyl-p-NP-phosphate), dursban (O,O-diethyl-3,5,6-tricloro2-pyrimidyl-phosphorothioate), parathion (O,O-diethyl O-pnitrophenyl phosphorothioate), methyl-parathion (O,O-dimethyl O-p-nitrophenyl phosphorothioate), coumaphos (O,O-diethyl O-(3-chloro-4-methyl-2-oxo-2H-1benzopyran-7-yl) phosphorothioate), diazinon (O,O-diethyl O-2-isopropyl-4-methyl-6pyrimidyl phosphorothioate), and bis-pNP-phosphate were purchased from Sigma Chemical Co. (St Louis, MO). Molecular mass markers for SDSePAGE and for gel filtration were obtained from Bio Rad (Hercules, CA) and Amersham Biosciences (Uppsala, Sweden), respectively. 2.2. Strains and plasmids E. coli TOP10 (Invitrogen, CA, USA) was used as the host for cloning whereas E. coli BL21(DE3) harboured the recombinant plasmid for gene expression. The vector utilized was pT7-7 vector [32,33]. S. solfataricus P2 and MT4 strains and S. acidocaldarius were used to analyse the crude extracts in vivo. 2.3. DNA manipulation Standard molecular cloning techniques were employed throughout. E. coli strains, TOP10 or BL21(DE3), were grown at 37  C in LuriaeBertani (LB) medium containing ampicillin (100 mg ml1). S. solfataricus and S. acidocaldarius were grown at 80  C in 182 medium as described in DSMZ online catalogue. Restriction enzymes used in this work were from New England BioLabs (Beverly, MA). Purification of plasmid DNA was performed with plasmid Mini- and Midi-kits (Qiagen, Hilden, Germany). Restriction enzymes were from New England BioLabs. 2.4. S. acidocaldarius genomic DNA preparation S. acidocaldarius genomic DNA was purified from a cell culture (100 ml) arrested at 0.8 OD600. Cells were harvested by centrifugation (3000  g, 4  C, 10 min), washed with 50 mM TriseHCl pH 8.0, 25 mM EDTA, 1% Triton X-100 and resuspended in 50 mM TriseHCl pH 8, 1% SDS. After addition of Proteinase K (1 U ml1 f.c.) incubation continued for 1 h at 37  C. After acid extraction with phenol/chloroform/isoamilic alcohol and centrifugation (3000  g, 4  C, 10 min), DNA was precipitated with 70% ethanol, 0.3 M sodium acetate, and then centrifuged (20,000  g, 4  C, 30 min) and washed with 70% ethanol. After centrifugation (20,000  g, 4  C, 30 min), the DNA was resuspended in 50 mM TriseHCl pH 8.0, 25 mM EDTA.

2.6. Purification of the recombinant enzyme All procedures were carried out at room temperature, unless otherwise indicated. Wet frozen cells (44 g) were thawed and re-suspended in 130 ml of buffer A (20 mM Hepes pH 8.0, 0.2 mM CdCl2). Cells were broken by French pressure cell disruption (Aminco Co., Silver Spring, MD, USA). A pressure setting of 2000 lb inch2 (1.38 MPa) was used. Cell debris was removed by centrifugation (80,000  g, 20 min, 4  C). After dilution with buffer A (until final volume of 200 ml),

628

E. Porzio et al. / Biochimie 89 (2007) 625e636

E. coli proteins were partially removed by incubating the crude extract at 60, 70, and 80  C for 15 min under gentle stirring and with clarification, between each incubation, by centrifugation (80,000  g, 20 min, 4  C). Pellets were discarded. The enzyme solution obtained at 80  C was directly loaded onto a Q Sepharose Fast Flow FPLC column (Pharmacia) equilibrated with buffer A. The flow rate was 1.5 ml min1. After washing, a linear gradient of NaCl (0 to 0.5 M) was applied. The fractions with paraoxonase activity were pooled, concentrated and loaded on the High Load 16/60 Superdex 75 column (Pharmacia, Sweden) using a run over an FPLC apparatus (Pharmacia, Sweden). The column was equilibrated and eluted with 20 mM Hepes buffer (pH 8.0) containing 0.2 mM CdCl2 and 0.2 M NaCl. The flow rate was 0.5 ml min1. The volume of the sample was 2 ml. Fractions showing paraoxonase activity were pooled and stored at 4  C. 2.7. Determination of SacPox molecular mass by SELDITOF and QSTAR Aliquots of 2 and 20 pmol of SacPox in 1e2 ml were spotted onto NP 20 ProteinChip array (Ciphergen Biosystems, Guildford, UK), overloaded with 1 ml of a-cyano-4-hydroxycinnamic acid solution (20% saturation in 25% acetonitrile, 0.25% TFA) and read on a SELDI-TOF Personal Model Series 4000 (Ciphergen Biosystems). Calibration was performed with the All-in-1 protein standard II (range 6964e147,300; Ciphergen Biosystems). An aliquot of SacPox (20 pmol) was analysed by LC/MS on a QSTAR Elite hybrid mass spectrometer (Applied Biosystems, Foster City, USA) equipped with HPLC pumps (Perkin Elmer, Boston, USA). Data were analysed with the Analyst QS 2.0 Software (Applied Biosystems, Foster City, USA). 2.8. Determination of SacPox molecular mass by gel filtration The molecular mass of SacPox was determined by size-exclusion chromatography, using a High Performance Superose 12 10/300 GL column (Pharmacia, Sweden) run over an FPLC apparatus (Pharmacia, Sweden). The column was equilibrated and eluted with 20 mM Hepes buffer (pH 8.0) containing 0.2 mM CdCl2 and 0.2 M NaCl. The flow rate was 0.5 ml min1. The column was calibrated in conditions outlined above, using the following molecular mass markers: Ribonuclease A (13,700 Da), Chymotrypsinogen A (25,000 Da), Ovalbumin (43,000 Da), Aldolase (158,000 Da) from Amersham Biosciences. The loaded sample markers had a concentration of 2 mg ml1 and a volume of 200 ml. Concentrations of the SacPox samples were 0.75 mg ml1 and 7.5 mg ml1 in a final volume of 200 ml. 2.9. Electrophoreses Electrophoretic runs were performed with a Bio-Rad MiniProtean II cell unit at room temperature. SDSePAGE (12.5% polyacrylamide) was performed essentially as described by

Laemmli [34]. Gels were stained with Coomassie Brilliant Blue G-250. As molecular weight standard the ‘‘Prestained Protein Marker broad range’’ (Cell Signaling) was used containing: MBP-b-galactosidase (175.0 kDa), MBP-paramyosin (83.0 kDa), glutamic dehydrogenase (62.0 kDa), aldolase (47.5 kDa), triosephosphate isomerase (32.5 kDa), b-lactoglobulin A (25.0 kDa), lysozyme (16.5 kDa) and aprotinin (6.5 kDa). Non-denaturing PAGE was performed at pH 8.5 in a 7.5% (w/v) polyacrylamide gel.

2.10. Cross-linking experiments Enzymes (0.1 and 0.2 mg ml1) were incubated in 20 mM Hepes (pH 8.0) at room temperature for 15 min, and then with 0.1% glutaraldehyde for 40 min at 30  C. The reaction was stopped by addition of 0.35 M TriseHCl (pH 6.8). Lactate dehydrogenase (Boehringer Mannheim Corp.) (0.1 and 0.2 mg ml1) was used as positive control. Samples were loaded into SDSePAGE under reducing conditions formed of two different concentrations of polyacrylamide (15% and 12%) to guarantee a better protein separation.

2.11. Activity staining Non-denaturing polyacrylamide gels were stained for esterase activity as described by Merone et al. [4]. As control the esterase EST2 from Alicyclobacillus acidocaldarius was used [35].

2.12. Enzyme assays Assays of enzyme activity on paraoxon and methyl paraoxon, and data analysis were performed essentially as described previously [4]. Standard assays were performed at 70  C in a mixture of 20 mM H3BO3/KCl/NaOH (pH 9.0), containing paraoxon 1 mM as substrate. Other reported substrates were assayed at 0.5 mM concentration in the presence of 10% acetonitrile, except for Dursban and Coumaphos, which were assayed at 0.1 mM in 10% acetonitrile because of solubility problems. Stock solutions of Paraoxon, Methyl-paraoxon and Bis-pNP-phosphate were in water, while the other substrates were dissolved in pure acetonitrile. Molar absorption coefficients used were as reported previously [4] except for p-nitrophenol dissolved in 10% acetonitrile at 70  C, which was estimated to be 29,300 M1 cm1after complete hydrolysis of paraoxon with NaOH. Kinetic measurements were performed at 75  C using paraoxon or methyl-paraoxon concentrations over the range 0.005e1 mM. Assays were done in duplicate or triplicate, and results were the means of two independent experiments. Assays were performed in water and the molar absorption coefficient used for p-nitrophenol at 75  C, calculated as reported above, was 28,600 M1 cm1.

E. Porzio et al. / Biochimie 89 (2007) 625e636

2.13. Determination of pH optimum, thermophilicity and thermostability The dependence of initial velocity on the pH, thermophilicity and thermostability was monitored as previously described [4]. 2.14. Molecular modelling Molecular modelling was performed on a Silicon Graphics O2 workstation using the commercial software packages Insight II (Insight II user guide, October 1995, Biosym/MSI, San Diego, CA, USA). The high-resolution X-ray crystal structure of PTE (PDB code: 1DPM) was used as template structure. Several threedimensional models were constructed using the Modeler module [36] within Insight II. The methodology is based on satisfaction of spatial restraints that are obtained from an alignment of a target sequence with related 3D structures at ˚ ), using a conjugate gradient and high resolution (1.8e2.4 A a molecular dynamics simulated annealing as optimization procedures. Each model was also opportunely minimized using Discover3 Module within Insight II. The resulting models were verified using the on-line software WHATH IF, ERRAT and VERIFY 3D on the Structure Analysis and verification Server at the WWW address http:// shannon.mbi.ucla.edu/DOE/Services/SV/. 3. Results and discussion 3.1. In vivo analysis of paraoxonases in Sulfolobus species Aiming at verifying whether enzymes with paraoxonase activity were expressed in vivo in some Sulfolobus species, we analysed for this activity crude extracts from S. solfataricus (P2 and MT4 strains) and S. acidocaldarius. All crude extracts showed low but detectable paraoxonase activity as reported in Table 1, with the S. acidocaldarius extract showing similar paraoxonase activity to S. solfataricus strains. 3.2. SacPox identification and molecular modelling By searching the S. acidocaldarius genome [31] for ORFs encoding putative phosphotriesterases (PTEs) we identified the ORF SACI2140 sharing 76% sequence identity with SsoPox from S. solfataricus [4], 34% with PTE from P. diminuta [14] and OPD from Flavobacterium sp. [37], as well as 32% to the E. coli PHP (ePHP) [26], in a multisequence alignment Table 1 Paraoxonase activity of the S. solfataricus and S. acidocaldarius crude extracts Crude extract

Specific activity  103 (U mg1)

S. solfataricus MT4 S. solfataricus P2 S. acidocaldarius

0.136  0.017 0.197  0.048 0.170  0.037

629

(Pfam Software, Release 21 at http://www.sanger.ac.uk/). From this alignment it is possible to drawn a phylogenetic tree for all the 73 annotated sequences of the PTE family (Fig. 1) showing that the two archaeal enzymes cluster together with bacterial sequences and separately from Eukarya (Program Quick Tree at http://www.sanger.ac.uk/). Since a 3D model for SsoPox does exist [28] as well as 3D structures for PTE [15] and ePHP [26], an alignment of SacPox sequence to the structural alignment of the above proteins was performed (Fig. 2). Based on this alignment and the PTE structure (PDB code: 1DPM;38) a molecular modelling for SacPox sequence was performed, as described in Section 2. More than 95% of residues in the model were located in the allowed regions of the Ramachandran plot and more than half of the remaining residues were glycines. Fig. 3A shows the superposition of SacPox model with PTE and ePHP structures. Folds were very similar except for insertion of loop 7 of PTE [13] with respect to both SacPox and SsoPox structures (see also Fig. 2). The root mean square (RMS) deviation on ˚ (by using 1220 superimposed backbone atoms was 0.67 A ˚ a RMS cut off of 3.75 A) and conserved residues putatively involved in the building up of the binuclear metal centre (H23, H25, K138, H171, H200, D257) were located exactly at the same positions as in PTE (Fig. 3B). SacPox K138, corresponding to PTE/OPD K169, is carboxylated in PTE and is involved in the coordination of two metal ions. Therefore, in this respect the S. acidocaldarius sequence would seem to belong to the subtype I of the amidohydrolase superfamily, together with the PTE/OPD [13]. From the analysis of the PTE structure complexed with a stable substrate analogue, it emerged that the active site could be defined as composed of a large subsite (H254, H257, L271, M317), a small subsite (C59, G60, S61, I106, L303, S308) and a subsite of the leaving group (W131, F132, F306 and Y309) [38,39]. From the structural alignment, in SacPox only the residue corresponding to L271 was strictly conserved. Other residues had similar chemical physical properties (I106L; L303C) and a few was not conserved at all (e.g. C59R; G60V; S61F; F132T; H254R; H257L; F306I; M317K). With respect to SsoPox all corresponding residues are conserved except for residue corresponding to PTE F132 that in SsoPox is an isoleucine. It is hard to argue from the model if this change can cause the observed difference on the two enzymes specificities (see below). The 3D structure knowledge of SacPox/SsoPox complexed with a substrate analogue and/or an approach of site-directed mutagenesis will help to define if and how these residues are involved in substrate specificity and activity.

3.3. Cloning and over-expression of SacPox in E. coli In order to evaluate the biochemical and kinetics properties of the paraoxonase from S. acidocaldarius we cloned by PCR amplification the gene from S. acidocaldarius genomic DNA, and inserted the gene into the expression vector pT7-7, with the strategy described in Methods. A clone was sequenced and used for over-expression in E. coli BL21(DE3) cells.

Fig. 1. Phylogenetic tree of 73 members of the PTE family drawn from the multisequences alignment as defined by the Pfam database (http://www.sanger.ac.uk/ Software/Pfam/). The full protein sequences alignment provided by the Pfam database, for PTE family, was automatically elaborated using the Quick Tree program [49] to obtain the reported tree. Sequences known for having OP hydrolysing activity are phosphotriesterases from: Flavobacterium spp, Breviundomonas diminuta, Sulfolobus solfataricus and Sulfolobus acidocaldarius, all belonging to the subtype II of the amidohydrolase superfamily.

E. Porzio et al. / Biochimie 89 (2007) 625e636

PTE

35

ePHP

2

SFDPTGY TLAHEHLHID LSGFKN---- NVDCRLDQYA

SsoPox

1

MRIPLVGK- DSIESKDIGF TLIHEHLRVF SEAVRQQWPH LYN-EDEEFR

SacPox

1

MTKIPLVGKG E-ISPGEMGF TLIHEHLRVF SEPVRYQWPH LYN-EDEELK * *

PTE

82

KAVRGLRRAR AAGVRTIVDV STFDIGRDVS LLAEVSRAAD VHIVAATGLW

631

ARINTVRG- PI-TISEAGF TLTHEHICGS SAGFLRAWPE FFGSRKALAE

ePHP

35

FICQEMNDLM TRGVRNVIEM TNRYMGRNAQ FMLDVMRETG INVVACTGYY

SsoPox

48

NAVNEVKRAM QFGVKTIVDP TVMGLGRDIR FMEKVVKATG INLVAGTGIY

SacPox

49

NAVNEVKTIM SYGVKTIVDP TVMGLGRDIR FSEKVVKETG INVIAATGLY

PTE

132

F--D--PPLS MRLRSVEELT QFFLREIQYG IEDTGIRAGI I-KVATTG-K

ePHP

85

QDAF--FPEH VATRSVQELA QEMVDEIEQG IDGTELKAGI IAEIGTSEGK

SsoPox

98

I--YIDLPFY FLNRSIDEIA DLFIHDIKEG IQGTLNKAGF V-KIAADE-P

SacPox

99

T--YTDLPFF FNGRSLEEIA ELLIHDIKKG IQGTNNRAGF I-KVAADE-P *

PTE

176

-ATPFQELVL KAAARASLAT GVPVTTHTAA SQR-DGEQQA AIFESEGLSP

ePHP

133

-ITPLEEKVF IAAALAHNQT GRPISTHTSF S--TMGLEQL ALLQAHGVDL

SsoPox

144

GITKDVEKVI RAAAIANKET KVPIITHSNA HNNTGLEQQR ILTEEGV-DP

SacPox

145

GITRDVERAI RAAAIAQKET NVPIITHSNA HNGTGLEQQR ILMEEGV-DP *

PTE

224

SRVCIGHSDD TDDLSYLTAL AARGYLIGLD HIPHSAIGLE DNASASALLG

ePHP

180

SRVTVGHCDL KDNLDNILKM IDLGAYVQFD TIGKNS---- ----------

SsoPox

193

GKILIGHLGD TDNIDYIKKI ADKGSFIGLD RYGLDLF--- -------LPV

SacPox

194

GRVLIGHLGD TDNVDYIKKI ADKGSFVGLD RYGLDLF--- -------LPI *

PTE

274

IRSWQTRALL IKALIDQGYM KQILVSNDWL FGFSSYVTNI MDVMDRVNPD

ePHP

216

YYPDEKRIAM LHALRDRGLL NRVMLSMDIT RRSHL----- ----KANGGY

SsoPox

233

DKRNETTLRL IKDG----YS DKIMISHDYC CTID-WGTAK PEYKPKLAPR

SacPox

234

DKRNEVLLKL IKDG----YL DRIMVSQDYC CTID-WGIAK PEYKPKLAPK

PTE

324

GM-AFIPLRV IPFLREKGVP QETLAGITVT NPARFLSPTL R

ePHP

257

GY-DYLLTTF IPQLRQSGFS QADVDVMLRE NPSQFFQ

SsoPox

278

WSITLIFEDT IPFLKRNGVN EEVIATIFKE NPKKFFS

SacPox

279

WSMSLIFTDV IPSIKRAGVT DEQLHVIFVK NPARLFS

Fig. 2. Structural multisequence alignment among PTE, ePHP, SsoPox and SacPox. The three-dimensional structures of PTE (1DPM), ePHP (1BF6) and model of SsoPox [28] were superimposed with the tools available under the program DeepView/Swiss-PDB viewer (version 3.7, GlaxoSmithKline). To the resulting structural alignment, the sequence of Sulfolobus acidocaldarius was aligned to the highly related SsoPox sequence. Conserved residues forming the cluster of the binuclear metal centre (His22, His24, K137, H170, H199 and D256 in SsoPox) are marked with an asterisk.

The level of activity in PTE and SsoPox, was dependent on the presence of divalent cations as previously reported [4,40]. Thus, in order to verify if the same correlation exists for SacPox activity, 0.2 mM of each of CoCl2, CdCl2 and NiSO4, were separately incorporated in the assay solutions of semi-purified extracts obtained by thermal precipitation of the host proteins. Activity assays showed that the maximum increase of activity (more than 8-fold) was obtained when Cd2þ ions were included in the assay solution (data not shown), suggesting which metal ion had to be used in the purification procedure. Consequently, SacPox was prepared on large scale by including CdCl2 contemporaneously to the IPTG induction. The expression level of the protein was independent from the metal ion incorporated in the growth medium (data not shown).

3.4. Purification and physical properties of SacPox Sixty milligrams of pure enzyme were obtained starting from an 8-litre E. coli culture. Identification and purity were evaluated by SDSePAGE analysis. The apparent molecular mass of the unique band observed on SDSePAGE was about 35,000 Da (Fig. 4A, lane 1), in agreement with a molecular mass predicted from the sequence of 35,307 Da. By HPLC analysis on reverse-phase C18 column a main peak eluting at about 50% of acetonitrile in 0.1% TFA was observed (95% purity; data not shown). The identity of the protein was confirmed by an LC/MS experiment on a Q-Star mass spectrometer of the intact protein. The mass obtained (data not shown) was 35,306.76 Da in agreement with the theoretical mass (35,307.7 Da). The pure protein was also analysed by

632

E. Porzio et al. / Biochimie 89 (2007) 625e636

Fig. 4. Electrophoretic analysis of purified SacPox. (A) SDSePAGE: lane 1, 5 mg of purified SacPox; lane 2, molecular mass standards. (B) Non-denaturing electrophoresis: lane 3, 7 mg of Coomassie-stained SacPox; lane 4, 30 mg of SacPox stained in situ by b-naphthyl acetate activity.

3.5. SacPox oligomeric structure

Fig. 3. 3D model of SacPox. (A) Superposition of backbone traces (shown as tubes) of SacPox (yellow), PTE (pink), ePHP (red) structures. (B) Active site zoom showing the two Zn2þ metal ions of PTE (cyan spheres) as well as PTE and SacPox residues (side chains in blue and red, respectively) forming the binuclear metal cluster (SacPox residues: H23, H25, K138, H171, H200 and D257).

SELDI-TOF. A peak of mass 35,576.87 was observed (Fig. 5). Quite interestingly, this mass corresponds exactly to the predicted mass of 35,307.7 Da, plus two cadmium atoms (112.4  2 ¼ 224.8 Da), plus CO2 (44 Da) due to lysine carboxylation. This experiment suggests that metals are tightly bound to the enzyme as demonstrated for SsoPox [4] and that probably K138 is carboxylated. As shown in Fig. 4B, after non-denaturing PAGE, a single band was observed either by Coomassie-staining (lane 3) or after in situ activity-staining with b-naphthyl-acetate as substrate (lane 4). The two bands display the same electrophoretic mobility.

The apparent molecular mass of the enzyme in non-denaturing conditions was measured by a gel filtration High Performance Superose 12 10/300 GL column (Pharmacia, Sweden), developed on a FPLC system. A value of 69.1  6.9 kDa was estimated by interpolation on a calibration curve (data not shown). This value is quite near to the mass of a dimeric form (calculated weight is 70.6 kDa). It is worth noting that SsoPox had exactly an intermediate mass between a monomeric and a dimeric mass (50 kDa; calculated MW ¼ 35,500) [4], ePHP has been reported to be monomeric both in solution and in crystals [26], whereas PTE has been crystallized as a dimer and reported to be monomeric [14] or dimeric in solution [15]. In order to shed some light on the oligomeric structures of SsoPox and SacPox we undertook cross-linking experiments with glutaraldehyde. As shown in Fig. 6 under conditions in which the lactate dehydrogenase was completely converted to a dimeric form (lanes 1e3), both SsoPox (lanes 5e7) and SacPox (lanes 8e10) were dimerized, although not completely. This result suggests that the dimer is the oligomeric structure of these proteins.

Fig. 5. SELDI-TOF analysis of SacPox. The peak at about 17 kDa is the double-charged protein.

E. Porzio et al. / Biochimie 89 (2007) 625e636

Fig. 6. Cross-linking experiments with 0.1% glutaraldehyde (GA). Lane 1: 4 mg lactate dehydrogenase (LD); lane 2: 2 mg LD (0.1 mg ml1) þ GA; lane 3: 4 mg LD (0.2 mg ml1) þ GA; lane 4: molecular mass standards; lane 5: 4 mg SsoPox; lane 6: 2 mg SsoPox (0.1 mg ml1) þ GA; lane 7: 4 mg SsoPox (0.2 mg ml1) þ GA; lane 8: 4 mg SacPox; lane 9: 2 mg SacPox (0.1 mg ml1) þ GA; lane 10: 4 mg SacPox (0.2 mg ml1) þ GA.

3.6. pH optimum, thermophilicity and thermostability The dependence of paraoxonase activity from pH was examined at 70  C (see below). Absorbance reading was performed at 348 nm, the pH-independent isosbestic point between the p-nitrophenol and p-nitrophenolate ion. As reported in Fig. 7A, by using four different buffers over the pH range 5.0e10.0, the maximum of activity was broad in the range of pH 9.0. This value is quite different from the value reported for SsoPox (pH 8.0) and similar to values reported for PTE (pH 9e10); however in the last instance, values could not be easily compared because data were not acquired at 348 nm. The relationship between activity and temperature over the range 30e90  C was obtained using paraoxon as substrate (Fig. 7B). The maximum of activity was obtained at

633

a temperature of 75  C, similar to other enzymes from S. acidocaldarius and substantially lower with respect to SsoPox optimal temperature (95  C). All characterizations were performed at 70  C, this being the temperature at which SsoPox has been characterized. The SacPox thermal stability was evaluated by measuring the residual activity after incubation of enzyme samples, for different lengths of time (until 2 h), at temperatures spanning the range 70e90  C (Fig. 7C). After 2 h incubation at 70  C, no changes in activity were observed. A 30% and 35% decrease was observed after the same incubation time at 80  C and 85  C, respectively. At 90  C, a t1/2 value of 5 min was observed. The time course of inactivation followed a first order kinetic for each temperature suggesting that we were looking at a single molecular phenomenon. The intrinsic thermal stability of this enzyme is a property of valuable interest for biotechnological applications. Although SacPox appears less stable than SsoPox (t1/2 ¼ 4 h at 95  C) [4], it is still a very stable enzyme. Reported data of thermal stability on PTE indicate loss of activity in the range 35e60  C and complete inactivation at 60  C [41]. Although for PTE it has been reported that immobilization dramatically improves enzyme stability [29], it should be considered that immobilization costs are usually high and the kinetic properties of the enzyme could change following the immobilization procedure. Therefore, thermostable enzymes are good candidate substitutes for mesophilic PTEs. 3.7. Substrate specificity A preliminary screening with several substrates at 0.5 mM concentration was performed (Table 2). The enzyme had hydrolytic activity against pNP-butanoate, bis pNP-phosphate and several organophosphate insecticides. The esterase activity was >10 times higher than in SsoPox, while the reverse was observed for phosphodiesterase activity. The best substrate among pesticides was methyl-Paraoxon, similar to

Fig. 7. SacPox optimum pH, thermophilicity and thermostability. (A) pH profile of SacPox: the activity of the enzyme on the substrate paraoxon (1 mM) was measured at 70  C. Buffers used were 20 mM Na2HPO4/NaH2PO4 over the range 5.0e8.5 (empty circles), 20 mM TriseHCl over the range 7.5e9.0 (full circles), 20 mM Na2B4O7/H3BO3 over the range 8.0e9.0 (squares), and 20 mM H3BO3/KCl/NaOH over the range 7.5e10.0 (triangles). (B) Thermophilicity of SacPox: the activity was measured at different temperatures using the standard assay. (C) Thermal stability of SacPox: the pure enzyme (0.2 mg ml1) was incubated in a sealed glass vials at 70  C (triangles), 80  C (full squares), 85  C (empty circles) and 90  C (full circles). Samples were withdrawn at indicated times and assayed by the standard assay. Data were reported as logarithm of residual activity (%) with respect to a non-incubated sample.

E. Porzio et al. / Biochimie 89 (2007) 625e636

634 Table 2 Activities against different substrates

Specific activity (U mg1)

pNP-Butanoate Bis-pNP phosphate Paraoxon Methyl-Paraoxon Parathion Methyl-Parathion Dursban Coumaphos Diazinon a

SacPox

SsoPoxa

0.65  0.06 0.0008  0.0002 0.24  0.03 1.38  0.01 0.0400  0.0097 0.54  0.06 0.027  0.002 0.018  0.003 0.10  0.01

0.043  0.004 0.0065  0.0002 0.42  0.02 1.125  0.240 0.019  0.001 0.0090  0.0003 0.0460  0.005 0.0240  0.002 0.0110  0.0004

These data were taken from ref. [4].

SsoPox. However, a significant difference was observed with methyl-Parathion. In fact its activity was about 60 times higher than in SsoPox. This difference appears still more significant if one considers the activity against Parathion, which is only two times higher than in SsoPox. Thus a difference of just a methyl group results in a huge change in activity for the two enzymes. A similar behaviour was observed for other pesticides. For Dursban and Coumaphos similar values were obtained for SacPox and SsoPox. Finally, for Diazinon the activity was 10 times higher in SacPox. With freshly prepared SacPox the Michaelis and Menten constant was 1.4 mM on the substrate methyl-Paraoxon (Table 3). From the calculated specific activity of 3.68 U mg1 and the molecular weight of 35,307, the values of kcat and s ¼ kcat/KM were 7.75 s1 and 5,570 M1 s1, respectively (Table 3). Considering that the second order rate constant for the chemical hydrolysis of paraoxon by KOH is 7.5  102 M1 s1 (at pH 7.0 and 25  C) [1], the catalytic rate enhancement was 7.4  104. With paraoxon as a substrate, we were not able to see a maximum of activity up to a concentration of 5 mM. This suggests a very high KM for this substrate. It was only possible to calculate the kcat/KM as the slope of the linear part of the plot of activity against subsaturating substrate concentrations. The calculated value of 0.91, about 4 times lower with respect to methyl-paraoxon, is in agreement with the difference observed in specific activity assayed at 0.5 mM substrates concentration. Experimentally determined values for kcat, KM and s with methyl-paraoxon as the substrate at 75  C (Table 3), were compared with the results obtained for SsoPox and P. diminuta PTE [14]. SacPox shows a 7-fold higher kcat on methyl-paraoxon but a 7-fold increase of KM with respect to SsoPox.

This results in a very similar proficiency. However, SacPox shows a kcat only 1000-fold lower (10,000-fold reported in the case of SsoPox) with respect to PTE and a similar value of KM (Table 3; 0.9 mM for PTE) [42], in their respective optimal conditions. The above results recall the still open question concerning the identity of natural substrates for PTE/OPDs and PHPs as well as the problem of evolution of enzyme activities on a short-range time scale. A current hypothesis is that highlyactive PTE/OPDs evolved very recently from an enzyme with different substrate specificity, perhaps belonging to the PHP or a nearby family [43]. Directed evolution experiments indicate that the presence of promiscuous activities in some enzymes are starting points from which new functionality can be evolved without compromising very much the main function [43,44]. In this scenario SacPox and SsoPox paraoxonase activities could be promiscuous activities of another more physiologically important activity, especially considering that the natural habitat of Sulfolobus spp. (about 80  C and low pH) is not favourable for the stability of these xenobiotics, which appeared in the environment only in the last fifty years [45]. The purified SacPox, as reported for SsoPox [4], was also able to catalyse the hydrolysis of b-naphthylacetate and pNP-butanoate (Fig. 3B and Table 2), typical substrates for carboxylesterases. Although lower than the paraoxonase activities, a large difference was observed between SacPox and SsoPox with respect to this activity, suggesting differential evolution independent from the main activity and reinforcing what said above about evolution of their promiscuous activities. The ability to catalyse hydrolysis of C-O and P-O bonds has been recently reported for other enzymes [46e48], suggesting convergent evolution in the respective hydrolytic mechanisms. SacPox is able to degrade several pesticides, as reported in Table 2. Therefore, as suspected from sequence signatures, the enzyme seems more similar to PTE than to ePHP. It would be interesting to test the activities of others members classified in the PHP family [3,14] in order to ascertain if Sulfolobus enzymes belong to this family or to a different one that could be considered as an intermediate step toward the evolution of PTE/OPDs. It is also worth noting that the SacPox and SsoPox genes are chromosomally located, as also reported for ePHP [3], while PTE/OPDs are located on plasmids [3,14]. This could strengthen the suggestion that a member of the PHP family or of a related family is a precursor of PTE/ OPDs, likely through mechanisms of horizontal gene transfer.

Table 3 Kinetic parameters Enzyme

Substrates 

SacPox (75 C; pH 9.0) SsoPoxb (70  C; pH 8.0) a

a

Paraoxon Me-Paraoxon Paraoxon Me-Paraoxon

U mg1

kcat (s1)

KM (mM)

kcat/KM (mM1 s1)

1.27  0.04 3.68  0.07 0.42  0.02 2.20  0.09

n.d. 7.75  0.33 0.24  0.01 1.30  0.05

n.d. 1.40  0.12 0.060  0.009 0.205  0.023

0.91  0.06 5.57  0.71 4.00  0.75 6.34  0.58

For paraoxon the KM value could not be determined up to a 5 mM concentration. Only kcat/KM values were calculated from non-saturing concentrations. n.d., not determined. b These data were taken from ref. [4].

E. Porzio et al. / Biochimie 89 (2007) 625e636

This hypothesis is supported by the phylogenetic tree shown in Fig. 1, which groups archaeal enzymes with bacterial ones. Acknowledgements This work was supported by the MIUR grant Piano Nazionale Ricerca per le Biotecnologie Avanzate IIdTema 6 ‘‘Biocatalisi’’. We also acknowledge the ‘‘Centro Regionale di Competenza in Biotecnologie Industriali ATIBBdBioTekNet’’. References [1] F.M. Raushel, Bacterial detoxification of organophosphate nerve agents, Curr. Opin. Microbiol. 5 (2002) 288e295. [2] K.E. LeJeune, J.R. Wild, A.J. Russell, Nerve agents degraded by enzymatic foams, Nature 395 (1998) 27e28. [3] X. Hou, R.L. Maser, B.S. Magenheimer, J.P. Calvet, A mouse kidneyand liver-expressed cDNA having homology with a prokaryotic parathion hydrolase (phosphotriesterase)-encoding gene: abnormal expression in injured and polycystic kidneys, Gene 168 (1996) 156e163. [4] L. Merone, L. Mandrich, M. Rossi, G. Manco, A thermostable phosphotriesterase from the archaeon Sulfolobus solfataricus: cloning, overexpression and properties, Extremophiles 9 (2005) 297e305. [5] T.C. Cheng, S.P. Harvey, A.N. Stroup, Purification and properties of a highly active organophosphorus acid anhydrolase from Alteromonas undina, Appl. Environ. Microbiol. 59 (1993) 3138e3140. [6] T.C. Cheng, V.K. Rastogi, J.J. DeFrank, G.P. Sawiris, G-type nerve agent decontamination by Alteromonas prolidase, Ann. N.Y. Acad. Sci. 864 (1998) 253e286. [7] R.D. Richins, I. Kaneva, A. Mulchandani, W. Chen, Biodegradation of organophosphorus pesticides by surface-expressed organophosphorus hydrolase, Nat. Biotechnol. 15 (1997) 984e987. [8] D.M. Munnecke, Enzymatic hydrolysis of organophosphate insecticides, a possible pesticide disposal method, Appl. Environ. Microbiol. 32 (1976) 7e13. [9] N. Sethunathan, T. Yoshida, A Flavobacterium sp. that degrades diazinon and parathion, Can. J. Microbiol. 19 (1973) 873e875. [10] I. Horne, T.D. Sutherland, R.L. Harcourt, R.J. Russell, J.G. Oakeshott, Identification of an opd (organophosphate degradation) gene in an Agrobacterium isolate, Appl. Environ. Microbiol. 68 (2002) 3371e3376. [11] D. Siddavattam, S. Khajamohiddin, B. Manavathi, S.B. Pakala, M. Merrick, Transposon-like organisation of plasmid-borne organophosphate degradation (opd) gene cluster found in Flavobacterium sp, Appl. Environ. Microbiol. 69 (2003) 2533e2539. [12] I. Horne, X. Qui, R.J. Russell, J.G. Oakeshott, The phosphotriesterase gene opdA in Agrobacterium radiobacter P230 is transposable, FEMS Microbiol. Lett. 222 (2003) 1e8. [13] C.M. Seibert, F.M. Raushel, Structural and catalytic diversity within the amidohydrolase superfamily, Biochemistry 44 (2005) 6383e6391. [14] D.P. Dumas, S.R. Caldwell, J.R. Wild, F.M. Raushel, Purification and properties of the phosphotriesterase from Pseudomonas diminuta, J. Biol. Chem. 264 (1989) 9659e19665. [15] M.M. Benning, J.M. Kuo, F.M. Raushel, H.M. Holden, Three-dimensional structure of phosphotriesterase: an enzyme capable of detoxifying organophosphate nerve agents, Biochemistry 33 (1994) 15001e15007. [16] M.M. Benning, J.M. Kuo, F.M. Raushel, H.M. Holden, Three-dimensional structure of the binuclear metal center of phosphotriesterase, Biochemistry 34 (1995) 7973e7938. [17] M.M. Benning, S.B. Hong, F.M. Raushel, H.M. Holden, The binding of substrate analogs to phosphotriesterase, J. Biol. Chem. 275 (2000) 30556e30560. [18] M.M. Benning, H. Shim, F.M. Raushel, H.M. Holden, High-resolution Xray structures of different metal-substituted forms of phosphotriesterase from Pseudomonas diminuta, Biochemistry 40 (2001) 2712e2722.

635

[19] H. Shim, F.M. Raushel, Self-assembly of the binuclear center of phosphotriesterase, Biochemistry 39 (2000) 7357e7364. [20] S.R. Caldwell, J.R. Newcomb, K.A. Schlecht, F.M. Raushel, Limits of diffusion in the hydrolysis of substrates by the phosphotriesterase from Pseudomonas diminuta, Biochemistry 30 (1991) 7438e7444. [21] W.J. Donarski, D.P. Dumas, D.H. Heitmeyer, V.E. Lewis, F.M. Raushel, Structure-activity relationships in the hydrolysis of substrates by the phosphotriesterase from Pseudomonas diminuta, Biochemistry 28 (1989) 4650e4655. [22] D.P. Dumas, H.D. Durst, W.G. Landis, F.M. Raushel, J.R. Wild, Inactivation of organophosphorus nerve agents by the phosphotriesterase from Pseudomonas diminuta, Arch. Biochem. Biophys. 277 (1990) 155e159. [23] C. Roodvelt, D.S. Tawfik, Shared promiscuous activities and evolutionary features in various members of amidohydrolase superfamily, Biochemistry 44 (2005) 12728e12736. [24] V.E. Lewis, W.J. Donarski, J.R. Wild, F.M. Raushel, Mechanism and stereochemical course at phosphorus of the reaction catalyzed by a bacterial phosphotriesterase, Biochemistry 27 (1988) 1591e1597. [25] S.D. Aubert, Y. Li, F.M. Raushel, Mechanism for the hydrolysis of organophosphates by the bacterial phosphotriesterase, Biochemistry 43 (2004) 5707e5715. [26] J.L. Buchbinder, R.C. Stephenson, M.J. Dresser, J.W. Pitera, T.S. Scanlan, R.J. Fletterick, Biochemical characterization and crystallographic structure of an Escherichia coli protein from the phosphotriesterase gene family, Biochemistry 37 (1998) 5096e5106. [27] R. Marti-Arbona, C. Xu, S. Steele, A. Weeks, G.F. Kuty, C.M. Seibert, F.M. Raushel, Annotating enzymes of unknown function: N-formimino-L-glutamate deiminase is a member of the amidohydrolase superfamily, Biochemistry 45 (2006) 1997e2005. [28] G. Manco, L. Merone, L. Mandrich, M. Rossi. A new phosphotriesterase cloned from the archaeon Sulfolobus solfataricus MT4, in: Proceedings of the first Japanese Conference on Extremophiles, 2005, Available from: . [29] K.E. LeJune, A.J. Mesiano, S.B. Bower, J.K. Grimsley, J.R. Wild, A.J. Russell, Dramatically stabilized phosphotriesterase-polymers for nerve agent degradation, Biotech. Bioeng. 54 (1997) 105e114. [30] R.D. Richins, A. Mulchandani, W. Chen, Expression, immobilization and enzymatic characterization of cellulose-binding domain-organophosphate hydrolase fusion enzymes, Biotechnol. Bioeng. 69 (2000) 591e596. [31] L. Chen, K. Brugger, M. Skovgaard, P. Redder, Q. She, E. Torarinsson, B. Greve, M. Awayez, A. Zibat, H.P. Klenk, R.A. Garrett, The genome of Sulfolobus acidocaldarius, a model organism of the Crenarchaeota, J. Bacteriol. 187 (2005) 4992e4999. [32] F.W. Studier, A.H. Rosenberg, J.J. Dunn, J.W. Dubendorff, Use of T7 RNA polymerase to direct expression of cloned genes, Methods Enzymol. 185 (1990) 60e89. [33] W.C. Brown, J.L. Campbell, A new cloning vector and expression strategy for genes encoding proteins toxic to Escherichia coli, Gene 127 (1993) 99e103. [34] U.K. Laemmli, Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature 227 (1970) 680e685. [35] G. Manco, E. Adinolfi, F.M. Pisani, G. Ottolina, G. Carrea, M. Rossi, Overexpression and properties of a new thermophilic and thermostable esterase from Bacillus acidocaldarius with sequence similarity to hormone-sensitive lipase subfamily, Biochem. J. 332 (1998) 203e212. [36] A. Sali, L. Potterton, F. Yuan, H. van Vlijmen, M. Karplus, Evaluation of comparative protein modelling by MODELLER, Proteins 23 (1995) 318e326. [37] K.A. Brown, Phosphotriesterases of Flavobacterium sp, Soil. Biol. Biochem. 12 (1980) 105e112. [38] J.L. Vanhooke, M.M. Benning, F.M. Raushel, H.M. Holden, Three-dimensional structure of the zinc-containing phosphotriesterase with the bound substrate analog diethyl 4-methylbenzylphosphonate, Biochemistry 35 (1996) 6020e6025. [39] M. Chen-Goodspeed, M.A. Sogorb, F. Wu, S.B. Hong, F.M. Raushel, Structural determinants of the substrate and stereochemical specificity of phosphotriesterase, Biochemistry 40 (2001) 1325e1331.

636

E. Porzio et al. / Biochimie 89 (2007) 625e636

[40] G.A. Omburo, J.M. Kuo, L.S. Mullins, F.M. Raushel, Characterization of the zinc binding site of bacterial phosphotriesterase, J. Biol. Chem. 267 (1992) 13278e13283. [41] D. Rochu, N. Viguie, F. Renault, D. Crouzier, M.T. Froment, P. Masson, Contribution of the active site metal cation to catalytic activity and to conformational stability of phosphotriesterase: a thermo- and pH-dependence study, Biochem. J. 380 (2004) 627e633. [42] H. Yang, P.D. Carr, S.Y. McLoughlin, J.W. Liu, I. Horne, X. Qiu, C.M. Jeffries, R.J. Russell, J.G. Oakeshott, D.L. Ollis, Evolution of an organophosphate-degrading enzyme: a comparison of natural and direct evolution, Protein Eng. 16 (2003) 135e145. [43] A. Aharoni, L. Gaidukov, O. Khersonsky, S. Gould, C. McQ Roodveldt, D.S. Tawfik, The ‘evolvability’ of promiscuous protein functions, Nat. Genet. 37 (2005) 73e76. [44] S.G. Peisajovich, L. Rockah, D.S. Tawfik, Evolution of new protein topologies through multistep gene rearrangements, Nat. Genet. 38 (2006) 168e174.

[45] G. Schrader, Die Entwicklung neur Insektizider Phosphorsaure-Ester, 3rd edition, Verlag Chemie, Weinheim, 1963. [46] S. Bencharit, C.L. Morton, Y. Xue, P.M. Potter, M.R. Redinbo, Structural basis of heroin and cocaine metabolism by a promiscuous human drugprocessing enzyme, Nat. Struct. Biol. 10 (2003) 349e356. [47] C.B. Millard, O. Lockridge, C.A. Broomfield, Organophosphorus acid anhydride hydrolase activity in human butyrylcholinesterase: synergy results in a somanase, Biochemistry 37 (1998) 237e247. [48] M. Harel, A. Aharoni, L. Gaidukov, B. Brumshtein, O. Khersonsky, R. Meged, H. Dvir, R.B. Ravelli, A. McCarthy, L. Toker, I. Silman, J.L. Sussman, D.S. Tawfik, Structure and evolution of the serum paraoxonase family of detoxifying and anti-atherosclerotic enzymes, Nat. Struct. Mol. Biol. 11 (2004) 412e419. [49] K. Howe, A. Bateman, R. Durbin, QuickTree: building huge neighbour-joining trees of protein sequences, Bioinformatics 18 (2002) 1546e1547.