A Novel Conserved Cochlear Gene, OTOR: Identification, Expression Analysis, and Chromosomal Mapping

Genomics 66, 242–248 (2000) doi:10.1006/geno.2000.6224, available online at http://www.idealibrary.com on

A Novel Conserved Cochlear Gene, OTOR: Identification, Expression Analysis, and Chromosomal Mapping Nahid G. Robertson,* ,† Stefan Heller,‡ Jason S. Lin,* ,† Barbara L. Resendes,* ,† ,§ Stanislawa Weremowicz,* ,§ Charlotte S. Denis,‡ Andrea M. Bell,‡ A. J. Hudspeth,‡ and Cynthia C. Morton* ,† ,§ ,1 *Department of Pathology, and †Department of Obstetrics, Gynecology, and Reproductive Biology, Brigham and Women’s Hospital, §Harvard Medical School, Boston, Massachusetts 02115; and ‡Laboratory of Sensory Neuroscience and Howard Hughes Medical Institute, The Rockefeller University, New York, New York 10021 Received February 16, 2000; accepted April 13, 2000

We have identified a novel cochlear gene, designated OTOR, from a comparative sequence analysis of over 4000 clones from a human fetal cochlear cDNA library. Northern blot analysis of human and chicken organs shows strong OTOR expression only in the cochlea; very low levels are detected in the chicken eye and spinal cord. Otor and Col2A1 are coexpressed in the cartilaginous plates of the neural and abneural limbs of the chicken cochlea, structures analogous to the mammalian spiral limbus, osseous spiral lamina, and spiral ligament, and not in any other tissues in head and body sections. The human OTOR gene localizes to chromosome 20 in bands p11.23–p12.1 and more precisely to STS marker WI-16380. We have isolated cDNAs orthologous to human OTOR in the mouse, chicken, and bullfrog. The encoded protein, designated otoraplin, has a predicted secretion signal peptide sequence and shows a high degree of cross-species conservation. Otoraplin is homologous to the protein encoded by CDRAP/MIA (cartilage-derived retinoic acid sensitive protein/melanoma inhibitory activity), which is expressed predominantly by chondrocytes, functions in cartilage development and maintenance, and has growth-inhibitory activity in melanoma cell lines. © 2000 Academic Press

INTRODUCTION

Hearing loss is the most prevalent sensory deficit in humans, with a variety of genetic and environmental causes. Approximately one in a thousand children in the United States has congenital deafness, with half of the cases estimated to have a genetic basis (Morton, Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession Nos. AF233261, AF233333, AF233518, and AF233519. 1 To whom correspondence should be addressed at Department of Pathology, Brigham and Women’s Hospital, 75 Francis Street, Boston, MA 02115. Telephone: (617) 732-7980. Fax: (617) 738-6996. E-mail: [email protected].

0888-7543/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.

1991; Reardon, 1992; Marazita et al., 1993). The great genetic heterogeneity seen in heritable deafness suggests the involvement of many genes in hearing. This inference is supported by the complexity of the inner ear in terms of the number of tissue and cell types in the highly structured and ionically regulated cochlear and vestibular labyrinths. In addition to the hundreds of known syndromes that include hearing loss as well as anomalies in other organ systems (Gorlin et al., 1995), a growing number of nonsyndromic deafness disorders are being recognized, in which defects of the inner ear are the only apparent findings. To date, over 60 genetic loci for nonsyndromic deafness have been identified by linkage studies, and 14 nuclear genes have been shown to be mutated in nonsyndromic hearing loss (Robertson and Morton, 1999; Van Camp and Smith, 2000). Although rapid progress has been made in the identification of deafness genes, it is estimated that hundreds of genes, most of which remain to be elucidated, play roles in the proper functioning of the inner ear. To identify potentially important genes in the hearing process, we previously took an organ-specific approach by constructing a human fetal cochlear cDNA library and using subtractive techniques to isolate transcripts that were differentially expressed in the cochlea (Robertson et al., 1994). One of these cDNAs, a novel cochlear gene, COCH, was subsequently shown in several American and European families (Robertson et al., 1998; de Kok et al., 1999; Fransen et al., 1999) to be mutated in the sensorineural deafness and vestibular disorder DFNA9. Inner-ear library construction and subtractive approaches by other investigators (Cohen-Salmon et al., 1997; Heller et al., 1998) have also proven useful in identifying genes localized to the cochlea and potentially important in hearing. Some of these genes are now being evaluated as candidate genes for mapped deafness disorders. In an effort to use our human fetal cochlear cDNA library as a resource for all genes expressed in this

242

IDENTIFICATION AND CHARACTERIZATION OF A NOVEL COCHLEAR GENE, OTOR

organ, and to sequence clones exhaustively from this library, we have generated and deposited in the GenBank database over 8000 expressed sequence tags (ESTs) from the original unsubtracted library. Analysis of the first round of sequencing (⬃4000 ESTs) (Skvorak et al., 1999) revealed that the ESTs could be grouped into useful categories such as transcripts of known genes, potentially new members of existing gene families, novel human sequences with homologies to known genes in other species, and altogether novel sequences, some with interesting functional motifs. A list of these ESTs, including for some the chromosomal map locations that would identify them as candidate genes for mapped deafness loci, is available on our Web site (http://hearing.bwh.harvard.edu). We performed a cluster analysis of the cochlear ESTs to identify groups of overlapping clones, reflecting the relative abundance of these transcripts in the randomly sequenced, unsubtracted, and nonnormalized cochlear library (Skvorak et al., 1999). Another interesting analysis is the identification of cochlear ESTs that do not match any ESTs from other organ-specific cDNA libraries deposited in the database; these ESTs may be uniquely or predominantly expressed in the cochlea. A relatively large percentage (13%) of the sequenced clones appear to be “unique” to the cochlea, reflecting the complexity of this specialized sensory organ. We have designated one of the unique cDNAs identified by this means as OTOR. The corresponding protein is termed otoraplin on the basis of its abundant and differential expression in otic tissue and its homology to a known gene, CDRAP/MIA (cartilage-derived retinoic acid-sensitive protein/melanoma inhibitory activity). CDRAP/MIA encodes a secreted growth-regulatory factor expressed predominantly in skeletal tissues, thought to play a role in cartilage development and maintenance (Dietz and Sandell, 1996), and in some neuroectodermal tumors such as malignant melanomas (Blesch et al., 1994). Here, we present identification and sequence analysis of OTOR in four species, with mRNA expression analysis, chromosomal mapping, and a discussion of its possible role in the inner ear. MATERIALS AND METHODS Isolation of cDNAs. To obtain the full-length human OTOR cDNA corresponding to the EST with GenBank Accession No. N63222, we screened 10 6 recombinant phage from a human fetal cochlear CapFinder (Clontech, Palo Alto, CA) cDNA library (Robertson et al., 1997) cloned into Lambda ZAP II vector (Stratagene, La Jolla, CA). Filters were prehybridized and then hybridized at 42°C with a 32P-labeled random-primed (Feinberg and Vogelstein, 1984) N63222 probe of 400 bp in size in 10% dextran sulfate, 4⫻ SSC, 7 mM Tris–HCl (pH 7.6), 0.8⫻ Denhardt’s solution, and 20 ␮g/ml sonicated herring sperm DNA in 40% formamide and 0.5% SDS. Filters were washed in 0.1⫻ SSC in 0.1% SDS at 50°C prior to autoradiography using XAR-5 film (Eastman Kodak Co., Rochester, NY) and intensifying screens at ⫺80°C. To clone the mouse ortholog of OTOR, we screened a P16 mouse cochlear cDNA library (Crozet et al., 1997) by the colony-hybridization protocol (Stratagene) with a 390-bp, PCR-generated, 32P-labeled probe (Robertson et al., 1997).

243

The probe, which was generated with the oligonucleotides GAAGATGGCAAGAATATTG and GAAGAAGTCAATATCCGTGG, spanned the entire coding region of human OTOR (Accession No. AF233261). The chicken and bullfrog (Rana catesbeiana) orthologs of OTOR were isolated from a late embryonic chicken cochlear cDNA library and a bullfrog saccular library using the human cDNA probe and a mixture of the human and chicken probes, respectively. Isolation of genomic clones. A human male placental genomic library in Lambda FIX II (Stratagene) was screened with the human OTOR probe as described above for the cDNA library. Genomic clones isolated from this screening were used as probes for FISH mapping (see below). Sequence analysis. Nucleotide sequence of clones was determined using an ABI PRISM dye-terminator cycle-sequencing system (PE Applied Biosystems, Foster City, CA). Sequence analysis was performed using the University of Wisconsin Genetics Computer Group software (Devereux et al., 1984). Sequence alignment was performed using the Genetics Computer Group’s Bestfit program (GCG, Madison, WI). Comparison of sequences to those deposited in nucleotide and peptide databases was performed using the BLAST Network Service of the National Center for Biotechnology Information (Altschul et al., 1997). Northern blot analysis. Total cellular RNAs were extracted (Chirgwin et al., 1979) from second-trimester human fetal organs including cochlea (membranous labyrinths), brain, eye, skin, epiglottis, skull (cranium), thymus, spleen, heart, lung, small intestine, large intestine, tongue, skeletal muscle, testis, ovary, liver, kidney, bone marrow, and pituitary. All human organs were obtained in accordance with guidelines established by the Human Research Committee at Brigham and Women’s Hospital. RNAs from posthatching chicken organs including cochlea, cerebellum, forebrain, midbrain, spinal cord, eye, heart, skeletal muscle, kidney, skin, and liver were also extracted by the same method. Ten micrograms of each of the RNAs was electrophoresed in denaturing 1% agarose– formaldehyde gels and transferred to GeneScreen filters (DuPont, Wilmington, DE; Thomas, 1980). Ethidium bromide-stained RNAs were visualized on the filters to confirm the transfer, integrity, and concentration of RNAs. Filters were prehybridized for 2– 4 h and hybridized overnight at 42°C as described above with a 32P-labeled probe (Feinberg and Vogelstein, 1984) derived from the original human OTOR 400-bp EST (Accession No. N63222) or with a chicken Otor cDNA probe. Filters were washed in 0.1⫻ SSC in 0.1% SDS at 42–55°C prior to autoradiography using XAR-5 film with intensifying screens at ⫺80°C. Control hybridizations of these filters with a GAPDH probe verified equal loading and integrity of the transferred RNAs and were consistent with the ethidium bromide staining of the RNAs. In situ hybridization. In situ hybridization with digoxigenin-labeled riboprobes on cryosections of chicken whole bodies, heads, and cochleae was conducted by a modification of a published protocol (Schaeren-Wiemers and Gerfin-Moser, 1993). Antisense probes and sense controls covered the entire coding sequence and the 3⬘ untranslated region of chicken Otor and approximately 1.2 kb that included the 3⬘ untranslated region of chicken Col2A1. Seventeen-micrometer frozen sections were cut with a cryomicrotome (Leica, Malvern, PA), collected on silylated slides (PGC Scientific, Gaithersburg, MD), dried at 37°C for 45 min, and stored frozen at ⫺70°C until use. For hybridization, sections were brought to room temperature, rehydrated in 120 ␮l of diluted probe (1:100) in 50% (v/v) formamide, 10% (w/v) dextran sulfate, 1 mg/ml yeast RNA, 1⫻ Denhardt’s solution, 185 mM NaCl, 5.6 mM NaH 2PO 4, 5 mM NaH 2PO 4, 5 mM EDTA, and 15 mM Tris at pH 7.5 and incubated overnight at 65°C. After washing and immunological detection with alkaline phosphatase-conjugated anti-digoxigenin Fab fragments (Boehringer Mannheim, Indianapolis, IN), the sections were exposed to nitro-blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphate substrate (Pierce, Rockford, IL), covered, and incubated overnight at room temperature in a humidified chamber. The color reaction was stopped with PBS, and the slides were mounted in 50% (v/v) glycerol in PBS. Photog-

244

ROBERTSON ET AL.

FIG. 1. Alignment of the complete deduced amino acid sequences of human, mouse, chicken, and bullfrog otoraplins, the proteins encoded by OTOR and its orthologs, and of the human CDRAP/MIA product (Blesch et al., 1994). The horizontal line indicates the predicted signal peptide sequence, a feature of secreted proteins. Dots represent amino acid residues that are identical to those in human otoraplin (excluding the signal peptide), and dashes indicate gaps introduced to align the sequences. All cysteine residues (boxed) are conserved in the otoraplin sequences across the four species, as well as in cdrap/mia. A high degree of overall homology indicates cross-species conservation of OTOR and also suggests that OTOR and CDRAP/MIA are members of the same family of genes. raphy was performed with a MC80 camera on an Axiovert 135 microscope (Carl Zeiss, Thornwood, NY) using Ektachrome 160T film (Eastman Kodak Co.). Gene mapping. Human genomic clones corresponding to OTOR were used as probes for fluorescence in situ hybridization (FISH). Probes were labeled with digoxigenin-11– dUTP (Boehringer Mannheim) using dNTPs obtained from the same manufacturer and the DNase I/DNA polymerase I mixture from the BioNick Labeling System (Gibco BRL, Gaithersburg, MD). DNA was coprecipitated with 5 ␮g of Cot-1 DNA (Gibco BRL) and resuspended in 1⫻ TE at 100 ␮g/ml. Hybridization of metaphase chromosomes from peripheral blood lymphocytes obtained from two normal males was performed with the OTOR probe at a concentration of 10 ␮g/ml in Hybrisol VI (Ney et al., 1993). Digoxigenin-labeled probe was detected with reagents supplied in the Oncor kit (Oncor, Gaithersburg, MD) according to the manufacturer’s recommendations. Metaphase chromosomes were counterstained with 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) (Oncor). The map position of the labeled OTOR probe was determined by visual inspection of the fluorescent signal on the DAPI-stained metaphase chromosomes. Hybridization was observed with a Zeiss Axiophot microscope, and photographs were prepared using the CytoVision Imaging System (Applied Imaging, Pittsburgh, PA).

RESULTS AND DISCUSSION

cDNA Isolation and Sequence Analysis From the analysis of over 4000 ESTs from our human fetal cochlear cDNA library, we identified an EST (No. N63222) representing a “cluster” clone, a cDNA that appeared several times in the random sequencing of a large number of clones and thus represented an abundantly expressed cochlear transcript. Because it did not match any EST from other organ-specific cDNA libraries deposited in the GenBank database, this EST appeared to be unique to the cochlea by BLAST analysis (Altschul et al., 1997). However, the clone did show homology to one EST from a whole mouse fetal cDNA library, which could represent a transcript from the otic vesicle. We isolated the full-length coding cDNA representing the N63222 EST. A BLASTX homology search of

the deduced amino acid sequence revealed a high degree of homology (Fig. 1) to a protein encoded by CDRAP/MIA (Blesch et al., 1994; Dietz and Sandell, 1996). Based on this homology, the symbol OTOR is given to the cochlear gene; the encoded protein is termed otoraplin. MIA (melanoma inhibitory activity) and CDRAP (cartilage-derived retinoic acid-sensitive protein) represent one gene, independently isolated from two sources and given different names: MIA from human melanoma cell lines (Blesch et al., 1994) and Cdrap from bovine chondrocytes (Dietz and Sandell, 1996). Expressed predominantly in skeletal cartilage, CDRAP/MIA is downregulated by retinoic acid (Dietz and Sandell, 1996), which has known effects on growth and differentiation during cartilage and bone development (Tickle et al., 1982; Heath et al., 1989; Iwamoto et al., 1993; Lau et al., 1993). The protein encoded by CDRAP/MIA is also secreted by, and is a potent cell growth inhibitor of, malignant melanoma cells and some other neuroectodermal tumors, such as gliomas (Blesch et al., 1994). The human OTOR and CDRAP/MIA genes encode small proteins of 128 and 131 amino acids, respectively (Fig. 1), with 43% amino acid identity and 67% similarity, taking into account conservative amino acid changes, as assessed by using the University of Wisconsin Genetics Computer Group software (Devereux et al., 1984). Both proteins have markedly hydrophobic N-terminal regions (Kyte and Doolittle, 1982) with features characteristic of eukaryotic signal peptides (von Heijne, 1986) present in secreted proteins. The small difference in the length of the two proteins and the greatest divergence in their amino acid residues occur in the signal peptide, which would be cleaved and absent from the mature protein. There are no other known structural motifs in either protein. All four cysteine residues are conserved between the two proteins, suggesting a similar pattern of disulfide bonds. It is very likely that OTOR and CDRAP/MIA are in the

IDENTIFICATION AND CHARACTERIZATION OF A NOVEL COCHLEAR GENE, OTOR

245

FIG. 2. (A) Autoradiograph of Northern blots of 10 ␮g of total RNAs extracted from human fetal cochlea, brain, thymus, spleen, lung, striated muscle (tongue), testis, liver, kidney, bone marrow, and pituitary, hybridized with a human OTOR cDNA probe. High-level expression is seen only in the cochlea, with no detectable transcript in other tissues. A strongly hybridizing band is observed at ⬃1.1 kb, a medium-intensity band at ⬃1.8 kb, and a very faint band at ⬃4 kb. (B) Autoradiograph of Northern blots of 10 ␮g of total RNAs extracted from posthatching chicken cochlea, cerebellum, forebrain, midbrain, spinal cord, eye, heart, skeletal muscle, kidney, skin, and liver hybridized with a chicken Otor cDNA probe. High-level expression is seen only in the cochlea. A strongly hybridizing band is estimated as 1 kb in size and a weak band as 1.9 kb. On longer exposures, very low levels of Otor transcript are also detected in the chicken eye and spinal cord. The transcripts are indicated by arrows.

same gene family, of which no other members are known to date. We have also isolated cDNAs orthologous to human OTOR from inner-ear cDNA libraries of the mouse, chicken, and bullfrog. The deduced amino acid sequences in all four species (Fig. 1) show predicted secretion signal peptides as well as conservation of all cysteine residues. Excluding the signal peptides, the overall Otor amino acid identities of mouse, chicken, and bullfrog compared to the human sequence are 90, 80, and 60%, respectively. Taking into account conservative amino acid changes, the percentages for the homologies increase to 95, 90, and 81%. Expression Analysis To assess OTOR mRNA expression level and tissue distribution, we performed a Northern blot of a panel of human fetal organs including cochlea, brain, thymus, spleen, lung, striated muscle (tongue), testis, liver, kidney, bone marrow, and pituitary (Fig. 2A). High-level expression of OTOR (a strong band at ⬃1.1 kb, a lowerintensity band at ⬃1.8 kb, and a very weak band at ⬃4 kb) was seen only in the cochlea, with no detectable levels in the other organs tested. Subsequent Northern panels including cochlea, eye, skin, epiglottis, cranium, small intestine, large intestine, ovary, skeletal muscle, and heart showed no detectable message in any organs except the cochlea (data not shown). These findings confirm the initial subtractive approach of the computer analysis of the ESTs that was used to identify the OTOR cDNA as both a cluster clone (indicative of a highly expressed transcript) and a potentially unique clone that did not match any EST from other organspecific cDNA libraries (indicative of a transcript preferentially expressed in the cochlea). Northern blot analysis of chicken Otor on a panel of organs from the posthatching chick, including cochlea, cerebellum, forebrain, midbrain, spinal cord, eye,

heart, skeletal muscle, kidney, skin, and liver, showed a very high level of expression only in the cochlea (Fig. 2B). The predominant transcript was estimated as 1.0 kb, with a much fainter band at ⬃1.9 kb. On longer exposures, very low levels of Otor transcript were also detected in the chicken eye and spinal cord. For localization of Otor expression within the inner ear, we performed in situ hybridization on late embryonic and posthatching chicken cochlear sections (Fig. 3A). Strong Otor mRNA hybridization signal was detected in the fibrocartilaginous plates at the neural and abneural edges of the sensory epithelium, structures analogous to the mammalian spiral limbus, osseous spiral lamina, and spiral ligament. These are extracellular matrix areas that support the adjacent sensory hair cells of the chick basilar papilla, the equivalent of the mammalian organ of Corti. In the chicken inner-ear sections, Otor expression was notably lacking from the cartilaginous otic capsule surrounding the cochlea. In addition, in situ hybridization on transverse sections of late embryonic chicken heads and bodies showed no Otor expression in any other sites, including other cartilaginous tissues. This finding is of interest in relation to the homologous gene Cdrap/mia, which is predominantly expressed in developing cartilaginous and skeletal tissues, such as rat fetal skeletal cartilage and bovine fetal vertebral column, knee, and shoulder (Dietz and Sandell, 1996). Furthermore, in situ hybridization in the mouse embryo shows coexpression of Cdrap/mia and Col2A1 in all structures where type II collagen is expressed abundantly except the noncartilaginous tissues of the otic vesicle (Dietz and Sandell, 1996; Sandell et al., 1996). We also localized Col2A1 expression by in situ hybridization in the chicken cochlea (Fig. 3B) and found that it occurs in the same tissues as Otor expression (Fig. 3A).

246

ROBERTSON ET AL.

FIG. 3. In situ hybridization on late embryonic and posthatching chicken cochlear sections with (A) chicken Otor and (B) chicken Col2A1. (A) Intense Otor mRNA hybridization signal is detected in the tissue forming the fibrocartilaginous plates at the neural (1 and 2) and abneural (3) edges of the sensory epithelium (4), structures analogous to the mammalian spiral limbus (1), osseous spiral lamina (2), and spiral ligament (3). No Otor expression is detected in the surrounding cartilaginous otic capsule. (B) Intense Col2A1 hybridization signal is detected in the same sites (1, 2, 3) in the cochlea as Otor expression (A).

Chromosomal Mapping Physical mapping of novel genes to a region of the human genome identifies positional candidate genes for mapped deafness loci. To determine the chromosomal location of the human OTOR gene, we performed FISH. Map position was determined by visual inspection of the fluorescent hybridization signals on DAPIstained metaphase chromosomes. Using OTOR genomic clones obtained from screening a ␭ phage human genomic library, we detected signal in 22 metaphase preparations in bands p11.23–p12.1 of chromosome 20 (Fig. 4A). In all metaphase spreads examined, both copies of chromosome 20 were labeled. We additionally performed a BLASTN homology search using the OTOR cDNA and found a genomic clone (121,151 kb in size), in 20p11.22–p12.2, that contains the OTOR gene. The clone (Accession No. AL034428) was sequenced and characterized by the Sanger Centre and contains the following STS markers: SG49071, SG16074, WI-6871, WI-16380, SG20263, and SG49072 (Fig. 4B). The STS marker WI-16380, which spans nucleotides 76,115–76,213 on this genomic clone, is contained within the OTOR gene, which spans nucleotides 76,090 –79,318 on the clone. This analysis corroborates our FISH results and provides a more precise physical map assignment for the human OTOR gene. Although no known hearing disorder has been mapped to this region, deafness loci are being identified at a rapid pace, and many remain to be localized. Alagille syndrome, a disorder due to mutations in

JAG1 (Li et al., 1997; Oda et al., 1997), involves deletions and rearrangements in 20p and is characterized by liver disease as well as cardiac, skeletal, ocular, and facial abnormalities (Krantz et al., 1999). Although deafness is not a typical feature of this syndrome, some patients with deletions in this region do show signifi-

FIG. 4. Chromosome localization of the human OTOR gene. (A) Photograph of human metaphase chromosomes counterstained with DAPI following FISH with a human OTOR genomic probe. The two chromosomes 20 are indicated by numbers. Arrows point to the sites of hybridization of the digoxigenin-labeled OTOR probe on both chromosomes 20 in bands p11.23–p12.1. (B) Idiogram of human chromosome 20 with STS markers contained on a genomic clone (Accession No. AL034428) sequenced by the Sanger Centre (http:// www.sanger.ac.uk/HGP/) showing localization of the human OTOR gene to WI-16380. The STS markers indicated with an asterisk (WI-6871 and WI-16380) are located at ⬃65.9 cM on an integrated map of chromosome 20 from the Whitehead Institute for Biomedical Research/MIT Center for Genome Research (http://wwwgenome.wi.mit.edu/).

IDENTIFICATION AND CHARACTERIZATION OF A NOVEL COCHLEAR GENE, OTOR

cant hearing loss (Anad et al., 1990) and could be evaluated for deletion of OTOR. Possible Role of OTOR The expression pattern and localization of the OTOR transcript and the homology of the encoded protein to a known gene, CDRAP/MIA, may provide entry points into the study of its function in the inner ear. Because Cdrap/Mia expression colocalizes with that of Col2A1 in all sites in fetal mouse sections except for the otic vesicle, otoraplin, the cochlear homolog of cdrap, may be the otic counterpart of cdrap. We also have shown expression of Col2A1 and Otor in the same structures of the chicken cochlea. Both cdrap and type II collagen are expressed predominantly and abundantly in cartilaginous tissues, where cdrap is thought to be a regulatory molecule rather than a structural matrix component (Neame et al., 1999). Otosclerosis is a hearing disorder involving the bony tissues of the ear, in which resorption and replacement of endochondral bone by spongy bone, known as otosclerotic foci, occur in the bony labyrinth and in the stapes footplate at the oval window. Otosclerosis is a very common cause of late-onset hearing loss. It is thought to be genetically heterogeneous, with only one autosomal dominant locus at 15q25– q26 identified to date (Tomek et al., 1998). Although otosclerosis has been associated in some cases with mutations in COL1A1 found in mild osteogenesis imperfecta (McKenna et al., 1998), it is thought to be a disease affecting only the temporal bone. It is therefore proposed that there are features unique to the otic capsule that predispose it to otosclerosis (Wang et al., 1999). Because of the preferential and abundant expression of OTOR in the cochlea, it is possible that the corresponding protein, otoraplin, exerts an influence on the surrounding otic capsule. Otoraplin may alternatively function within the extracellular matrix of the membranous portion of the cochlea, where abundant expression of other genes such as COCH and the fibrillar collagens (types I, II, and III) has also been demonstrated (Khetarpal et al., 1994; Robertson et al., 1994). ACKNOWLEDGMENTS This work was supported by National Institutes of Health Grants DC03402 (C.C.M.) and DC00317 (A.J.H.). A.J.H. is an Investigator of the Howard Hughes Medical Institute.

REFERENCES Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W., and Lipman, D. J. (1997). Gapped BLAST and PSIBLAST: A new generation of protein database search programs. Nucleic Acids Res. 25: 3389 –3402. Anad, F., Burn, J., Matthews, D., Cross, I., Davison, B. C., Mueller, R., Sands, M., Lillington, D. M., and Eastham, E. (1990). Alagille syndrome and deletion of 20p. J. Med. Genet. 27: 729 –37. Blesch, A., Bosserhoff, A. K., Apfel, R., Behl, C., Hessdoerfer, B., Schmitt, A., Jachimczak, P., Lottspeich, F., Buettner, R., and

247

Bogdahn, U. (1994). Cloning of a novel malignant melanomaderived growth-regulatory protein, MIA. Cancer Res. 54: 5695– 5701. Chirgwin, J. R., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18: 5294 –5299. Cohen-Salmon, M., El-Amraoui, A., Leibovici, M., and Petit, C. (1997). Otogelin: A glycoprotein specific to the acellular membranes of the inner ear. Proc. Natl. Acad. Sci. USA 94: 14450 – 14455. Crozet, F., el Amraoui, A., Blanchard, S., Lenoir, M., Ripoll, C., Vago, P., Hamel, C., Fizames, C., Levi-Acobas, F., Depetris, D., Mattei, M. G., Weil, D., Pujol, R., and Petit, C. (1997). Cloning of the genes encoding two murine and human cochlear unconventional type I myosins. Genomics 40: 332–341. de Kok, Y. J. M., Bom, S. J. H., Brunt, T. M., Kemperman, M. H., van Beusekom, E., van der Velde-Visser, S. D., Robertson, N. G., Morton, C. C., Huygen, P. L. M., Verhagen, W. I. M., Brunner, H. G., Cremers, C. W. R. J., and Cremers, F. P. M. (1999). A Pro51Ser mutation in the COCH gene is associated with late onset autosomal dominant progressive sensorineural hearing loss with vestibular defects. Hum. Mol. Genet. 8: 361–366. Devereux, J., Haeberli, P., and Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12: 387–395. Dietz, U. H., and Sandell, L. J. (1996). Cloning of a retinoic acidsensitive mRNA expressed in cartilage and during chondrogenesis. J. Biol. Chem. 271: 3311–3316. Feinberg, A. P., and Vogelstein, B. (1984). A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 137: 266 –267. Fransen, E., Verstreken, M., Verhagen, W. I., Wuyts, F. L., Huygen, P. L., D’Haese, P., Robertson, N. G., Morton, C. C., McGuirt, W. T., Smith, R. J., Declau, F., Heyning, P. H., and Camp, G. V. (1999). High prevalence of symptoms of Meniere’s disease in three families with a mutation in the COCH gene. Hum. Mol. Genet. 8: 1425–1429. Gorlin, R. J., Toriello, H. V., and Cohen, M. M. (1995). “Hereditary Hearing Loss and Its Syndromes,” Oxford Univ. Press, New York. Heath, J. K., Rodan, S. B., Yoon, K., and Rodan, G. A. (1989). Rat calvarial cell lines immortalized with SV-40 large T antigen: Constitutive and retinoic acid-inducible expression of osteoblastic features. Endocrinology 124: 3060 –3068. Heller, S., Sheane, C. A., Javed, Z., and Hudspeth, A. J. (1998). Molecular markers for cell types of the inner ear and candidate genes for hearing disorders. Proc. Natl. Acad. Sci. USA 95: 11400 – 11405. Iwamoto, M., Golden, E. B., Adams, S. L., Noji, S., and Pacifici, M. (1993). Responsiveness to retinoic acid changes during chondrocyte maturation. Exp. Cell Res. 205: 213–224. Khetarpal, U., Robertson, N. G., Yoo, T. J., and Morton, C. C. (1994). Expression and localization of COL2A1 mRNA and type II collagen in human fetal cochlea. Hear. Res. 79: 59 –73. Krantz, I. D., Piccoli, D. A., and Spinner, N. B. (1999). Clinical and molecular genetics of Alagille syndrome. Curr. Opin. Pediatr. 11: 558 – 64. Kyte, J., and Doolittle, R. F. (1982). A simple method for displaying the hydropathic character of a protein. J. Mol. Biol. 157: 105–132. Lau, W. F., Tertinegg, I., and Heersche, J. N. (1993). Effects of retinoic acid on cartilage differentiation in a chondrogenic cell line. Teratology 47: 555–563. Li, L., Krantz, I. D., Deng, Y., Genin, A., Banta, A. B., Collins, C. C., Qi, M., Trask, B. J., Kuo, W. L., Cochran, J., Costa, T., Pierpont, M. E., Rand, E. B., Piccoli, D. A., Hood, L., and Spinner, N. B. (1997). Alagille syndrome is caused by mutations in human Jagged1, which encodes a ligand for Notch1. Nat. Genet. 16: 243– 251.

248

ROBERTSON ET AL.

Marazita, M. L., Ploughman, L. M., Rawlings, B., Remington, E., Arnos, K. S., and Nance, W. E. (1993). Genetic epidemiological studies of early-onset deafness in the U.S. school-age population. Am. J. Med. Genet. 46: 486 – 491. McKenna, M. J., Kristiansen, A. G., Bartley, M. L., Rogus, J. J., and Haines, J. L. (1998). Association of COL1A1 and otosclerosis: Evidence for a shared genetic etiology with mild osteogenesis imperfecta. Am. J. Otol. 19: 604 – 610. Morton, N. E. (1991). Genetic epidemiology of hearing impairment. Ann. N.Y. Acad. Sci. 630: 16 –31. Neame, P. J., Tapp, H., and Azizan, A. (1999). Noncollagenous, nonproteoglycan macromolecules of cartilage. Cell. Mol. Life Sci. 55: 1327–1340. Ney, P. A., Andrews, N. C., Jane, S. M., Safer, B., Purucker, N. E., Weremowicz, S., Morton, C. C., Goff, S. C., Orkin, S. H., and Niehuis, A. W. (1993). Purification of the human NF-E2 complex: cDNA cloning of the hematopoietic cell-specific subunit and evidence for an associated partner. Mol. Cell. Biol. 13: 5604 –5612. Oda, T., Elkahloun, A. G., Pike, B. L., Okajima, K., Krantz, I. D., Genin, A., Piccoli, D. A., Meltzer, P. S., Spinner, N. B., Collins, F. S., and Chandrasekharappa, S. C. (1997). Mutations in the human Jagged1 gene are responsible for Alagille syndrome. Nat. Genet. 16: 235–242. Reardon, W. (1992). Genetic deafness. J. Med. Genet. 29: 521–526. Robertson, N. G., Khetarpal, U., Gutie´rrez-Espeleta, G. A., Bieber, F. R., and Morton, C. C. (1994). Isolation of novel and known genes from a human fetal cochlear cDNA library using subtractive hybridization and differential screening. Genomics 23: 42–50. Robertson, N. G., Lu, L., Heller, S., Merchant, S. N., Eavey, R. D., McKenna, M., Nadol, J. B., Jr., Miyamoto, R. T., Linthicum, F. H., Jr., Lubianca Neto, J. F., Hudspeth, A. J., Seidman, C. E., Morton, C. C., and Seidman, J. G. (1998). Mutations in a novel cochlear gene cause DFNA9, a human nonsyndromic deafness with vestibular dysfunction. Nat. Genet. 20: 299 –303. Robertson, N. G., and Morton, C. C. (1999). Beginning of a molecular era in hearing and deafness. Clin. Genet. 55: 149 –159.

Robertson, N. G., Skvorak, A. B., Yin, Y., Weremowicz, S., Johnson, K. R., Kovatch, K. A., Battey, J. F., Bieber, F. R., and Morton, C. C. (1997). Mapping and characterization of a novel cochlear gene in human and in mouse: A positional candidate gene for a deafness disorder, DFNA9. Genomics 46: 345–354. Sandell, L. J., Dietz, U. H., and Nalin, A. M. (1996). mRNA encoding a novel growth regulatory factor is coexpressed with type II procollagen during chondrogenesis. Ann. N. Y. Acad. Sci. 785: 325– 327. Schaeren-Wiemers, N., and Gerfin-Moser, A. (1993). A single protocol to detect transcripts of various types and expression levels in neural tissue and cultured cells: In situ hybridization using digoxigenin-labeled cRNA probes. Histochemistry 100: 431– 440. Skvorak, A. B., Weng, Z., Yee, A. J., Robertson, N. G., and Morton, C. C. (1999). Human cochlear expressed sequence tags provide insight into cochlear gene expression and identify candidate genes for deafness. Hum. Mol. Genet. 8: 439 – 452. Thomas, P. S. (1980). Hybridization of denatured RNA and small DNA fragments transferred to nitrocellulose. Proc. Natl. Acad. Sci. USA 77: 5201–5205. Tickle, C., Alberts, B., Wolpert, L., and Lee, J. (1982). Local application of retinoic acid to the limb bond mimics the action of the polarizing region. Nature 296: 564 –566. Tomek, M. S., Brown, M. R., Mani, S. R., Ramesh, A., Srisailapathy, C. R., Coucke, P., Zbar, R. I., Bell, A. M., McGuirt, W. T., Fukushima, K., Willems, P. J., Van Camp, G., and Smith, R. J. (1998). Localization of a gene for otosclerosis to chromosome 15q25– q26. Hum. Mol. Genet. 7: 285–290. Van Camp, G., and Smith, R. J. H. (2000). Hereditary hearing loss homepage. WWW URL: http://dnalab-www.uia.ac.be/dnalab/hhh. von Heijne, G. (1986). A new method for predicting signal sequence cleavage sites. Nucleic Acids Res. 14: 4683– 4690. Wang, P. C., Merchant, S. N., McKenna, M. J., Glynn, R. J., and Nadol, J. B., Jr. (1999). Does otosclerosis occur only in the temporal bone? Am. J. Otol. 20: 162–165.