Molecular Cloning, Chromosomal Mapping, and Developmental Expression of a Novel Protein Tyrosine Phosphatase-like Gene

Genomics 62, 406 – 416 (1999) Article ID geno.1999.5950, available online at http://www.idealibrary.com on

Molecular Cloning, Chromosomal Mapping, and Developmental Expression of a Novel Protein Tyrosine Phosphatase-like Gene Dafe A. Uwanogho,* Zoe¨ Hardcastle,* Piroska Balogh,† Ghazala Mirza,‡ Kent L. Thornburg,† Jiannis Ragoussis,‡ and Paul T. Sharpe* ,1 *Department of Craniofacial Development and ‡Department of Medical and Molecular Genetics, GKT Medical and Dental Institute, Kings College at Guy’s Hospital, London; and †Department of Physiology and Pharmacology, Oregon Health Sciences University, Portland, Oregon 92719-3098 Received March 30, 1999; accepted July 29, 1999

Protein tyrosine phosphatases (PTPs) mediate the dephosphorylation of phosphotyrosine. PTPs are known to be involved in many signal transduction pathways leading to cell growth, differentiation, and oncogenic transformation. We have cloned a new family of novel protein tyrosine phosphatase-like genes, the Ptpl (protein tyrosine phosphatase-like; proline instead of catalytic arginine) gene family. This gene family is composed of at least three members, and we describe here the developmental expression pattern and chromosomal location for one of these genes, Ptpla. In situ hybridization studies revealed that Ptpla expression was first detected at embryonic day 8.5 in muscle progenitors and later in differentiated muscle types: in the developing heart, throughout the liver and lungs, and in a number of neural crest derivatives including the dorsal root and trigeminal ganglia. Postnatally Ptpla was expressed in a number of adult tissues including cardiac and skeletal muscle, liver, testis, and kidney. The early expression pattern of this gene and its persistent expression in adult tissues suggest that it may have an important role in the development, differentiation, and maintenance of a number of different tissue types. The human homologue of Ptpla (PTPLA) was cloned and shown to map to 10p13–p14. © 1999 Academic Press

INTRODUCTION

Protein phosphorylation is a reversible process that is dependent on the opposing activities of kinases and phosphatases. Eukaryotic protein phosphatases are structurally and functionally diverse enzymes that are represented by three distinct supergene families. Two Sequence data from this article have been deposited with the EMBL/GenBank Data Libraries under Accession Nos. AF114493, AF114494, AF162706, and AF62707. 1 To whom correspondence should be addressed at Department of Craniofacial Development, GKT Dental School, Floor 28, Guy’s Hospital, London Bridge, London SE1 9RT, United Kingdom. Telephone: 171 955 2687. Fax: 171 955 2704. E-mail: [email protected]. 0888-7543/99 $30.00 Copyright © 1999 by Academic Press All rights of reproduction in any form reserved.

of these, the phosphoprotein phosphatases and the Mg 2⫹-dependent protein phosphatases, dephosphorylate phosphoserine and phosphothreonine residues (Wera and Hemmings, 1995; Cohen, 1994), whereas members of the third family, the protein tyrosine phosphatases (PTPs), dephosphorylate phosphotyrosine residues. On the basis of function, structure, and sequence homology, PTPs can be subgrouped into four main families: the tyrosine-specific phosphatases (PTPases) (Jia et al., 1995), which include receptor and nonreceptor types; VH1-like dual-specificity phosphatases (dsPTPases) (Martell et al., 1998), which have the ability to dephosphorylate both serine and tyrosine residues; the cdc25-like phosphatases (Nurse, 1990; Sebastian et al., 1993; Coleman and Dunphy, 1994); and the low-molecular-weight or acidic phosphatases (Guan and Dixon, 1991). All PTPs contain an active site signature motif, (I/V)HCXXGXXRS, which harbors the catalytic cysteinyl residue; mutation of this cysteine residue abolishes the catalytic activities of PTPs (Fauman and Saper, 1996). PTPs have important roles in development; in some systems, they can function as tumor suppressors (Laforgia et al., 1991; Steck et al., 1997) and have demonstrable roles in cell cycle regulation (Gould and Nurse, 1989; Hannon et al., 1994). Genetic evidence for the importance of PTPs in development comes from a number of findings. First, mutations in the murine motheaten locus, which encodes for the phosphatase SH-PTP1, results in developmental and functional defects in multiple hematopoietic cell lineages (Shultz et al., 1993; Tsui et al., 1993). Furthermore, mutations in PTPase encoding genes have been associated with a number of human congenital diseases. Deletions in the MTM1 gene have been shown to occur in a subset of cases of myotubular myopathy, characterized by severe hypotonia and generalized muscle weakness (Laporte et al., 1996). Recently, it was shown that mutations in the human PTEN gene, which encodes a dsPTPase, causes a fraction of sporadic brain, breast, and prostate tumors and is also responsible for Cowden disease, a hereditary cancer predisposition syndrome that gives

406

NOVEL PROTEIN TYROSINE PHOSPHATASE-LIKE GENE

rise to a variety of tumors and hamartomas (Li and Sun, 1997; Li et al., 1997; Steck et al., 1997; Nelen et al., 1997). Here we report the cloning of the first member of a new family of novel protein tyrosine phosphatase-like genes, all of which possess a catalytic site, (I/V)HCXXGXXPS, where the conserved arginine residue has been replaced by a proline residue. The Ptpl (protein tyrosine phosphatase-like; proline instead of catalytic arginine) gene family to date consists of three members, which, outside the catalytic site, share no sequence homology to any of the other families of PTPs. The protein encoded by the Ptpla gene contains a putative SV40-like nuclear localization signal (Boulikas, 1994), suggesting a nuclear location for this protein. The expression pattern for the Ptpla gene shows considerable overlap with those of the phosphonuclear protein encoding Rb1 and p107 genes, which suggests that the product of the Ptpla gene may be involved in the regulation of the phosphorylation states of members of the Retinoblastoma gene family. The human homologue of Ptpla (PTPLA) maps to chromosome 10p13–p14; deletions within this region have been associated with DiGeorge and velocardiofacial syndromes (Daw et al., 1996; Schuffenhauer et al., 1998). MATERIALS AND METHODS Isolation and sequencing of Ptpla and PTPLA. An amplified embryonic day 10.5 (E10.5) mouse cDNA in Lambda Exlox (Novagen) derived from 1 ⫻ 10 6 primary recombinants was screened at moderate stringency (1 M NaCl, 1% SDS, 10% PEG, at 55°C) with a cPtpla partial cDNA clone, which had been previously isolated from a mixed stage (HH stage 14 –17) chick cDNA library (Coriat et al., 1993). Positive clones were purified and pExlox phagemid was excised in accordance with the manufacturer’s instructions. Two clones, pEx10-1 and pEx4-1, were found to be overlapping copies for the same gene, which was designated Ptpla. These clones were sequenced in full using the dideoxy termination method (Sanger et al., 1977), with Thermosequence (Amersham), deaza-dGTP, and a modified reaction buffer (20 mM Tris–HCl (pH 8.75), 10 mM KCl, 10 mM (NH 4) 2SO 4, 0.2 mM MgSO 4, 0.1% Triton X-100, 0.1 mg/ml BSA, 10% DMSO). Human PTPLA was isolated by screening an amplified human adult heart cDNA library in Lambda ZAP II (Stratagene) derived from 1 ⫻ 10 6 primary recombinants at high stringency (1 M NaCl, 1% SDS, 10% PEG, at 65°C) with the full-length Ptpla cDNA. Positive clones were purified, and the pBluescript phagemid was excised using the R408 helper phage (Promega). A single PTPLA clone, pB20 –1, was isolated and sequenced as described above. To confirm further the evolutionary conservation of the Ptpla gene, the ovine homologue (sPtpla) was isolated. Full-length Ptpla was used to screen a sheep fetal heart cDNA library (143-day fetus, in Lambda ZAP II; a kind gift from Mike Burson), using high-stringency conditions as described above. EST database screening also allowed the identification of a Caenorhabditis elegans Ptpla homologue. The sequences for cPtpla, Ptpla, PTPLA, and sPtpla have been deposited with the GenBank database under Accession Nos. of AF162706, AF114493, AF114494, and AF162707, respectively. Expression. In situ hybridization using 35S-radiolabeled riboprobes was carried out as described by Angerer and Angerer (1991). Radioactive riboprobes were synthesized with SP6 polymerase (Promega) for antisense probes and with T7 polymerase for sense probes using 35S-labeled UTP (ICN). Following prehybridization procedures, tissues sections were hybridized at 65°C with antisense or sense probes, at 7.5 ⫻ 10 5 cpm per slide. Following overnight incubation,

407

unhybridized probe was removed through stringent washes and treatment with RNase A. Slides were subsequently coated with K.5 nuclear emulsion (Ilford) and exposed at 4°C for 14 days. A mouse multiple-tissue Northern blot containing approximately 2 ␮g of RNA, purchased from Clontech Ltd., was probed at high stringency (50% formamide, 0.25 M Na 2PHPO 4, 0.5 M NaCl, 0.2% Na 4P 2O 4, 1 mM EDTA, 7% SDS, 10% dextran sulfate, 20 mg/ml yeast RNA (Sigma), at 45°C) with full-length Ptpla cDNA. The blot was washed twice in 1⫻ SSC, 1% SDS at 65°C and once in 0.5 ⫻ SSC, 0.5% SDS at 65°C. Chromosomal mapping of PTPLA. The chromosomal location of PTPLA was determined using fluorescence in situ hybridization (FISH) with PAC clones 130B3, 130E9, 130F9, 130F10, 277M7, 142F15, 143H14, 195H23, and 57K1, which were derived from screening the human PAC library (RPC1) filters, obtained from the HGMP Resource Center (Hinxton) with the PTPLA cDNA. PCR using primers to the MASSEED (ATGGCGTCCAGCGACGAGGAC, forward primer) and VIVEKDD (ACTAACATCTTTTCCTACTAA, reverse primer) motifs in the PTPLA protein (Fig. 2A) was used to verify the presence of the PTPLA gene within the PAC clones. FISH with all the positive clones was performed as follows: PAC DNA was prepared as recommended by the MRC HGMP Resource Centre. All clones were labeled with biotin-14 – dATP or digoxigenin-11– dUTP by nick-translation (Bio-Nick Labeling System or Nick-Translation System, respectively, BRL Life Technologies USA). In situ hybridization was performed as described by Davies et al. (1996). Briefly, 100 ng of each PAC per slide was dried and suspended in 50% formamide, 1% Tween 20, 20% dextran sulfate along with salmon sperm DNA (100⫻ w/w) and Cot-1 DNA (50⫻ w/w). The probe mixes were then denatured by heating to 75°C for 3 min, prehybridized for 30 min, and applied to the slides, which had themselves been denatured by treatment in 70% formamide, 2⫻ SSC for 2 min at 65°C. Hybridization was carried out at 37°C for 16 h. Posthybridization washes were 50% formamide, 2⫻ SSC for 15 min at 45°C followed by 0.1 ⫻ SSC for 15 min at 60°C and 4⫻ SSC for 5 min at room temperature. Signals from biotin-labeled probes were developed using alternate layers of avidin-fluorescein isothiocyanate (avidinFITC) and biotinylated anti-avidin. Those from digoxigenin-labeled probes were developed with a layer of sheep anti-digoxigenin conjugated to tetramethylrhodamine isothiocyanate (TRITC–anti-digoxigenin) followed by one layer of donkey anti-sheep TRITC. Slides were mounted in Vectashield antifading medium (Vector Laboratories, USA) containing 80 ng/ml 4⬘,6-diamidino-2-phenylindole (DAPI) as counterstain. Signals were visualized under a Zeiss Axioplan microscope equipped with a cooled charge-coupled device camera (Photometrics, Woburn, MA) and the Smartcapture image analysis system (Vysis, UK). G-banding was enhanced during image analysis. At least 10 metaphase cells were examined to confirm the results. For the purposes of clone mapping, all clones were mapped to specific chromosome bands of normal male chromosomes by examination of a minimum of 10 well-extended metaphases per clone. The quality of the banding was sufficient to allow localization of clones to precise bands and subbands at the 850-band level in the region of interest.

RESULTS

Cloning and Sequence Analysis A single partial cDNA clone for chick Ptpla (cPtpla) was serendipitously isolated from a mixed HH stage 14 to 17 chick embryonic cDNA library (Lambda ZAP I, Stratagene), following screening with PCR generated HMG-box sequences (Coriat et al., 1993). The cPtpla cDNA was then used to probe an E10.5 mouse embryonic cDNA library (Exlox, Novagen). Six clones were isolated, restriction mapped, and sequenced in full. The six clones represented two different but related genes, and a third member of this gene family was isolated by EST database searching. A PROSITE (Bai-

408

UWANOGHO ET AL.

FIG. 1. Nucleotide and conceptual amino acid sequence of Ptpla. Numbering begins at the 5⬘ extent of the cDNA clone pEx4-1. The protein tyrosine phosphatase active site motif is boxed, the absolutely conserved aspartic acid residue is circled, and the putative nuclear localization signal is underlined. The polyadenylation signal is shown in boldface type. GenBank Accession No. AF11943.

roch et al., 1996) search with the conceptual protein sequences for these genes revealed that they all contained a protein tyrosine phosphatase consensus active site motif, containing a substitution of an arginine residue, which is essential for catalytic activity, for a proline residue. This new family of genes was designated Ptpl genes (protein tyrosine phosphatase-like, proline instead of catalytic arginine). The conceptual translation of the Ptpla cDNA clones (the nucleotide sequences of other members of the Ptpl gene family will be presented elsewhere) showed that there are two in-frame methionine residues that are

capable of being the translation initiation codon (Fig. 1); the second methionine codon is contained within a good Kozak consensus sequence for translation initiation (Cavener, 1987). Taking the first in-frame AUG as the initiation codon, the conceptual translation of Ptpla yields a protein of 281 amino acids and 32,200 Da. The Ptpla protein is rich in leucine (31%) and valine (27%) residues. Located at the N-terminus of this protein is a putative SV40-like nuclear localization signal (Kalderon et al., 1984a,b; Hanover, 1992), suggestive of a nuclear location for this protein (Fig. 2A). In addition to containing the protein tyrosine phosphatase active

NOVEL PROTEIN TYROSINE PHOSPHATASE-LIKE GENE

409

FIG. 2. (A) Comparison of the mouse, human, ovine, and chick Ptpla protein sequences. (B) Comparison of the active site motif of Ptpla with those from various classes of tyrosine phosphatases. PTP-2, SH2 domain-containing protein tyrosine phosphatase; PTP1B, P19 protein tyrosine phosphatase; VH1, Vaccinia virus phosphatase; VHR, human homologue of VH1; Yer, Yersinia phosphatase; PAC-1 human dual-specificity phosphatase. An asterisk represents absolutely conserved residues, a colon represents strong conservative substitutions, and a period represents weak conservative substitutions.

site motif, the Ptpla protein possesses an aspartic acid residue (Asp-50) (Fig. 1), which is conserved in all classes of PTPs (Denu et al., 1995). Outside the active site motif, the Ptpla protein shares no homology with any other class of PTPs (Fig. 2B). The Ptpla gene is evolutionarily conserved; we have isolated homologues

from chick, human, ovine, and nematode species. The Ptpla protein shows 92% identity, at the amino acid level, with the PTPLA and sPtpla proteins. The PTPLA and sPtpla proteins possess a conserved region immediately upstream of the second methionine residue; this region is not found in the mouse protein, which

410

UWANOGHO ET AL.

FIG. 3. (a) An example of the results of in situ hybridization using a positive clone on normal male metaphase preparations. PAC Probe 130B3 was labeled with biotin and detected using alternate layers of fluorescein isothiocyanate (FITC-avidin) and biotin anti-avidin conjugate. The hybridization signals (green) are produced on chromosome 10p13/14 (indicated by arrowheads), visualized under a Zeiss Axioplan microscope equipped with a cooled charged-coupled camera (Photometrics). G-banding was enhanced using a Smartcapture image analysis system (Digital Scientific Systems, Cambridge, UK). (b) Partial karyotype and idiogram of chromosome 10. The hybridization signals (red) indicate a digoxigeninlabeled alpha-satellite chromosome 10 centromeric paint (Oncor), detected using rhodamine anti-digoxigenin, the green signal represents the probe shown in (a), visualized under a Zeiss Axioplan microscope equipped with a cooled charge-coupled device camera (Photometrics). G-banding was enhanced using Smartcapture image analysis system (Digital Scientific Systems).

appears to be more divergent (Fig. 2A). The mouse Ptpla protein is 48% identical to the C.elegans homologue, which possesses an active site motif in which the conserved cysteine residue has been replaced with an alanine residue; the conserved arginine residue remains unchanged (Fig. 7).

Chromosomal Mapping of PTPLA Genomic clones containing PTPLA were isolated by hybridizing the human PTPLA cDNA to the human PAC library (RPC1) filters obtained from the HGMP Resource Center (Hinxton). Initial positives were puri-

FIG. 4. Early expression of Ptpla. (A, B, D) sagittal sections of E10.5; (C) transverse section of E11.5; (E, F) sagittal sections of E11.5; (G, H, I) sagittal sections of E 12.5; (J, K) sense controls. Fb, forebrain; BI, first branchial arch; BII, second branchial arch; So, somite; A, atrium; V, ventricle; Mb, mandible; My, myotome; NT, neural tube; DRG, dorsal root ganglia; Li, liver; Lu, lungs; He, heart. FIG. 5. (A, B) Transverse sections of E13.5; (C, D, E, F) transverse sections of E14.5; (G, H) transverse sections of E15.5; (I) sagittal section of E15.5; (J, K) sense controls. Icm, intercostal muscle; He, heart; Di, diaphragm; FL, forelimb; Lu, lung, Ab, abdominal muscles; Li, liver; In, intestine; St, stomach; Sc, spinal cord, To, tongue; TG, tooth germ; Tri, trigeminal ganglia; Vi, vibrissae.

NOVEL PROTEIN TYROSINE PHOSPHATASE-LIKE GENE

411

412

UWANOGHO ET AL.

Developmental Expression of Ptpla

FIG. 6. Northern blot analysis of Ptpla expression in adult tissues.

fied, digested with EcoRI, blotted, and rehybridized with the PTPLA cDNA. The following clones contained a strongly positive 7.5-kb long EcoRI fragment: 130B3, 130E9, 130F9, 130F10, 277M7, 142F15, 143H14, and 195H23 (data not shown). PCR with primers designed to amplify the full coding sequence for PTPLA was used to confirm the positive status of each clone (data not shown). Clone 57K1 was weakly positive, and no PCR product was obtained using the PTPLA-specific primers, suggesting that this clone represents another PTPL family member. All clones were mapped to 10p13–p14 with the single exception of clone 57K1, which mapped to the 9qtel region; this finding is further evidence that this clone represents a different PTPL gene (Fig. 3a). The position of the PTPLA gene in relation to deletions of chromosome 10p associated with DiGeorge and velocardiofacial syndromes (DGS2) was examined by using the PAC clones 130B3, 130F10, 277M7, and 130E9, for FISH on the panel of patients that have been characterized by Daw et al. (1996). The PAC clones hybridized to both chromosomes of the terminal deletion patients but failed to hybridize to chromosome 10 of case P3 that carried an interstitial deletion (Peter Scambler, London, pers. comm., June 1999). By using these data, the PTPLA gene can be positioned within a 15-cM interval on chromosome 10p13–p14 between the markers WI-8819 (toward the telomere), which is deleted in the terminal deletion patients dizygous for the PACs, and the marker D10S203 (toward the centromere), which is proximal to the interstitial deletion of case P3. Since PTPLA maps proximal to the terminal deletion breakpoints of the cases in Daw et al., (1996), this gene can be excluded from the smallest region of overlap (SRO) as presented by these authors.

Initial studies using whole-mount in situ hybridization, with digoxigenin-labeled probes (on embryos from E2 to E8.5), showed that expression of Ptpla was first detected at E8.5, when weak expression was observed in the developing somites (data not shown). In situ hybridization using 35S-labeled riboprobes on serial sections from E8 to E15.5 was subsequently used to determine the temporal and spatial expression pattern for Ptpla during embryogenesis. Ptpla was shown to be differentially expressed in specific cell lineages. Hybridization with sense control probes yielded no detectable signals (Figs. 4J, 4K, 5J, and 5K). Myogenesis. Skeletal muscles originate from the paraxial mesoderm that forms the somites (Olson and Klein, 1994). By E10 –E11, myotomes containing myoblast precursors are delineated from the somites. At around E14, migrating myoblasts fuse to form elongated myotubes and functional muscles. Ptpla transcripts were detected throughout myogenesis. Expression of Ptpla was first detected at E8.5 in the most recently formed somite; at this stage, Ptpla is expressed throughout the somite (data not shown; and Fig. 4B). As the somite differentiates into the sclerotome, myotome, and dermatome, expression of Ptpla became restricted to the myotome (Fig. 4C). By E12.5– E13.5, Ptpla transcripts were detected in migrating myoblasts ventral to the developing vertebral column of the neck, thorax, abdomen, and tail (Figs. 4G, 4H, and 4I). By E14.5–E15.5, Ptpla transcripts were found in muscle bundles of the proximal mandible, the pharynx, the intrinsic and extrinsic muscles of the tongue (Figs. 5B and 5G), the muscles of the limbs, the intercostal muscles, the diaphragm, the muscles of the abdominal wall (Figs. 5A, 5D, and 5E), and the muscles surrounding the eyes (Fig. 5C). By E15.5, Ptpla transcripts were also detected in the smooth muscles of the digestive and urogenital tracts (Figs. 5D and 5E). Cardiogenesis. At E8.5, when the primitive heart tube consists of cardiac myocytes and an endothelial layer separated by cardiac jelly (Challice and Viragh, 1974), expression of Ptpla was robust and restricted to the cardiac myocytes (data not shown). At E10.5, when the trabeculations within the walls of the common ventricular chamber are clearly demarcated, Ptpla expression was uniform in both the atrium and the ventricle (Fig. 4D). At E11.5–E14.5, no Ptpla expression was detected in the aortic outflow, endocardial cushion, or developing aortic valves (Fig. 4D). The endogenous transcript was uniformly strong within the atrial and ventricular myocardium, including both the trabecular and the compact layers, and this pattern of expression was maintained throughout embryonic development (Figs. 4C, 4D, and 5B). Other sites of expression. The liver was a major site of Ptpla expression. Ptpla transcripts were first detected in the hepatic primordia at E10.5 (Fig. 4D), and this expression was maintained throughout development (Figs. 4E, 5D, and 5E). Other regions of

NOVEL PROTEIN TYROSINE PHOSPHATASE-LIKE GENE

expression included the mesoderm of the second branchical arch (at E10.5), which migrates to form the muscles of facial expression (Fig. 4A); dorsal root ganglion (DRG), from E10.5 onward (Figs. 3e, 3f, and 4C), and trigeminal ganglia (E13.5) (Fig. 5I), the epithelia of the lungs (E14.5) (Fig. 5B), tooth germ (E14.5) (Fig. 5H), and the vibrissae of the whisker follicles (E15.5) (Fig. 5I). At E11.5, transcripts for Ptpla were also detected in the ventral part of the neural tube (Fig. 4C); this expression was transient, and no Ptpla transcripts were detected in the CNS after E12.5. Expression in Adult Tissues Northern blot hybridization was used to determine the expression profile of Ptpla in adult tissues. Ptpla was expressed at high levels in testis, skeletal muscle, and heart and at lower levels in liver and kidney (Fig. 6). EST database searching revealed that Ptpla transcripts have also been isolated from adult lymph nodes (EST clone AA185627), mammary glands (EST clone AA671635), melanocytes (EST clone AA030606), hypothalamus (EST clone AA982656), and proximal colon (EST clone AA674973). DISCUSSION

We have cloned a member of a new family of developmentally regulated protein tyrosine phosphataselike genes. The Ptpl gene family shares limited homology with other classes of phosphatases. They possess a protein tyrosine phosphatase active site motif, (I/ V)HCX 2GX 2P(S/T), where the catalytic arginine residue has been replaced with proline, as well as a conserved aspartic acid residue found in all classes of PTPs. The substitution of the arginine residue for proline in the active site of the Ptpla protein could have one of two effects. First, it may affect the rate of catalysis of the dephosphorylation reaction, since formation of the phosphoenzyme intermediate, via the cysteine residue, would still occur but the rate at which this is broken down may be affected (Guan and Dixon, 1991; Pot and Dixon, 1992; Cho et al., 1992, Denu et al., 1996). This assumes that the proline residue can substitute directly for arginine in the formation of the Cys(X 5)Arg phosphate binding loop, but due to structural constraints, it is unlikely that the ring structure of proline could participate in the formation of such a loop. Alternatively, the arginine to proline mutation is likely to render the Ptpla protein biochemically inactive. If this is the case, then the Ptpla protein may represent a new member of the growing class of antiphosphatases, which are proteins that are capable of competitively antagonizing PTPs. Anti-phosphatases include the Sfb1 (SET-binding factor 1) protein, which shares extensive sequence similarity with myotubularin, a dsPTPase. However, Sbf1 lacks phosphatase activity due to several evolutionarily conserved amino acid changes in the active site motif, including the cysteine and arginine residues (De Vivo et al., 1998).

413

The STYX protein (phosphoserine/threonine/tyrosine-binding interaction protein) is also related in amino acid sequence to dsPTPases, except for the substitution of glycine for the conserved cysteine within the active site (Wishart et al., 1995; Wishart and Dixon, 1998). STYX domains are also found in a number of other proteins including RPTPb/z (Krueger and Saito, 1992), RPTPg (Barnea et al., 1993), and IA-2 (Lan et al., 1996). EST database screening enabled the isolation of a Ptpla homologue from C.elegans (EST clone AF022985); this protein, which is 48% identical to mouse Ptpla, has an active site motif in which the cysteine residue has been replaced with an alanine, and so the protein is likely to be inactive (Fig. 7). This suggests that Ptpl proteins could constitute an evolutionarily conserved class of anti-phosphatases; Ptpl genes have been isolated from human, chick, sheep, and Xenopus. However, it is yet to be established whether Ptpla protein can recognize, and bind to, protein ligands and affect downstream signaling, and despite the arginine to proline substitution, the Ptpla protein may still retain catalytic activity. We have mapped the human homologue of Ptpla (PTPLA) to chromosome 10 at 10p13–p14. The position of the PTPLA gene between the markers WI-8819 and D10S203 proximal to the SRO segment in Daw et al. (1996) excludes it from being a strong candidate for the DiGeorge syndrome. It has been shown that deletions of other segments of chromosome 10, distinct from the SRO region, are also associated with characteristics of DGS and velocardiofacial syndromes (Dasouki et al., 1997; Gottlib et al., 1998). These other regions are located further telomeric than the SRO region estimated by Daws et al. (1996), and this suggests that DGS2 phenotypes may arise from complex deletions within chromosome 10. The segment containing the PTPLA gene is part of the regions deleted in three terminal and three interstitial deletions described by Schuffenhauser et al. (1998). Therefore hemizygosity for PTPLA may contribute to the clinical presentations in these cases or alternatively via position effects on the PTPLA locus. Deletions of chromosome 10p are a frequent finding in many types of malignancies including glioblastomas (Ichimura et al., 1998), astrocytomas (Nishizaki et al., 1998), prostate carcinomas (Ittmann, 1998), urinary bladder cancer (Sauter et al., 1997), and familial neuroblastoma (Altura et al., 1997). It is interesting that the PTEN tumor suppressor gene has been recently identified as the gene inactivated at 10q23 in a number of prostate carcinomas (Ittmann, 1998). This gene encodes a dual-specificity protein phosphatase that interacts with and controls the tyrosine phosphorylation of focal adhesion kinase, a key regulator of signal transduction via focal adhesions. Both functional studies and direct analysis of human tumors strongly support the idea that at least one and possibly two tumor suppressor genes for prostate cancer are also present on 10p (Ittmann, 1998); if Ptpla is an anti-phospha-

414

UWANOGHO ET AL.

FIG. 7. Comparison of the mouse and C. elegans Ptpla proteins. Amino acid substitutions within the active sites are shown in bold. An asterisk represents absolutely conserved residues, a colon represents strong conservative substitutions, and a period represents weak conservative substitutions.

tase, then it may have a role in the development of these carcinomas. We have demonstrated by in situ and Northern blotting hybridization that the Ptpla gene is differentially expressed during embryogenesis and in a number of adult tissues. Ptpla transcripts were detected throughout the somites at E8.5 and in the myotome at E11.5, several days before the onset of terminal differentiation, which occurs post-E14. By E12.5, Ptpla expression was observed in muscles ventral to the developing vertebral column of the neck, thorax, abdomen, and tail. The relative intensity of the autoradiographic signal in the muscles of the neck and thorax compared to the signal in the abdomen and tail was in agreement with the rostrocaudal development of the axial musculature. The expression of Ptpla was maintained in skeletal muscle types well after the terminal differentiation of muscle fibers. Similarly, during cardiac development, Ptpla expression was restricted to the myocytes of the primitive heart tube, and by E10.5, it was expressed in the muscles throughout all the cardiac chambers. By E12.5, no Ptpla expression was detected in the aortic outflow, the endocardial cushions, or the developing aortic valves,

showing that Ptpla transcripts were specific for cardiac muscle. By E15.5, Ptpla expression was also observed in the smooth muscle surrounding the digestive, respiratory, and urogenital tracts. So it appears that Ptpla has roles in the differentiation of muscle types that originate from both paraxial and splanchnic mesoderm. Ptpla is also expressed in a number of other tissues, most notably in the liver, where transcripts were detected at E10.5 in the hepatic primordia and later in the embryonic liver. Other sites of expression included the dorsal root and trigeminal ganglia, both neural crest derivatives, tooth germ, and vibrissae of the whisker follicles. Transient expression of Ptpla was also observed in the ventral neural tube, including the floor plate. In the adult, Ptpla was expressed in a number of tissues including skeletal muscle, liver, heart, testis, and kidney; the last two tissues did not express this gene at detectable levels during embryogenesis. It is apparent that in addition to having a role in the determination and differentiation of tissue types during embryogenesis, the Ptpla gene has specific roles in these tissues in the adult. In certain tissues, these roles may be evolutionarily conserved; the chick homologue

NOVEL PROTEIN TYROSINE PHOSPHATASE-LIKE GENE

(cPtpla) is expressed only in adult heart and skeletal muscle (Uwanogho, unpublished observation). Expression of Ptpla is also detected in adult human and ovine heart. The expression pattern of the Ptpla gene overlaps with those of two members of the retinoblastoma gene family, Rb1 in the developing liver, skeletal muscle, and DRG and p107 in the developing heart, kidney, lungs, and intestine (Jiang et al., 1997; Monden et al., 1996; Gu et al., 1993; Schneider et al., 1994; Chen et al., 1996; Bernards et al., 1989; Anderson et al., 1996; Sellers and Kaelin, 1997). This suggests that Ptpl proteins may be involved in the regulation of the phosphorylation state of RB proteins; Ptplb expression overlaps with that of Rb1 in the developing eye and with p130 in developing bones (Uwanogho et al., in preparation). If Ptpl proteins are anti-phosphatases, then this regulation could be achieved by the binding of Ptpl proteins to specific target phosphoproteins, thus preventing their dephosphorylation. From the expression pattern of Ptpla, it is clear that this gene participates in mechanisms that control the spatial and temporal capacity of cells to undergo determination and terminal differentiation and thus plays a critical role in organogenesis. Ptpla is a member of a new family of evolutionarily conserved genes of which there are at least two other members. The characterization of these other members is currently underway. REFERENCES Altura, R. A., Maris, J. M., Li, H., Boyett, J. M., Brodeur, G. M., and Look, A. T. (1997). Novel regions of chromosomal loss in familial neuroblastoma by comparative genomic hybridization. Genes Chromosomes Cancer 19(3): 176 –184. Anderson, J. J., Tiniakos, D. G., McIntosh, G. G., Autzen, P., Henry, J. A., Thomas, M. D., Reed, J., Horne, G. M., Lennard, T. W., Angus, B., and Horne, C. H. (1996). Retinoblastoma protein in human breast carcinoma: Immunohistochemical study using a new monoclonal antibody effective on routinely used tissues. J. Pathol. 180: 65–70. Angerer, L. M., and Angerer, R. C. (1991). Localization of mRNAs by in situ hybridization. Methods Cell. Biol. 35: 37–71. Bairoch, A., Bucher, P., and Hofmann, K. (1996). The PROSITE database, its status in 1995. Nucleic Acids Res. 24: 189 –196. Barnea, G., Silvennoinen, O., Shaanan, B., Honegger, A. M., Canoll, P. D., D’Eustachio, P., Morse, B., Levy, J. B., Laforgia, S., Huebner, K., et al. (1993). Identification of a carbonic anhydrase-like domain in the extracellular region of RPTP gamma defines a new subfamily of receptor tyrosine phosphatases. Mol. Cell. Biol. 13: 1497–1506. Bernards, R., Schackleford, G. M., Gerber, M. R., Horowitz, J. M., Friend, S. H., Schartl, M., Bogenmann, E., Rapaport, J. M., McGee, T., Dryja, T. P., et al. (1989). Structure and expression of the murine retinoblastoma gene and characterization of its encoded protein. Proc. Natl. Acad. Sci. USA 86: 6474 – 6478. Boulikas, T. (1994). Putative nuclear localization signals (NLS) in protein transcription factors. J. Cell. Biochem. 55: 32–58. Cavener, D. (1987). Comparison of the consesus sequence flanking translation start sites in Drosophila and vertebrates. Nucleic Acids Res. 15: 1353–1361. Challice, C. E., and Viragh, S. (1974). The architectural development of the early mammalian heart. Tissue Cell 6: 447– 462.

415

Chen, G., Guy, C. T., Chen, H. W., Hu, N., Lee, E. Y., and Lee W. H. (1996). Molecular cloning and developmental expression of mouse p130, a member of the retinoblastoma gene family. J. Biol. Chem. 271: 9567–9572. Cho, H. J., Ramer, S. E., Itoh, M., Winkler, D. G., Kitas, E., Bannwarth, W., Burn, P., Saito, H., and Walsh, C. T. (1992). Purification and characterization of a soluble catalytic fragment of the human transmembrane leukocyte antigen related (LAR) protein tyrosine phosphatase from an Escherichia coli expression system. Biochemistry 30: 6210 – 6216. Cohen, P. (1994). The discovery of protein phosphatases: From chaos and confusion to an understanding of their role in cell regulation and human disease. BioEssays 16: 583–585. Coleman, T. R., and Dunphy, W. G. (1994). Cdc2 regulatory factors. Curr. Opin. Cell. Biol. 6: 877– 882. Coriat, A.-M., Mu¨ller, U., Harry, J. L., Uwanogho, D., Sharpe, P. T. (1993). PCR amplification of SRY-related gene sequences reveals evolutionary conservation of the SRY-box motif. PCR Methods Appl. 2: 218 –222. Dasouki, M., Jurecic, V., Phillips, J. A. R., Whitlock, J. A., and Baldini, A. (1997). DiGeorge anomaly and chromosome 10p deletions: One or two loci. Am. J. Med. Genet. 73: 72–75. Davies, A. F., Olavesen, M. G., Stephens, R. J., Davidson, R., Delneste, D., Van Regemorter, N., Vamos, E., Flinter, F., Abusaad, I., and Ragoussis, J. (1996). A detailed investigation of two cases exhibiting characteristics of the 6p deletion syndrome. Hum. Genet. 98: 454 – 459. Daw, S. C., Taylor, C., Kraman, M., Call, K., Mao, J., Schuffenhauer, S., Metinger, T., Lipson, T., Goodship, J., and Scambler, P. (1996). A common region of 10p deleted in DiGeorge and velocardiofacial syndromes. Nat. Genet. 13: 458 – 460. Denu, J. M., Zhou, G., Guo, Y., Dixon, J. E. (1995). The catalytic role of aspartic acid-92 in a human dual-specific protein-tyrosine-phosphatase. Biochemistry 34: 3396 –3403. Denu, J. M., Lohse, D. L., Vijayalakshmi, J., Saper, M. A., and Dixon, J. E. (1996). Visualization of intermediate and transition-state structures in protein-tyrosine phosphatase catalysis. Proc. Natl. Acad. Sci. USA 93: 2493–2498. De Vivo, I., Cui, X., Domen, J., and Cleary, M. L. (1998). Growth stimulation of primary B cell precursors by the anti-phosphatase Sbf1. Proc. Natl. Acad. Sci. USA 95: 9471–9476. Fauman, E. B., and Saper, M. A. (1996). Structure and function of the protein tyrosine phosphatases. Trends Biochem. Sci. 21: 413– 417. Gottlieb, S., Driscoll, D. A., Punnett, H. H., Sellinger, B., Emanuel, B. S., and Budarf, M. L. (1998). Characterisation of 10p deletions suggests two non-overlapping regions contribute to the DiGeorge syndrome phenotype. Am. J. Med. Genet. 62: 495– 498. Gould, K. L., and Nurse, P. (1989). Tyrosine phosphorylation of the fission yeast cdc2⫹ protein kinase regulates entry into mitosis. Nature 342: 39 – 45. Gu, W., Schneider, J. W., Condorelli, G., Kaushal, S., Mahdavi, V., and Nadal-Ginard, B. (1993). Interaction of myogenic factors and the retinoblastoma protein mediates muscle cell commitment and differentiation. Cell 72: 309 –324. Guan, K. L., and Dixon, J. E. (1991). Evidence for protein-tyrosinephosphatase catalysis proceeding via a cysteine-phosphate intermediate. J. Biol. Chem. 266: 17026 –17030. Hannon, G. J., Casso, D., and Beach, D. (1994). KAP: A dual specificity phosphatase that interacts with cyclin-dependent kinases. Proc. Natl. Acad. Sci. USA 91: 1731–1735. Hanover, J. A. (1992). The nuclear pore: At the crossroads. FASEB J. 6: 2288 –2295. Hou, J. W., Wang, J. K., Tsai, W. Y., Chou, C. C., and Wang, T. R. (1997). CATCH 22: Deletion of locus 22q11 in velocardiofacial syndrome, DiGeorge anomaly, and nonsyndromic conotruncal defects. J. Formos. Med. Assoc. 96: 419 – 423.

416

UWANOGHO ET AL.

Hubbard, M. J., and Cohen, P. (1993). On target with a new mechanism for the regulation of protein phosphorylation. Trends Biochem. Sci. 18: 172–177. Hunter, T. (1998). Anti-phosphatases take the stage. Nat. Genet. 18: 303–305. Ichimura, K., Schmidt, E. E., Miyakawa, A., Goike, H. M., and Collins, V. P. (1998). Distinct patterns of deletion on 10p and 10q suggest involvement of multiple tumor suppressor genes in the development of astrocytic gliomas of different malignancy grades. Genes Chromosomes Cancer, 22(1): 9 –15. Ittmann, M. M. (1998). Chromosome 10 alterations in prostate adenocarcinoma. Oncol. Rep. 5(6): 1329 –1335. [Review] Jia, Z., Barford, D., Flint, A. J., and Tonks, N. K. (1995). Structural basis for phosphotyrosine peptide recognition by protein tyrosine phosphatase 1B. Science 268: 1754 –1758. Jiang, Z., Zacksenhaus, E., Gallie, B. L., and Phillips, R. A. (1997). The retinoblastoma gene family is differentially expressed during embryogenesis. Oncogene 14: 1789 –1797. Kalderon, D., Roberts, B. L., Richardson, W. D., and Smith, A. E. (1984a). A short amino acid sequence able to specify nuclear location. Cell 39: 499 –509. Kalderon, D., Richardson, W. D., Markham, A. F., and Smith, A. E. (1984b). Sequence requirements for nuclear location of simian virus 40 large-T antigen. Nature 311: 33–38. Krueger, N. X., and Saito, H. (1992). A human transmembrane protein-tyrosine-phosphatase, PTP zeta, is expressed in brain and has an N-terminal receptor domain homologous to carbonic anhydrases. Proc. Natl. Acad. Sci. USA 89: 7417–7421. LaForgia, S., Morse, B., Levy, J., Barnea, G., Cannizzaro, L. A., Li, F., Nowell, P. C., Boghosian-Sell, L., Glick, J., Weston, A., et al. (1991). Receptor protein-tyrosine phosphatase gamma is a candidate tumor suppressor gene at human chromosome region 3p21. Proc. Natl. Acad. Sci. USA 88: 5036 –5040. Lan, M. S., Wasserfall, C., Maclaren, N. K., and Notkins, A. L. (1996). IA-2, a transmembrane protein of the protein tyrosine phosphatase family, is a major autoantigen in insulin-dependent diabetes mellitus. Proc. Natl. Acad. Sci. USA 93: 6367– 6370. Laporte, J., Hu, L. J., Kretz, C., Mandel, J. L., Kioschis, P., Coy, J. F., Klauck, S. M., Poustka, A., and Dahl, N. (1996). A gene mutated in X-linked myotubular myopathy defines a new putative tyrosine phosphatase family conserved in yeast. Nat. Genet. 13. Li, D. M., and Sun, H. (1997). TEP1, encoded by a candidate tumor suppressor locus, is a novel protein tyrosine phosphatase regulated by transforming growth factor beta. Cancer Res. 57: 2124 – 2129. Li, L., Ernsting, B. R., Wishart, M. J., Lohse, D. L., and Dixon, J. E. (1997). A family of putative tumor suppressors is structurally and functionally conserved in humans and yeast. J. Biol. Chem. 272: 29403–29406. Martell, K. J., Angelotti, T., and Ullrich, A. (1998). The “VH1-like” Dual specificity protein tyrosine phosphatases. Mol. Cells. 8: 2–11. Monden, T., Yamamoto, H., Ikeda, K., Izawa, H., Tsujie, M., Ohnishi, T., Miyoshi, Y., Sekimoto, M., Tomita, N., and Monden, M. (1996). RB gene expression in gastrointestinal tract. Nippon Rinsho. 54: 965–971. Neel, B. G. (1993). Structure and function of SH2-domain containing tyrosine phosphatases. Semin. Cell Biol. 4: 419 – 432. Nelen, M. R., van Staveren, W. C., Peeters, E. A., Hassel, M. B., Gorlin, R. J., Hamm, H., Lindboe, C. F., Fryns, J. P., Sijmons,

R. H., Woods, D. G., Mariman, E. C., Padberg, G. W., and Kremer, H. (1997). Germline mutations in the PTEN/MMAC1 gene in patients with Cowden disease. Hum. Mol. Genet. 6: 1383–1387. Nishizaki, T., Ozaki, S., Harad, K., Ito, H., Arai, H., Beppu, T., and Sasaki, K. (1998). Investigation of genetic alterations in associated with the grade of astrocytic tumor by comparative genomic hybridization. Genes Chromosomes Cancer 21(4): 340 –346. Nurse, P. (1990). Universal control mechanism regulating onset of M-phase. Nature 344: 503–508. Olson, E. N., and Klein, W. H. (1994). bHLH factors in muscle development: Dead lines and commitments, what to leave in and what to leave out. Genes Dev. 8: 1– 8. Pot, D. A., and Dixon, J. E. (1992). Active site labeling of a receptorlike protein tyrosine phosphatase. J. Biol. Chem. 267: 140 –143. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463–5467. Sauter, G., Moch, H., Wagner, U., Bubendorf, L., Gasser, T. C., and Mihatsch, M. J. (1997). Genomic changes in urinary bladder cancer. Vert. Dtsch. Ges. Pathol. 287–296. Schneider, J. W., Gu, W., Zhu, L., Mahdavi, V., and Nadal-Ginard, B. (1994). Reversal of terminal differentiation mediated by p107 in Rb-/- muscle cells. Science 264: 1467–1471. Schuffenhauer, S., Lichtner, P., Peykar-Derakhshandeh, P., Murken, J., Hass, O. A., Back, E., Wolff, G., Zabel, B., Barisic, I., Rauch, A., Borochowitz, Z., Dallapiccola, B., Ross, M., and Metinger, T. (1998). Deletion mapping on chromosome 10p and definition of a critical region for the second DiGeorge syndrome locus (DGS2). Eur. J. Hum. Genet. 6: 213–225. Sebastian, B., Kakizuka, A., and Hunter, T. (1993). Cdc25M2 activation of cyclin-dependent kinases by dephosphorylation of threonine-14 and tyrosine-15. Proc. Natl. Acad. Sci. USA 90: 3521– 3524. Sellers, W. R., and Kaelin, W. G. (1997). Role of retinoblastoma protein in the pathogenesis of human cancer. J. Clin. Oncol. 15: 3301–3312. Shultz, L. D., Schweitzer, P. A., Rajan, T. V., Yi, T., Ihle, J. N., Matthews, R. J., Thomas, M. L., and Beier, D. R. (1993). Mutations at the murine motheaten locus are within the hematopoietic cell protein-tyrosine phosphatase (Hcph) gene. Cell 73: 1445–1454. Steck, P. A., Pershouse, M. A., Jasser, S. A., Yung, W. K., Lin, H., Ligon, A. H., Langford, L. A., Baumgard, M. L., Hattier, T., Davis, T., Frye, C., Hu, R., Swedlund, B., Teng, D. H., and Tavtigian, S. V. (1997). Identification of a candidate tumour suppressor gene, MMAC1, at chromosome 10q23.3 that is mutated in multiple advanced cancers. Nat. Genet. 15. Tsui, H. W., Siminovitch, K. A., de Souza, L., and Tsui, F. W. (1993). Motheaten and viable motheaten mice have mutations in the haematopoietic cell phosphatase gene. Nat. Genet. 4: 124 –129. Wera, S., and Hemmings, B. A. (1995). Serine/threonine protein phosphatases. Biochem. J. 311: 17–29. Wishart, M. J., Denu, J. M., Williams, J. A., and Dixon, J. E. (1995). A single mutation converts a novel phosphotyrosine binding domain into a dual-specificity phosphatase. J. Biol. Chem. 270: 26782–26785. Wishart, M. J., and Dixon, J. E. (1998). Gathering STYX: Phosphatase-like form predicts functions for unique protein-interaction domains. Trends Biochem. Sci. 23: 301–306.