A novel variable number of tandem repeats (VNTR) polymorphism containing Sp1 binding elements in the promoter of XRCC5 is a risk factor for human bladder cancer

Available online at www.sciencedirect.com

Mutation Research 638 (2008) 26–36

A novel variable number of tandem repeats (VNTR) polymorphism containing Sp1 binding elements in the promoter of XRCC5 is a risk factor for human bladder cancer Shouyu Wang a , Meilin Wang a , Shiwei Yin a , Guangbo Fu b , Chunping Li a , Rui Chen a , Aiping Li a , Jianwei Zhou a , Zhengdong Zhang a , Qizhan Liu a,∗ a

Department of Molecular Cell Biology and Toxicology, School of Public Health, Nanjing Medical University, Nanjing, Jiangsu, China b Department of Urology, The Huai’an First Affiliated Hospital, Nanjing Medical University, Huai’an, Jiangsu, China Received 1 June 2007; received in revised form 17 August 2007; accepted 20 August 2007 Available online 26 August 2007

Abstract X-ray repair cross-complementing 5 (XRCC5) is a gene involved in repair of DNA double-strand breaks. Abnormal expression of the XRCC5 protein is associated with genomic instability and an increased incidence of cancers. In our study, a polymorphism with a variable number of tandem repeats (21-bp repeat elements at position −201 to −160 relative to the initiation of transcription) in the promoter of XRCC5 was identified. As determined with gel-shift and super-shift assays, the binding affinity of the transcription factor Sp1 to the allele with two 21-bp repeats was greater than that for the allele with one 21-bp repeat. As established with a reporter assay, plasmids containing zero or one repeat element had higher transcriptional activities than plasmids containing two repeat elements. Furthermore, fewer tandem repeats in the promoter of XRCC5 was associated with enhanced levels of the XRCC5 protein in bladder cancer patients. Although, in a case–control study, the different genotypes were not associated with the risk of bladder cancer, individuals not carrying the two tandem repeats allele had an increased risk of bladder cancer compared with those carrying the allele with two repeats. These results indicated that, at least in a population in southeastern China, this polymorphism in the promoter of XRCC5 could regulate the expression of XRCC5 and thereby contribute to susceptibility to bladder cancer. © 2007 Elsevier B.V. All rights reserved. Keywords: Bladder cancer; XRCC5; Genetic susceptibility; Transcription activity

1. Introduction

Abbreviations: DSB, double-strand break; EMSA, electrophoretic mobility shift assay; NHEJ, non-homologous end joining; PCR, polymerase chain reaction; SDS, sodium dodecyl sulfate; VNTR, variable number of tandem repeats; XRCC5, X-ray repair crosscomplementing 5. ∗ Corresponding author. Tel.: +86 25 8686 2834; fax: +86 25 8652 7613. E-mail address: [email protected] (Q.Z.Liu). 0027-5107/$ – see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.mrfmmm.2007.08.011

It is generally believed that cancer is the result of a series of genetic alterations leading to progressive disorders in the normal mechanisms controlling cellular growth, differentiation, death, and genomic instability. The cellular capacity to repair genetic injury and to maintain genomic stability by means of a variety of DNA repair mechanisms is essential in preventing tumor initiation and progression. Bladder cancer is common

S. Wang et al. / Mutation Research 638 (2008) 26–36

worldwide. In 2000, there were 340,000 newly diagnosed bladder cancer cases and 130,000 related deaths; 70% of the cases occurred in men [1]. Associated with the risk of bladder cancer are environmental factors, such as chemical carcinogens, including polycyclic aromatic hydrocarbons, aromatic amines, and N-nitroso compounds; some anticancer drugs; and reactive oxygen species [2–4]. Although many people are exposed to these risk factors, only a few develop bladder cancer, suggesting that there is an individual variation in susceptibility to exposure-related bladder carcinogenesis. Because damage caused by DNA double-strand breaks (DSB) leads to loss or rearrangement of genomic material, the pathways for repairing the damage are important for genomic stability [5]. If DNA DSB damage remains unrepaired or is inaccurately repaired, mutations and/or chromosomal aberrations are induced, and these may result in cancer or cell death [6]. To combat the effects of DNA DSB damage, eukaryotic cells have evolved non-homologous end joining (NHEJ) and homologous recombination processes to mediate repair mechanisms. In higher eukaryotic cells, NHEJ, also known as illegitimate recombination, is predominant [7–10]. The human X-ray repair cross-complementing 5 (XRCC5) gene, which is also named Ku80 or Ku86, is on chromosome 2q35 [11] and encodes the XRCC5 protein. As one of three subunits of a DNA-dependent protein kinase, XRCC5 contributes to NHEJ, which is involved in maintaining genomic integrity. Defects in XRCC5 may induce deficiencies in DNA DSB repair, leading to growth retardation, chromosomal aberrations, hypersensitivity to ionizing radiation, and severe combination immune deficiency due to severely impaired V(D)J recombination [12,13]. Although loss of XRCC5 can result in instability of the genome and in increased development of tumors, overexpression of XRCC5 is also associated with the progression of bladder cancer, gastric cancer, and breast cancer [14–16]. The proximate promoter of XRCC5 contains seven copies of cis elements, which are essential for basal expression and are subject to CpG methylation [17]. Recently, we identified a novel variable number of tandem repeats (VNTR) polymorphism (rs 6147172) located in this functional region of the XRCC5 promoter. This polymorphism contains three different alleles, which are two 21 nucleotides repeats (2R) (−201 to −160 relative to the initiation of transcription), one 21 nucleotides repeat (1R) (−180 to −160), and a zero repeat (0R). Computer analysis (AliBaba) predicted that this VNTR polymorphism, which includes a variable number of Sp1-binding motifs, might affect the tran-

27

scriptional activity of XRCC5 and therefore lead to a phenotypic variation that could affect susceptibility to cancer. To test this hypothesis, we examined the function of this VNTR polymorphism and evaluated the association between its genotypes and susceptibility of a Chinese population to bladder cancer. 2. Materials and methods 2.1. Study subjects The subject recruitment for this study has been described previously [18]. In brief, 213 patients with a confirmed histologic diagnosis of bladder cancer and 235 cancer-free control subjects were recruited from The First Affiliated Hospital, Nanjing Medical University between January 2003 and November 2004 without any restriction of age and sex. All cases were patients newly diagnosed with histologically confirmed transitional cell carcinoma of the bladder. The exclusion criteria included previous cancer, metastasized cancer from other or unknown origins, and previous radiotherapy or chemotherapy. Cancer-free control subjects were genetically unrelated to the cases, had no individual history of cancer, and were recruited from those who were seeking health care and those who accompanied the patients to the clinics. We used a short questionnaire to obtain demographic and risk factor information and frequency-matched the controls to the cases by age (±5 years), sex, and residential areas. Individuals who smoked once a day for more than 1 year was defined as ever smokers. Ever smokers who had quit smoking for more than 1 year were defined as former smokers, and the other smokers as current smokers. Individuals who consumed three or more alcoholic drinks per week for at least 1 year were considered ever drinkers. After signing an informed consent form, each subject donated 5 ml of blood to be used for genomic DNA extraction. Twenty-two bladder tumor tissues from cancer patients were supplied by the Department of Urology in The Huai’an First Affiliated Hospital of Nanjing Medical University. After these tissues were genotyped, nine tissues homozygous for 2R, 1R or 0R were selected for use in this study. The study was approved by the Institutional Review Board of Nanjing Medical University. 2.2. Genotyping The VNTR polymorphism of XRCC5 was identified by the polymerase chain reaction (PCR). We designed the primer of 5 -AGGCGGCTCAAACACCACAC-3 (forward) and 5 CAAGCGGCAGATAGCGGAAAG-3 (reverse) to amplify the target fragment of XRCC5. The annealing temperature was 62 ◦ C for the XRCC5 polymorphism. The PCR products, 266-bp (2R allele), 245-bp (1R allele) or 224-bp (0R allele), were used to distinguish the VNTR polymorphism of XRCC5. Two samples of each tandem-repeat genotype were randomly selected and confirmed by automated sequencing (ABI model 377, Perkin-Elmer Applied Biosystems). To ensure that the

28

S. Wang et al. / Mutation Research 638 (2008) 26–36

observed polymorphism was sequence-specific and not the result of experimental error, the polymorphism analyses were performed by two persons independently in a blind fashion. More than 20% of the samples were randomly selected for confirmation, and the results were 100% concordant. 2.3. Cell culture, reporter gene constructs, and dual-luciferase reporter assays To determine if the VNTR polymorphism of XRCC5 promoter is functional, we used transient transfection to investigate the effects of the promoter variants on the transcription activity of reporter genes. NIH-3T3, T24, and HeLa cells were obtained from the Shanghai Institute of Biochemistry and Cell Biology, Chinese Academy of Sciences (Shanghai, China) and cultured in Dulbecco’s Modified Eagle’s Medium or 1640 medium supplemented with 100 units/ml of penicillin, 100 ␮g/ml of streptomycin, and 10% fetal bovine serum (FBS). The cells were grown at 37 ◦ C with 5% CO2 in a humidified incubator. The 2R, 1R and 0R allelic reporter constructs were prepared by amplifying the target XRCC5 promoter region, including the different repeat fragments from subjects homozygous for the 2R/2R, 1R/1R or 0R/0R genotypes. The primers were 5 -GACACGCGTCAAACACCACACGCTCCC-3 (forward) and 5 -CGCGAGATCTCGGCAGATAGCGGAAAG-3 (reverse), including the Mlu I and Bgl II restriction sites. (Attached protective nucleotides are in bold and restriction sites are in italics.) The amplified fragments were sequenced to confirm that there were no errors in matching nucleotides and that they encompassed the 2R, 1R, or 0R alleles of the human XRCC5 promoter. The amplified fragments and pGL3basic vector (Promega, Madison, WI, USA) were cleaved by Mlu I and Bgl II (TaKaRa Biotech Co., Dalian, China), and the three fragments of the XRCC5 promoter were cloned into the pGL3-basic vector. After cloning, the vectors were sequenced to confirm the orientation and integrity of each inserted construct. For transfection experiments, cells were seeded onto 24-well plates (100,000 cells per well), and cells in each well were transfected with 2.25 ␮g of vector DNA with the 2R, 1R or 0R allele by use of the Polyfect transfection reagent (Qiagen, Valencia, CA). As an internal standard, all plasmids were cotransfected with 10 ng of pRL-SV40, which contains the Renilla luciferase gene. The pGL3-basic vector without an insert was used as a negative control. Cells were collected 48 h after transfection, and cell lysates were prepared according to Promega’s instruction manual. Luciferase activity was measured with a dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) and normalized against the activity of the Renilla luciferase gene. Independent triplicate experiments were performed for each plasmid. 2.4. Electrophoretic mobility shift assay (EMSA) EMSAs were performed with the LightShiftTM Chemiluminescent EMSA Kit (Pierce, Rockford, IL, USA). For each gel-shift reaction (10 ␮l), a total of 20 fmol of 3 -end labeled

probe was combined with 1 ␮g of nuclear extract prepared from T24 or HeLa cells, 1 ␮g poly(dI-dC), and 1× binding buffer. For competition assays, a 100-fold molar excess of unlabeled 2R or 1R probe was used. The reactions were allowed to proceed for 30 min at room temperature. For each super-shift reaction (20 ␮l), 2 ␮l Sp-1 (sc-59) or NF-␬B (sc7178) antibody (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) was incubated with a nuclear extract at 4 ◦ C for 30 min, followed by an additional incubation for 30 min at room temperature with a labeled 2R probe, 1R probe, or Sp1 consensus-binding sequence. After incubation, samples were separated on a native, non-denaturing 4.5% polyacrylamide gel and then transferred to a nylon membrane. The positions of the biotin-labeled probe in the membrane were detected by a chemiluminescent reaction with the stabilized streptavidin-horseradish peroxidase conjugate according to the manufacturer’s instructions and visualized by autoradiography. The nucleotide sequences of biotin-labeled, double-stranded oligonucleotides were 5 -TGCGCATGCTCGGCGGGAATCTGCGCATGCTCGGCGGGAATC-3 , 5 -TGCGCATGCTCGGCGGGAATC-3 , and 5 -GCTCGCCCCGCCCCGATCGAAT-3 for the 2R probe, 1R probe, and Sp1 consensus-binding sequence, respectively [19]. 2.5. Southwestern blotting analyses Nuclear proteins (60 ␮g) extracted from T24 cells was subjected to electrophoresis on a 6% sodium dodecyl sulfate (SDS)-polyacrylamide gel with pre-stained protein molecular weight standards (19,000–118,000 molecular range) from Life Technologies Inc. The proteins were then electroblotted onto nitrocellulose filters (Schleicher & Schuell BA85, 0.45 mm) and renatured on the filters by serial dilution from 6 M guanidine hydrochloride to binding buffer (25 mM Hepes-KOH, pH 7.9, 5 mM MgCl2 , 25 mM NaCl, 0.5 mM dithiothreitol). The membrane was then incubated for 1 h in blocking solution containing 5% nonfat dried milk in binding buffer, and then hybridized with 1R or 2R probes labeled with biotin at 3 -end of the double-stranded sequence in binding buffer containing 0.25% nonfat dried milk for 2 h at 4 ◦ C. The filter was then washed four times (each time for 15 min) with binding buffer containing 0.25% nonfat dried milk. Biotin-labeled probes were detected by a Chemiluminescence Kit (Pierce Rockford, IL, USA). 2.6. Western blotting To investigate the effect of the VNTR polymorphism on XRCC5 protein levels, nine samples of bladder tumor tissues from patients homozygous for 2R, 1R or 0R, as confirmed by PCR, were analyzed by Western blotting. The fresh tissues were ground in liquid nitrogen and washed three times with phosphate-buffered saline. Tissue extracts were made with a detergent lysis buffer (50 mM Tris [pH 7.4]; 150 mM NaCl; 1% NP-40; 0.5% sodium deoxycholate; 0.1% SDS; and the protease inhibitor, 1 mM phenylmethanesulfonyl flu-

S. Wang et al. / Mutation Research 638 (2008) 26–36

29

Fig. 1. A schematic diagram depicting the VNTR polymorphism in the XRCC5 promoter. There are three different alleles. One, including the 42 nucleotides in the rectangular box, is composed of two 21-nucleotide repeats (2R). Another is only 21 nucleotides in the rectangular box (1R). The other is two repeats in the rectangular box absent (0R). +1 and a bent arrow designate the site for initiation of transcription.

oride). Protein (30 ␮g) was run on a 12.5% polyacrylamide gel and transferred to a nitrocellulose membrane (HybondECL; Amersham Pharmacia Biotech, Buckinghamshire, UK). The membrane was blocked with Tris-buffered saline containing 0.1% Tween 20 and 5% nonfat milk (w/v) (TBSTM) for 2 h at room temperature and then incubated overnight at 4 ◦ C with primary antibody diluted in TBSTM, which included the XRCC5 polyclonal rabbit antibody (1:1000 dilution) and ␤-actin (1:1000 dilution). These two antibodies were purchased from Cell Signaling Technology (Cell Signaling Technology Inc., Beverly, MA, USA). Immunoreactive bands were detected with a Phototope-HRP Western blot detection kit (Cell Signaling Technology Inc., Beverly, MA, USA). 2.7. Statistical analysis The χ2 -test was used to evaluate differences in the frequency distributions of selected demographic variables, smoking status, alcohol use, and each allele and genotype of the polymorphism between the cases and controls. Multivariate logistic regression analyses were performed to obtain adjusted odds ratios (ORs) for the risk of bladder cancer and their 95% confidence intervals (CIs). The multivariate adjustment included age, sex, smoking status, and alcohol use. Differences of the transcription activity in Dual-luciferase reporter assays were determined by t-test. Two-sided tests of statistical significance were conducted with SAS software (version 8.2; SAS Institute Inc., Cary, NC); a P-value <0.05 was used as the criterion of statistical significance.

3. Results

three different alleles, one including the 42 nucleotides in the rectangular box, which is composed of two 21nucleotide repeat elements (2R). Another contains only one 21-nucleotide repeat in the rectangular box (1R). The other includes no repeat element, i.e., 42 nucleotides in the rectangular box absent (0R). For this sequence, +1 and a bent arrow designate the site for initiation of transcription. As shown in Table 1, in this region, there are four additional 21-nucleotide repeat elements, with a disparity of only one or two nucleotides with 1R (different nucleotides in bold). There is more than 70% sequence conservation between the mouse and human 21-nucleotide repeat element. In our study, the human repeat elements in the VNTR polymorphism region are different from the cis elements described in the previous study [17] (Table 1, different nucleotides in italic and bold). Table 1 Sequences of the repeat elements in the XRCC5 promoter Humana

Mouseb Reported repeat a

3.1. A schematic diagram depicting the VNTR polymorphism in promoter of XRCC5 In Fig. 1, a schematic diagram depicts the VNTR polymorphism in the promoter of XRCC5. There are

(1) TGCGCATGCTCGGCGGGAATC (2) TGCGCATGCTCGGCGGGAATC (3) TGCGCATGCTCGGAGAGAATC (4) TGCGCATGCTCGGCCGGAATC (5) TGCGCGAGCTCGGCGGGAATC (6) TGCGCAAGCTCGGCGGGAATC TGCGCATGCTCAGAGCCCATG elementc

GAATGTGCGCATGCTCGGCGG

(1)–(2) two polymorphism elements in human XRCC5 promoter; (3)–(6), four additional similar repeat elements (different bases in bold). b Underlined bases indicate perfect sequence conservation between mouse and human polymorphism elements. c The polymorphism element differs with reported cis elements in the XRCC5 promoter [17] (different nucleotides in italic and bold).

30

S. Wang et al. / Mutation Research 638 (2008) 26–36

3.2. Allele-specific binding of nuclear proteins to the different tandem repeat elements in the XRCC5 promoter Analysis of these polymorphic tandem repeat elements in the XRCC5 promoter with a computer algorithm (AliBaba) revealed several potential binding sites for the nuclear transcription factor Sp1 (Fig. 2A). Furthermore, the allele with two tandem repeats includes more Sp1 binding sites than the one-repeat allele, suggesting that the presence of more tandem repeats could increase the affinity of Sp1 to the region of the XRCC5 promoter. Southwestern blotting confirmed that Sp1 binds to the VNTR polymorphism alleles, 2R and 1R. A single band at about 110 kDa (Fig. 2B) was recognized by probes for 1R and 2R. Since the molecular mass of Sp1 is about 105 kDa [31,32], the binding nuclear protein may be Sp1. Although the amounts of nuclear protein and probes 2R or 1R were equal in the binding reaction, the amount of probe 2R that binds to the nuclear protein is more than that for probe 1R, suggesting that the affinity of nuclear protein to probe 2R is greater than that for probe 1R. To confirm the binding of Sp1 to the VNTR polymorphism region of the XRCC5 promoter, electrophoretic mobility shift assays (EMSAs) were employed. Nuclear protein extracts from T24 and HeLa cells were incubated with biotin-labeled, double-stranded oligonucleotide

probes, which contained the one-repeat allele (1R) or the two-repeat allele (2R). As a positive control, a consensus binding sequence containing a classic GC box Sp1 binding site was used. As shown in Fig. 2C, a specific DNA/nuclear protein complex (shift band) was evident in binding reactions with probe 1R, probe 2R, and the Sp1 consensus probe (Lanes 2, 5, and 7); the band was more abundant with probe 2R than 1R. The shift band was eliminated by 100-fold unlabeled 1R or 2R allele probes (Lanes 3 and 6). Further, the binding of the Sp1 consensus probe/nuclear protein was eliminated by 100fold unlabeled 2R probe (Lane 8). When the 2R probe was used as a competitor with the probe for 1R, it disrupted complex formation (Lane 10). However, when oligonucleotide 1R was used as a competitor with the probe 2R, disruption of DNA-protein complexes was not evident (Lane 9). The same results were obtained with nuclear protein extracts from the HeLa cells, which have an abundance of Sp1 (data not shown). An EMSA super-shift assay was performed to determine if an anti-Sp1 antibody recognizes the complex bound to the 1R or 2R probe (Fig. 2D). The rabbit antihuman polyclonal Sp1 antibody supershifted the nuclear protein/biotin-labeled 1R probe complex (Lanes 3 and 6). A negative control anti-NF-kB antibody did not cause a shift in the band (Lanes 4 and 7). In this assay, the 2R probe bound to Sp1 (data not shown).

Fig. 2. Analysis of transcription factor binding sites in the XRCC5 promoter region containing the VNTR polymorphism. (A) Potential Sp1 binding sites in the repeat elements are underlined. (B) Southwestern blotting analysis was performed using T24 cells nuclear extract to determine the molecular weight(s) of the proteins that bind to the probe 1R (Lane 2) and the probe 2R (Lane 1). (C) Electrophoretic mobility shift assays (EMSAs) are depicted where nuclear protein extracts from T24 cells were incubated with biotin-labeled double-stranded oligonucleotide probes, which were one-repeat allele (1R) (Lanes 2 and 3), two-repeat allele (2R) (Lanes 5 and 6), and the Sp1 consensus sequence (Lanes 7 and 8). A specific DNA/nuclear protein complex (shift band) can be completely abolished both by 100-fold unlabeled 1R or 2R allele probes (Lanes 3 and 6). The binding band of the Sp1 consensus probe/nuclear protein also can be completely eliminated by 100-fold unlabeled 2R probe (Lane 8). The unlabeled oligonucleotide 2R probe and 1R probe were used as a competitor with probe 1R or 2R (Lanes 9 and 10). (D) Super-shift studies with the biotin-labeled oligonucleotide 1R probe (Lanes 1–5) or Sp1 consensus sequence (Lanes 6 and 7) and nuclear extracts from T24 cells in the presence of anti-Sp1 antibody and anti-NF-kb antibody. The rabbit anti-human polyclonal Sp1 antibody supershifted the protein complex (Lanes 3 and 6). As a control, rabbit anti-NF-kb antibody did not cause any shift in the band (Lanes 4 and 7). Labeled oligonucleotides incubated without the nuclear extracts were considered as negative controls (Lane 1).

S. Wang et al. / Mutation Research 638 (2008) 26–36

31

Fig. 2. (Continued ).

3.3. Effect of the VNTR polymorphism on XRCC5 basal transcript activity and XRCC5 protein level To determine if the VNTR polymorphism located in the promoter region affects the basal transcription activity of XRCC5, we measured promoter activity with a Dual Luciferase Reporter Assay System (Promega) and compared the activities of the 2R, 1R, and 0R alleles by transient transfection in HeLa, T24, and NIH3T3

cells. In these three cells, the reporter plasmid containing the 1R allele and 0R allele yielded 1.72- and 2.79-fold higher luciferase levels in NIH3T3 cell than the 2R allele (Fig. 3B). Similarly, in T24 and HeLa cells, the luciferase activities of the 1R allele (2.38-, 1.73-fold, respectively) and the 0R allele (2.73-, 2.03-fold, respectively) were higher relative to that for the 2R allele. We conclude that fewer tandem repeats in the XRCC5 promoter increase the activity of the XRCC5 transcript.

32

S. Wang et al. / Mutation Research 638 (2008) 26–36

3.4. The VNTR polymorphism of XRCC5 and risk of bladder cancer

Fig. 3. Effect of the VNTR polymorphism on XRCC5 transcript activity and XRCC5 protein level. (A) Schematic representation of reporter plasmids containing two, one, or zero tandem-repeat elements (2R, 1R, 0R), which were inserted upstream of the luciferase reporter gene in the pGL3 basic plasmid. (B) The three constructs and the control pGL3 basic plasmid were transiently transfected into NIH3T3, T24, or HeLa cells. The luciferase activity of each construct was normalized against the activity of Renilla luciferase. Fold increase was determined relative to the activity of the empty pGL3 basic plasmid. The mean expression levels and standard deviations were obtained from three independent experiments (*p < 0.01, compared with the 2R construct). (C) XRCC5 protein levels in tumor tissues of bladder cancer patients homozygous for 2R, 1R, or 0R were analyzed by Western blotting. The level of each protein was normalized against ␤-actin. For Lanes 1, 5, and 8, proteins were from bladder cancer patients with the 2R/2R genotype. For Lanes 3 and 4, proteins were from samples with the 1R/1R genotype. For Lanes 2, 6, 7, and 9, proteins were from those with the 0R/0R genotype. Arrows indicate the positions of the proteins.

In order to confirm the hypothesis that the VNTR polymorphism of XRCC5 promoter affects XRCC5 protein levels, nine samples of bladder cancer tissue homozygous for 2R (three cases), 1R (two cases), or 0R (four cases) were selected. XRCC5 protein levels were higher in tumor tissues bearing the 0R/0R genotype (Lanes 2, 6, 7, and 9) than in those with the 1R/1R (Lanes 3 and 4) or 2R/2R (Lanes 1, 5, and 8) genotype (Fig. 3C). The level of XRCC5 protein was lowest in the group with the 2R/2R (Lanes 1, 5, and 8) genotype. Thus, in bladder cancer patients, fewer tandem repeats in the XRCC5 promoter may enhance XRCC5 protein levels.

The evidence that elevated expression of XRCC5 is associated with shorter repeats prompted us to investigate the association between the VNTR polymorphism of XRCC5 and susceptibility to bladder cancer. In a case–control study, we selected 213 cases and 235 controls, matched for age and sex. The mean age was 63.5 ± 12.1 years for cases and 62.7 ± 12.0 years for controls (P = 0.981). 82.6% and 17.4% of the cases and 76.2% and 23.8% of the controls were men and women, respectively (P = 0.092). However, the cases were more likely to be ever smokers (53.5%) and alcohol users (50.7%) than were the controls (34.9% and 35.7%, respectively). These differences were statistically significant (P < 0.001 for tobacco smoking and P = 0.001 for alcohol use, Table 2). XRCC5 genotype and allele distributions of the VNTR polymorphism in case patients and control subjects and their associations with risk of bladder cancer are shown in Table 3. The frequencies of the 2R/2R, 2R/1R, 2R/0R genotypes (11.7%, 12.7%, and 29.1%, respectively) among the cases were less than those for the controls (11.9%, 24.3%, and 30.2%, respectively). Among the cases, however, the proportions of the 1R/1R, 1R/0R, 0R/0R genotypes were 5.6%, 18.8%, and 22.1%, respectively, which were greater than those among the controls (5.1%, 15.7%, and 12.8%, respectively). Furthermore, the difference of these genotype distributions between the cases and the controls was statistically significant (P = 0.014). These genotypes were divided into two groups, one including individuals carrying the 2R allele (2R/2R, 2R/1R, 2R/0R genotypes) and the other individuals not carrying this allele (1R/1R, 1R/0R, 0R/0R genotypes). The frequencies of subjects carrying the 2R allele and not carrying the 2R allele were 0.535 and 0.465, respectively, among the cases and 0.664 and 0.336, respectively, among the controls; the difference was statistically significant (P = 0.006). The proportions of the 2R allele, 1R allele, and 0R allele were 0.326, 0.214, and 0.460, respectively, among the cases and 0.392, 0.251, and 0.357, respectively, among the controls; the difference was statistically significant (P = 0.008). Multivariate logistic regression analysis revealed that the risk of bladder cancer was not associated with different genotypes of XRCC5 (Table 3). However, individuals not carrying the 2R allele had a 1.75-fold increased risk of bladder cancer (95% CI = 1.19–2.58) compared with those carrying the 2R allele.

S. Wang et al. / Mutation Research 638 (2008) 26–36

33

Table 2 Frequency distributions of selected variables between bladder cancer cases and cancer-free controls Variables

Cases (N = 213) N

Pa

Controls (N = 235) %

N

%

Age (years) ≤55 56–65 >65

45 65 103

21.1 30.5 48.4

49 73 113

20.9 31.1 48.0

0.992

Sex Male Female

176 37

82.6 17.4

179 56

76.2 23.8

0.092

Smoking status Never Ever

99 114

46.5 53.5

153 82

65.1 34.9

<0.001

Drinking status Never Ever

105 108

49.3 50.7

151 84

64.3 35.7

0.001

a

Two-sided χ2 -test for the frequency distributions of selected variables between the cases and controls.

Table 3 Genotype and allele frequencies of the XRCC5 VNTR polymorphism among the cases and controls and their associations with risk of bladder cancer Genotypes

2R/2R 2R/1R 2R/0R 1R/1R 1R/0R 0R/0R

Cases (N = 213)

Controls (N = 235)

N

N

%

Pa

Adjusted OR (95% CI)b

1.00 (reference) 0.54 (0.27–1.10) 0.99 (0.52–1.87) 1.16 (0.44–3.05) 1.28 (0.63–2.58) 1.78 (0.87–3.61)

%

25 27 62 12 40 47

11.74 12.68 29.11 5.63 18.78 22.07

28 57 71 12 37 30

11.91 24.26 30.21 5.11 15.74 12.77

0.014

Alleles 2R allele 1R allele 0R allele

139 91 196

32.63 21.36 46.01

184 118 168

39.15 25.11 35.74

0.008

Dichotomized groups Carrying 2R allele (2R/2R, 2R/1R, 2R/0R) No-carrying 2R allele (1R/1R, 1R/0R, 0R/0R)

114 99

53.52 46.48

156 79

66.38 33.62

0.006

a b

1.00 (reference) 1.75 (1.19–2.58)

Two-sided χ2 -test for either genotype distributions or allele frequencies between the cases and controls. Obtained from a logistic regression model with adjustment for age, sex, smoking status, and alcohol use.

4. Discussion In the present study, we examined the functional significance of a VNTR polymorphism in the XRCC5 promoter and, in a hospital-based case–control study, evaluated the impact of this polymorphism on the risk of the bladder cancer in a southeastern Chinese population. The VNTR polymorphism in the promoter of XRCC5 was detected in a Chinese population using PCR and confirmed with sequencing. There were three different alleles, 2R, 1R, and 0R. Following the VNTR polymorphism sequences in the XRCC5 promoter region,

there are four similar repeat elements; however, each of these elements includes one or two different nucleotides compared with the minimum repeat element in polymorphism region (1R). The basis for the absence of the VNTR polymorphism in these four elements and the lack of deletion of these repeat elements are not clear. Perhaps the one or two differing nucleotides are important for occurrence of the VNTR polymorphism. In the mouse XRCC5 promoter, there is only one similar repeat element, and there are six different nucleotides compared with the human minimum repeat element (1R). Further studies are required to determine if these

34

S. Wang et al. / Mutation Research 638 (2008) 26–36

differing structures have different functions in various species. In our study, we found that transcription of XRCC5 was decreased by Sp1 through the interaction at the Sp1-binding sites in the tandem-repeat elements in the XRCC5 promoter region. Sp1, considered to be a transcriptional activator in some cells, however, it also may negatively regulate gene transcription [19–22]. Recent reports document the overexpression of the XRCC5 protein or high XRCC5 mRNA activity in gastric cancer [15], esophageal cancer [23], colorectal cancer [24], breast and bladder tumors [16], non-melanoma-skin cancer [25], head and neck cancer, [26] and chronic lymphocytic leukemia [27]. XRCC5 may function as an oncogene in the development of cancer. Our results also confirm that, in bladder cancer patients, fewer repeats in the XRCC5 promoter enhance XRCC5 transcriptional activity and protein levels. Perhaps over-activity of XRCC5 leads to excess DNA repair, which can increase the resistance of cells to genotoxic agents and interfere with normal apoptosis, thus increasing the likelihood for the development of neoplasia. The VNTR polymorphism appears to have functional significance. The short-sequence motifs in these tandem repeats are thought to bind to nuclear factors and affect transcriptional activity, stability of mRNA, and translational efficacy [28]. In this study, the presence of the 21-bp tandem repeat elements in the XRCC5 promoter correlated with transcriptional activity and protein expression. These results are consistent with previous reports. For example, a VNTR polymorphism in the SMYD3 promoter region affects its basal expression [29]; a polymorphic microsatellite of PIG3 is a p53-responsive element [30]; and the 28-bp repeat polymorphism in TYMS 5 -untranslated region (5 UTR) can affect gene expression, protein translation efficiency [31,32] and sensitivity to antitumor agents [33]. The tandem-repeat sequences, which expand during DNA replication, are thought to be related to certain human diseases [34]. Further, VNTR polymorphisms often relate to differential susceptibility to cancer [29]. Our data show that the individuals not carrying the 2R allele of the VNTR polymorphism in the XRCC5 promoter had a 1.75-fold increased risk of bladder cancer compared with those carrying the 2R allele. This observation is similar to another report in which variable numbers of CCGCC units in the SMYD3 promoter region were noted to affect the risk of colorectal cancer, hepatocellular carcinoma, and breast cancer [29]. Nevertheless, a polymorphic microsatellite of PIG3 was not associated with breast cancer in two different ethnic groups, Greek

and British [35]. Further, the 28-bp repeat polymorphism in TYMS 5 -UTR had no effect on gastric cancer in a Chinese population [36] or on squamous cell carcinoma of the head and neck in non-Hispanic white people [37]. Although the present hospital-based case–control study is subject to the limitation of selection bias, we applied rigorous epidemiological design in subject recruitment and made statistical adjustments to minimize this possibility. Further, since the sample size in our study was not large, we did not analyze the potential interaction of the different genotypes with risk factors such as age, sex, smoking, or drinking. A following study will include more samples. In conclusion, we established that fewer tandem repeats containing Sp1-binding elements and located in the XRCC5 promoter region confer higher transcriptional activity and translational efficacy owing to lower binding affinity to the Sp1 factor. Furthermore, we determined that, in a Chinese population, the risk of bladder cancer was increased in subjects carrying fewer tandem repeat alleles. Larger studies with more detailed environmental exposure data and involving ethnically diverse populations could be used to verify our findings. Acknowledgements We are grateful to Dr. Donald L. Hill (University of Alabama at Birmingham, USA) for editing this paper. This work was supported in part by the National Natural Science Foundation of China (30571541), the Natural Science Foundation of Jiangsu Province (BK2006233, BK2005161), the Medicine Foundation of Jiangsu Province (H200506), and the Creative Science Foundation of Nanjing Medical University (CX2004002). References [1] D.M. Parkin, International variation, Oncogene 23 (2004) 6329–6340. [2] S.M. Cohen, T. Shirai, G. Steineck, Epidemiology and etiology of premalignant and malignant urothelial changes, Scand J. Urol. Nephrol. Suppl. (2000) 105–115. [3] P. Vineis, G. Talaska, C. Malaveille, H. Bartsch, T. Martone, P. Sithisarankul, P. Strickland, DNA adducts in urothelial cells: relationship with biomarkers of exposure to arylamines and polycyclic aromatic hydrocarbons from tobacco smoke, Int. J. Cancer 65 (1996) 314–316. [4] A. Miyajima, J. Nakashima, K. Yoshioka, M. Tachibana, H. Tazaki, M. Murai, Role of reactive oxygen species in cis-dichlorodiammineplatinum-induced cytotoxicity on bladder cancer cells, Br. J. Cancer 76 (1997) 206–210. [5] J.H. Hoeijmakers, Genome maintenance mechanisms for preventing cancer, Nature 411 (2001) 366–374. [6] T. Lindahl, R.D. Wood, Quality control by DNA repair, Science 286 (1999) 1897–1905.

S. Wang et al. / Mutation Research 638 (2008) 26–36 [7] J.E. Haber, Partners and pathways repairing a double-strand break, Trends Genet. 16 (2000) 259–264. [8] M. Takata, M.S. Sasaki, E. Sonoda, C. Morrison, M. Hashimoto, H. Utsumi, Y. Yamaguchi-Iwai, A. Shinohara, S. Takeda, Homologous recombination and non-homologous end-joining pathways of DNA double-strand break repair have overlapping roles in the maintenance of chromosomal integrity in vertebrate cells, EMBO J. 17 (1998) 5497–5508. [9] D.C. van Gent, J.H. Hoeijmakers, R. Kanaar, Chromosomal stability and the DNA double-stranded break connection, Nat. Rev. Genet. 2 (2001) 196–206. [10] K.P. Hopfner, C.D. Putnam, J.A. Tainer, DNA double-strand break repair from head to tail, Curr. Opin. Struct. Biol. 12 (2002) 115–122. [11] Q.Q. Cai, A. Plet, J. Imbert, M. Lafage-Pochitaloff, C. Cerdan, J.M. Blanchard, Chromosomal location and expression of the genes coding for Ku p70 and p80 in human cell lines and normal tissues, Cytogenet. Cell Genet. 65 (1994) 221–227. [12] Y. Gu, K.J. Seidl, G.A. Rathbun, C. Zhu, J.P. Manis, N. van der Stoep, L. Davidson, H.L. Cheng, J.M. Sekiguchi, K. Frank, P. Stanhope-Baker, M.S. Schlissel, D.B. Roth, F.W. Alt, Growth retardation and leaky SCID phenotype of Ku70-deficient mice, Immunity 7 (1997) 653–665. [13] K.K. Khanna, S.P. Jackson, DNA double-strand breaks: signaling, repair and the cancer connection, Nat. Genet. 27 (2001) 247– 254. [14] L. Stronati, G. Gensabella, C. Lamberti, P. Barattini, D. Frasca, C. Tanzarella, S. Giacobini, M.G. Toscano, C. Santacroce, D.T. Danesi, Expression and DNA binding activity of the Ku heterodimer in bladder carcinoma, Cancer 92 (2001) 2484– 2492. [15] J.W. Lim, H. Kim, K.H. Kim, Expression of Ku70 and Ku80 mediated by NF-kappa B and cyclooxygenase-2 is related to proliferation of human gastric cancer cells, J. Biol. Chem. 277 (2002) 46093–46100. [16] S. Pucci, P. Mazzarelli, C. Rabitti, M. Giai, M. Gallucci, G. Flammia, A. Alcini, V. Altomare, V.M. Fazio, Tumor specific modulation of KU70/80 DNA binding activity in breast and bladder human tumor biopsies, Oncogene 20 (2001) 739– 747. [17] D.L. Ludwig, F. Chen, S.R. Peterson, A. Nussenzweig, G.C. Li, D.J. Chen, Ku80 gene expression is Sp1-dependent and sensitive to CpG methylation within a novel cis element, Gene 199 (1997) 181–194. [18] C. Li, W. Wu, J. Liu, L. Qian, A. Li, K. Yang, Q. Wei, J. Zhou, Z. Zhang, Functional polymorphisms in the promoter regions of the FAS and FAS ligand genes and risk of bladder cancer in south China: a case–control analysis, Pharmacogenet. Genomics 16 (2006) 245–251. [19] B. Hao, X. Miao, Y. Li, X. Zhang, T. Sun, G. Liang, Y. Zhao, Y. Zhou, H. Wang, X. Chen, L. Zhang, W. Tan, Q. Wei, D. Lin, F. He, A novel T-77C polymorphism in DNA repair gene XRCC1 contributes to diminished promoter activity and increased risk of non-small cell lung cancer, Oncogene 25 (2006) 3613– 3620. [20] Y. Shou, S. Baron, M. Poncz, An Sp1-binding silencer element is a critical negative regulator of the megakaryocyte-specific alphaIIb gene, J. Biol. Chem. 273 (1998) 5716–5726. [21] J. Won, J. Yim, T.K. Kim, Sp1 and Sp3 recruit histone deacetylase to repress transcription of human telomerase reverse transcriptase (hTERT) promoter in normal human somatic cells, J. Biol. Chem. 277 (2002) 38230–38238.

35

[22] G. Dean, D.A. Young, D.R. Edwards, I.M. Clark, The human tissue inhibitor of metalloproteinases (TIMP)-1 gene contains repressive elements within the promoter and intron 1, J. Biol. Chem. 275 (2000) 32664–32671. [23] N. Tonotsuka, Y. Hosoi, S. Miyazaki, G. Miyata, K. Sugawara, T. Mori, N. Ouchi, S. Satomi, Y. Matsumoto, K. Nakagawa, K. Miyagawa, T. Ono, Heterogeneous expression of DNA-dependent protein kinase in esophageal cancer and normal epithelium, Int. J. Mol. Med. 18 (2006) 441–447. [24] Y. Hosoi, T. Watanabe, K. Nakagawa, Y. Matsumoto, A. Enomoto, A. Morita, H. Nagawa, N. Suzuki, Up-regulation of DNAdependent protein kinase activity and Sp1 in colorectal cancer, Int. J. Oncol. 25 (2004) 461–468. [25] P. Parrella, P. Mazzarelli, E. Signori, G. Perrone, G.F. Marangi, C. Rabitti, M. Delfino, M. Prencipe, A.P. Gallo, M. Rinaldi, G. Fabbrocini, S. Delfino, P. Persichetti, V.M. Fazio, DNA binding activity and ku70/80 heterodimer expression in human nonmelanoma-skin cancer, J. Clin. Pathol. (2006). [26] H.W. Chang, S.Y. Kim, S.L. Yi, S.H. Son, D.Y. Song, S.Y. Moon, J.H. Kim, E.K. Choi, S.D. Ahn, S.S. Shin, K.K. Lee, S.W. Lee, Expression of Ku80 correlates with sensitivities to radiation in cancer cell lines of the head and neck, Oral Oncol. (2006). [27] A. Klein, O. Miera, O. Bauer, S. Golfier, F. Schriever, Chemosensitivity of B cell chronic lymphocytic leukemia and correlated expression of proteins regulating apoptosis, cell cycle and DNA repair, Leukemia 14 (2000) 40–46. [28] Y. Nakamura, K. Koyama, M. Matsushima, VNTR (variable number of tandem repeat) sequences as transcriptional, translational, or functional regulators, J. Hum. Genet. 43 (1998) 149– 152. [29] M. Tsuge, R. Hamamoto, F.P. Silva, Y. Ohnishi, K. Chayama, N. Kamatani, Y. Furukawa, Y. Nakamura, A variable number of tandem repeats polymorphism in an E2F-1 binding element in the 5 -flanking region of SMYD3 is a risk factor for human cancers, Nat. Genet. 37 (2005) 1104–1107. [30] A. Contente, A. Dittmer, M.C. Koch, J. Roth, M. Dobbelstein, A polymorphic microsatellite that mediates induction of PIG3 by p53, Nat. Genet. 30 (2002) 315–320. [31] N. Horie, H. Aiba, K. Oguro, H. Hojo, K. Takeishi, Functional analysis and DNA polymorphism of the tandemly repeated sequences in the 5 -terminal regulatory region of the human gene for thymidylate synthase, Cell Struct. Funct. 20 (1995) 191– 197. [32] K. Kawakami, K. Omura, E. Kanehira, Y. Watanabe, Polymorphic tandem repeats in the thymidylate synthase gene is associated with its protein expression in human gastrointestinal cancers, Anticancer Res. 19 (1999) 3249–3252. [33] A. Yawata, S.R. Kim, A. Miyajima, T. Kubo, S. Ishida, Y. Saito, Y. Nakajima, N. Katori, Y. Matsumoto, M. Fukuoka, Y. Ohno, S. Ozawa, J. Sawada, Polymorphic tandem repeat sequences of the thymidylate synthase gene correlates with cellular-based sensitivity to fluoropyrimidine antitumor agents, Cancer Chemother. Pharmacol. 56 (2005) 465–472. [34] P. Djian, Evolution of simple repeats in DNA and their relation to human disease, Cell 94 (1998) 155–160. [35] V.G. Gorgoulis, T. Liloglou, F. Sigala, D. Korkolis, D. Yannoukakos, E. Papalambros, P.J. Asimacopoulos, A.G. Papavassiliou, A. Kotsinas, Absence of association with cancer risk and low frequency of alterations at a p53 responsive PIG3 gene polymorphism in breast and lung carcinomas, Mutat. Res. 556 (2004) 143–150.

36

S. Wang et al. / Mutation Research 638 (2008) 26–36

[36] Z. Zhang, Y. Xu, J. Zhou, X. Wang, L. Wang, X. Hu, J. Guo, Q. Wei, H. Shen, Polymorphisms of thymidylate synthase in the 5 and 3 -untranslated regions associated with risk of gastric cancer in South China: a case–control analysis, Carcinogenesis 26 (2005) 1764–1769.

[37] Z. Zhang, Q. Shi, E.M. Sturgis, M.R. Spitz, W.K. Hong, Q. Wei, Thymidylate synthase 5 - and 3 -untranslated region polymorphisms associated with risk and progression of squamous cell carcinoma of the head and neck, Clin. Cancer Res. 10 (2004) 7903–7910.