- Email: [email protected]
Correlation between a variable number tandem repeat (VNTR) polymorphism in SMYD3 gene and breast cancer: A genotype-phenotype study
Journal Pre-proofs Research paper Correlation between a variable number tandem repeat (VNTR) polymorphism in SMYD3 gene and breast cancer: a genotype-phenotype study Laith N. AL-Eitan, Doaa M. Rababa'h PII: DOI: Reference:
S0378-1119(19)30940-0 https://doi.org/10.1016/j.gene.2019.144281 GENE 144281
To appear in:
Gene Gene
Received Date: Revised Date: Accepted Date:
20 January 2019 18 November 2019 2 December 2019
Please cite this article as: L.N. AL-Eitan, D.M. Rababa'h, Correlation between a variable number tandem repeat (VNTR) polymorphism in SMYD3 gene and breast cancer: a genotype-phenotype study, Gene Gene (2019), doi: https://doi.org/10.1016/j.gene.2019.144281
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Published by Elsevier B.V.
Correlation between a variable number tandem repeat (VNTR) polymorphism in SMYD3 gene and breast cancer: a genotype-phenotype study. Laith N. AL-Eitan1,2*, Doaa M. Rababa’h2 1Department
of Applied Biological Sciences, Jordan University of Science and Technology, Irbid 22110, Jordan 2Department of Biotechnology and Genetic Engineering, Jordan University of Science and Technology, Irbid 22110, Jordan *Corresponding Author: Dr. Laith N Al-Eitan at Jordan University of Science and Technology. P.O. Box 3030, Irbid 22110, Jordan. Tel: + (962) -2 -7201000. Ext. 23464. Fax: + (962)-2-7201071. Email: [email protected] Highlights
Breast cancer (BC) is the most common cancer among women and consider the most lethal disease in the developing countries
This is the first study on Jordanian population of Arab descent to investigate the genetic association of SET and MYND domain containing protein 3 (SMYD3) gene polymorphisms with BC susceptibility and prognosis factors.
The SMYD3 gene encodes a methyltransferase enzyme, the overexpression of the SMYD3 gene could lead to cancer development
The variable number tandem repeat (VNTR) polymorphism within SMYD3 gene promoter was found to be associated with BC development and progression.
Abstract Genetic predisposition to breast cancer (BC) has become one of the most studied aspects of the disease. Advances in the field of cancer research have revealed the role of different genetic polymorphisms within genes of interest in the development of BC. This study aimed to explore the impact of a variable number tandem repeat (VNTR) genetic variant found within the SET and MYND domain containing protein 3 (SMYD3) gene on BC risk in Jordan and examine key clinical and pathological prognostic factors. Genotyping of blood samples from 180 cases with breast cancer and 180 healthy individuals from the Jordanian population was carried out via a combination of PCR and agarose gel electrophoresis. A highly significant association was found at level of genotype (P-value = 0.009) and allele (P-value = 0.0001) between BC development and the VNTR variant in the SMYD3 gene among Jordanian women. Moreover, we found that the VNTR of SMYD3 gene may interfere with BC risk among patients with different immunohistochemistry (IHC) profiles (P-value < 0.05). This study reported that there is a significant correlation between BC development and the VNTR in the SMYD3 gene. These findings can help alleviate the burden of BC in developing countries including Jordan and to
fill the gaps in current literature. Since this study was carried out on Jordanian Arabs, more studies on the link between BC and the SMYD3 VNTR variant are recommended to determine this polymorphism’s impact on other ethnic groups. Key words: Cancer; Breast; SMYD3; VNTR; Prognosis. Background BC is the most common type of cancer among women across the world.1 In Jordan, 1230 women were diagnosed with breast cancer in 2012 alone, making it the most prevalent type of cancer among Jordanian females2. Like other cancers, BC develops when the cells of the breast undergo rapid and abnormal growth3,4. Such uncontrolled growth results in the formation of a malignant tumor that could later invade the surrounding parts and tissues of the breast5. BC can be divided into two types depending on where it originates within the breast: ductal cancer (if it develops in the milk ducts) and lobular cancer (if it begins in the milk-producing glands)6. BC development and progression has been found to be influenced by environmental factors, individual physiological profiles, and inherited genetics, the latter of which has been the subject of much research in recent years7,8. SET and MYND domain containing protein 3 (SMYD3), is a member of the SMYD family of SET domain-containing proteins, that methylate’s Lys4 of histone H3 (H3-K4)9,10. However, as a methyltransferase enzyme, the overexpression of the SMYD3 gene could lead to cancer development because of its role in the catalysis of histone methylation. Regardless, studies suggested that SMYD3 labor an oncogenic effect by activating transcription of the downstream target genes11, 12. Specific genetic variants within genes of interest have been significantly associated with an increased susceptibility to BC in a number of studies that explored the impact of genetics on cancer risk13-15. The variable number tandem repeat (VNTR) is a genetic variant that has been previously implicated in BC and involves repeated nucleotides that are tandemly-arranged and of different lengths 13. In particular, the VNTR polymorphism in the promoter region of the SMYD3 gene has been implicated in many types of cancer such as colorectal, ovarian, and breast cancer as well as leukemia16-17. This VNTR polymorphism located in the promoter region of the SMYD3 and consist of five bases (CCGCC motif) and was shown to be a binding site for the transcription factor E2F-1. The wild type allele involves three repeats that has high binding affinity when compared to the two repeats allele18, 19.
In the present study, the relationship between the VNTR polymorphism in the SMYD3 gene and BC among Jordanian women was investigated. In addition, BC patients were screened for a group of prognosis parameters in order to determine the influence of this polymorphism in increased risk of BC. Materials and Methods Sample Collection Blood samples were collected from 180 women diagnosed with BC and 180 healthy women randomly selected from the Jordanian population. The two groups were matched by age, gender, and ethnicity. Ethical approval was obtained from the Intuitional Review Board (IRB) with ethical code number 32/104/2017 at Jordan University of Science and Technology. Written informed consent was obtained from all participants. In this study, the collected samples were obtained from the Jordanian Royal Medical Services (JRMS). Clinical and pathological features of BC patients In this study we analyzed group of clinical and pathological characteristics of BC patients involved in this study. All data (demographical, clinical and pathological) was obtained from the patients’ medical records. Table 1 summarizes these parameters and their details. All patients were female with average age of 53.9±9 years while the average age at BC diagnosis of the cohort was 50.5 ±17.5 years, in addition the average age at first pregnancy was 21.4±1.5 years, while it was 13.9±0.5 years for patients at their first menstruation. Genomic Extraction and Genotyping DNA was extracted from 5 ml of venous peripheral blood using the Wizard® Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA) according to the manufacturer’s instructions. The NanoDrop® ND-1000 UV-Vis spectrophotometer (Thermofisher Scientific, USA) was used to detect the DNA quality (A260/280) and DNA quantity (ng/µl). SMYD3 Genotyping Traditional PCR and agarose gel electrophoresis techniques were used to genotype the VNTR in the regulatory region of the SMYD3 gene. Ready-made primers based on previously published data were used (F-5′GGCGTCTCACGGGCTGCCGGG3′ and R5′CGGAGCCTTACGACCACCTTC3′)16. The chosen PCR program entailed initial denaturation at 94℃for 5 minutes, 35 cycles of denaturation at 94℃, annealing at 58℃, and extension at 72℃for 30s each, and a final extension step at 72℃for 7 minutes. The sizes of the amplicons were 157and 162bp. Gel electrophoresis was subsequently employed in order
to detect the PCR product. PCR products were loaded onto 2% agarose gel and subsequently visualized by gel documentation under UV light. Band sizes were deduced through comparison with a 50 bp ladder. Statistical Analysis In this study, genotypic and allelic frequencies were statistically calculated using SNPstat software (version 1.14.0). Pearson's chi-squared and ANOVA tests were used to perform genetic association20. All P-values < 0.05 were accepted as statistically significant. The Statistical Package for the Social Sciences (SPSS), version 25.0 (SPSS, Inc., Chicago, IL) was used to conduct the phenotype-genotype statistical analyses. Results Genotypes assessment Figure 1 shows the three different genotypes that resulted from the PCR amplification. The 2R allele was detected at a size of 157bp, while the3R allele was detected at a size of 162bp. The heterozygous 2R\3R genotype was indicated by two bands at sizes of 157bp and 162bp. Allelic and Genotypic Frequency Distribution of SMYD3 VNTR Table 2 shows the frequency distribution of the SMYD3 VNTR genotypes and alleles. We found that 43% of healthy participants had the 2R allele compared to the 57% who had the 3R allele. In contrast, allelic frequencies among BC patients were 57.5% and 42.5% for the 2R and 3R alleles, respectively. Additionally, our results displayed that the frequency of the 3R allele among controls (57%) was significantly higher than its frequency in the BC group (42.5%). With regard to genotypic frequencies, we estimated a significant differences in the distribution of the homozygous 3R genotype among cases and controls. Correspondingly, 48.3% of the healthy group carried 3R/3R while 32.8% of the cases expressed the same genotypes. As table 2 illustrates, the distribution of 2R/2R genotype among patients (47.8%) was higher than it among controls (34.5%), however there was no significant variation in the heterozygous genotype distribution among cases and controls. To describe how the distribution of different genotypes and alleles among study cohorts impact the disease risk, a genetic association analysis was performed in this study and remarkably revealed a significant correlation with BC for alleles (P-value=1e-4) and genotypes (P-value=9e-3).
Genotype-Phenotype Analysis As shown in Tables 3 and 4, the correlation between the SMYD3 VNTR gene variant and a group of clinical and pathological features among BC patients was investigated. Clinical parameters include ages at first diagnosis with breast cancer, menarche, and pregnancy, involvement of other diseases (co-morbidity) and family history of breast cancer (Table 3). The age of first menarche as well as the age at first pregnancy were included to determine the effect of the duration of endogenous estrogen exposure on the BC progression. In this study we did not find any correlation between the investigated clinical features and SMYD3 variant. Furthermore, Table 4 illustrates the Pathological prognosis factors that have been investigated in this study that included the presence of progesterone and estrogen receptors, tumor size (<=2cm, >2cm<5cm, >=5cm), metastasis of the tumor to the axillary lymph nodes, and the tumor stages (stage 1 & 2 compared to stage 3 & 4). In addition, tumors were classified into two groups; in situ carcinomas and invasive carcinomas, while tumor differentiation was classified as low against tumor with medium and high differentiation. Moreover, we categorized the cases according to the immunohistochemistry (IHC) profile that based on progesterone and estrogen receptor status in addition to the expression of human epidermal growth factor receptor 2 (Her2). Our finding showed an association between IHC and the VNTR of Smyd3 gene (P-value= 0.023). However the other pathological parameters were not in correlation with Smyd3 variant (Table 4). Discussion This present study investigated the association between BC development and the VNTR variant in the SMYD3 gene. To the best of our knowledge, this study involved homogeneous cohort of a single ethnic group, comprising women randomly selected for BC. Several studies have investigated the relationship between the SMYD3 VNTR in its promoter region and cancer, suggesting that it may be related to individual susceptibility to tumorigenesis21-23. As a methyltransferase, the SMYD3 gene itself has been reported to be implicated in multiple cancers due to its role in transcriptional regulation24,25. However, the association between SMYD3 VNTR genotypes and BC showed disparity among different ethnic groups.25,26 According to our study, both the alleles and the genotypes of the VNTR in the SMYD3 gene are associated with BC risk among Jordanian females. In particular, we found that the 2R allele and the 2R\2R genotype may confer increased BC risk in Jordanian women. In contrast, Ma et al. (2017) found no such association between the SMYD3 VNTR variant and BC in Chinese
women27, as well as among Germany women26. Otherwise, an odd finding by Tsuge et al (2005) suggested in their study conducted in Japan that the three repeats VNTR of SMYD3 gene is a risk factor for BC risk 28. However more epidemiological studies are needed for better understanding of the fundamental role of SMYD3 genetic alteration among different populations. The association between prognostic factors of cancer types and SMYD3 polymorphism has been investigated in several studies14,29. Likewise, in the current study group of clinical and pathological features that could be linked to increased BC risk were explored. However, clinical features such as smoking, breastfeeding status, family history, allergy and body mass index did not show any correlation with the breast cancer increased risk. Moreover, we explored several pathological features that may be related to breast cancer development. An association between IHC profile of BC patients and SMYD3 variant genotypes was found. In regard, we suggest that the VNTR of SMYD3 gene may interfere BC risk among patients with different BC classes according to their IHC profile. However, except for IHC profile, in this study we suggested that the presence of progesterone or estrogen receptors, tumor differentiation, tumor stage, lymph node involvement and the histology classification of BC were not associated with breast cancer increased risk, even more they were not influenced by the VNTR in the SMYD3 gene. Overall, this study is the first in Jordan to investigate the genetic association of SMYD3 gene polymorphisms with BC susceptibility and prognosis factors. Although, the results of this study are limited to generate a background knowledge of genetic variations between BC patients and healthy individuals of Jordanian population. These findings may prove crucial to understanding the BC mechanism in Middle Eastern populations of Arab descent. Moreover, the identification of genetic variants that are associated with diseases in different ethnic backgrounds may enable researchers in the future to assess if the same gene variations are associated with the aetiology of BC and further assess the strength of the association. Comparative analyses with different ethnic groups could also assist in understanding the mechanisms that causes BC. Finally, this may lead to more accurate diagnosing of individuals to different classifications including cancer stage development and identify at an early stage individual at high risk for BC and therefore requiring more intensive intervention. To conclude, our study proved that there is a significant correlation between BC development and the VNTR in the SMYD3 gene among Jordanian women. Our findings can help alleviate
the burden of BC in the Jordanian population and to fill the gaps in current literature. Since this study was carried out on Jordanian Arabs, more studies on the link between BC and the SMYD3 VNTR variant are recommended to determine this polymorphism’s impact on other ethnic groups. Acknowledgements The authors thank the Royal Medical Services for approving the study in the first instance. This study was funded by the Deanship of Research (RN: 126/2017), Jordan University of Science and Technology.
Disclosure of interest The authors report no conflicts of interest. Informed consent Informed consent was obtained from all individual participants included in the study References 1- World Health Organization (WHO).Breast cancer: prevention and control. 2014. http://www.who.int/cancer/detection/breastcancer/en// 2- Laith N. AL-Eitan, Reem I. Jamous, Rame H. Khasawneh. Candidate Gene Analysis of Breast Cancer in the Jordanian Population of Arab Descent: A Case-Control Study, Cancer Investigation. 2017; [1289217] DOI: 10.1080/07357907.2017. 3- American Joint Committee on Cancer. Breast. In AJCC Cancer Staging Manual. New York: Springer. 2010;7: 345-376. 4- Benson JR, Jatoi I. The global breast cancer burden. Future Oncol. 2010; 8(6):697-702. 5- Sakorafas GH. Breast cancer surgery—historical evolution: current status, and future perspectives. Acta Oncologica. 2001;40:5–18. 6- U.S. National Library of Medicine. https://ghr.nlm.nih.gov/condition/breast-cancer.
Genetics
Home
Reference.
2017.
7- Yip CH, Smith RA, Anderson BO et al. Guideline implementation for breast healthcare in low- and middle-income countries: early detection resource allocation. Cancer. 2008;113:2244–2256. 8- Angahar LT. An overview of breast cancer epidemiology, risk factors, pathophysiology, and cancer risks reduction. MOJ Biol Med. 2017;1(4):92‒96. 9- Steel M, Thompson A, Clayton J. Genetic aspects of breast cancer. Br Med Bull. 1999;47:504–518.
10- Woldegiorgis S, Ahmed R.C, Zhen Y et al. Genetic Polymorphism in Three Glutathione S-transferase Genes and Breast Cancer Risk. California Breast Cancer Research Program of the University of California. 2002; 1-14. 11- Konwar R, Chaudhary P, Kumar S et al. Breast cancer risk associated with polymorphisms of IL-1RN and IL-4 gene in Indian women. Oncol Res. 2009; 17(8):367-72. 12- Han MR, Zheng W, Cai Q et al. Evaluating genetic variants associated with breast cancer risk in high and moderate-penetrance genes in Asians. Carcinogenesis. 2017; 38( 5): 511–518. 13- Alshareeda AT, Negm OH, Albarakati N et al. Clinicopathological significance of KU70/KU80, a key DNA damage repair protein in breast cancer. Breast Cancer Res Treat. 2013; 139:301–310. 14- Liu T, Xu H, Gao W et al. SET and MYND Domain-Containing Protein 3 (SMYD3) Polymorphism as a Risk Factor for Susceptibility and Poor Prognosis in Ovarian Cancer. Med Sci Monit.2016; 22: 5131-5140. 15- Oliveira-Santos W, Rabello DA, Lucena-Araujo AR, et al. Residual expression of SMYD2 and SMYD3 is associated with the acquisition of complex karyotype in chronic lymphocytic leukemia. Tumour Biol. 2016; 37(7):9473-81. 16-Barlési F, Giaccone G, Gallegos-Ruiz MI et al. Genotype analysis of the VNTR polymorphism in the SMYD3 histone methyltransferase gene: Lack of correlation with the level of histone H3 methylation in NSCLC tissues or with the risk of NSCLC. Int. J. Cancer. 2008;122: 1441–1442. 17- Orphanos G, Kountourakis P. Targeting the HER2 receptor in metastatic breast cancer. Hematol Oncol Stem Cell Ther. 2012; 5(3):127-137. 18- Wang H, Liu Y, Tan W et al. Association of the variable number of tandem repeats polymorphism in the promoter region of the SMYD3 gene with risk of esophageal squamous cell carcinoma in relation to tobacco smoking. Cancer Science. 2008; 99 (4):787-791. 19- Tsuge M, Hamamoto R, Silva F et al. A variable number of tandem repeats polymorphism in an E2F-1 binding element in the 5′ flanking region of SMYD3 is a risk factor for human cancers. Nature Genetics. 2005;37 (10): 1104 – 1107. 20- Preacher K. J. Calculation for the chi-square test: An interactive calculation tool for chisquare tests of goodness of fit and independence.2001; http://quantpsy.org/chisq/chisq.htm/ 21- Miremadi A1, Oestergaard MZ, Pharoah PD, Caldas C. Cancer genetics of epigenetic genes, Human Molecular Genetics. 2007; 16(1): 28–49. 22-Wang XQ, Miao X, Cai Q et al . SMYD3 tandem repeats polymorphism is not associated with the occurrence and metastasis of hepatocellular carcinoma in a Chinese population. Exp Oncol. 2007; 29: 71–3.
23-Lund AH, van Lohuizen M. Epigenetics and cancer. Genes Dev. 2004;18:2315–35. 24 - Sponziello M, Durante C, Boichard A et al. Epigenetic-related gene expression profile in medullary thyroid cancer revealed the overexpression of the histone methyltransferases EZH2 and SMYD3 in aggressive tumours. Mol Cell Endocrinol. 2014;392(1-2):8-13. 25-Hamamoto R, Furukawa Y, Morita M et al . SMYD3 encodes a histone methyltransferase involvedin the proliferation of cancer cel ls. Nat Cell Biol. 2004;6:731–40. 26-Frank B, Hemminki K, Wappenschmidt B et al. Variable number of tandem repeats polymorphism in the SMYD3 promoter region and the risk of familial breast cancer. Int J Cancer. 2016; 118: 2917–18. 27- Ma SJ, Liu YM, Zhang YL et al. Correlations of EZH2 and SMDY3 Gene Polymorphisms with Breast Cancer Susceptibility and Prognosis. Bioscience Reports. 2017; 10: 1-34.
28- Tsuge M, Hamamoto R, Silva FP et al. A variable number of tandem repeats polymorphism in an E2F‐1 binding element in the 5′ flanking region of SMYD3 is a risk factor for human cancers. Nat Genet2005; 37: 1104–7. 29- Chen LB, Xu JY, Yang Z et al. Silencing SMYD3 in hepatoma demethylates RIZI promoter induces apoptosis and inhibits cell proliferation and migration. World J Gastroenterol. 2007; 13: 5718–24.
Figure caption
Figure 1: Agarose gel electrophoresis of the different alleles of the VNTR polymorphism in the SMYD3 gene. Lane 1 represents the heterozygous genotype (2R\3R), which was indicated by two bands at sizes of 162 and 157bp. The two homozygous genotypes are represented by lanes 2 (3R\3R) and 3 (2R\2R).
*Abbreviations list BC: Breast Cancer IHC: Immunohistochemistry IRB: Institutional Review Board JRMS: Jordanian Royal Medical Services
PCR: Polymerase Chain Reaction SPSS: Statistical Package for the Social Sciences SMYD3: SET and MYND domain containing protein 3 VNTR: variable number tandem repeat
Highlights
Breast cancer (BC) is the most common cancer among women and consider the most lethal disease in the developing countries
This is the first study on Jordanian population of Arab descent to investigate the genetic association of SET and MYND domain containing protein 3 (SMYD3) gene polymorphisms with BC susceptibility and prognosis factors.
The SMYD3 gene encodes a methyltransferase enzyme, the overexpression of the SMYD3 gene could lead to cancer development
The variable number tandem repeat (VNTR) polymorphism within SMYD3 gene promoter was found to be associated with BC development and progression.
Author Contributions AL-Eitan designed the study. AL-Eitan and Rababa’h were responsible for sample, demographic and clinical data collection. AL-Eitan and Rababa’h analyzed the sample and interpreted the data. AL-Eitan and Rababa’h prepared the manuscript. Both authors helped in reviewing the manuscript.
Table 1: Clinical and pathological features of BC patients Clinical characteristics
Frequency (n=180)
Pathological characteristics
Frequency (n=180)
BMI
<=25
23.9%
Positive
50%
>25
76.1%
Progesterone receptor
Negative
50%
First pregnancy (age)
<20
19.0%
Estrogen receptor
Positive
76.6%
>=20
81.0%
Negative
23.4%
Age at breast cancer diagnosis
<45
33.9%
Low. differentiation
36.3%
>=45
66.1%
Tumor differentiation
Mid & High. differentiation
63.6%
Age at first menstruation
<13
30.6%
Free of tumor
50%
>=13
69.4%
Axillary nodes
Show metastatic Carcinoma
50%
Breastfeeding status
yes
66.3%
PT1-PT2
94.7%
No
33.7%
PT3-PT4
5.3%
<50
46.7%
In situ carcinoma
16.4%
>=50
53.3%
Histology classification
invasive carcinoma
83.6%
Yes
14.6%
Tumor size
<=2CM
20.5%
No
69.6%
2
35.5%
Yes
27.1%
>5
44.0%
No
72.8%
Yes
84.6%
Yes
27.7%
Lymph node involvement
No
15.3%
No
72.3%
Positive
39.6%
Yes
49.1%
Negative
60.4%
No
50.9%
Human epidermal growth factor receptor 2 (Her2) marker
Age menopause Family history
Allergy
Smoking
Co-morbidity
at
lymph
Tumor stage
Table 2: Genotypic and Allelic Frequency Distribution of the VNTR within the SMYD3Gene. Genotypes and alleles Control group Breast cancer group P- value* 2R
155 (43%)
205 (57.5%)
3R
207 (57%)
153 (42.5%)
2R\2R
62 (34.5%)
86 (47.8%)
3R\3R
87 (48.3%)
59 (32.8%)
2R\3R
31 (17.2%)
35 (19.4%)
1e-4
P-Value <0.05 considered as significant
9e-3
Table 3: Association of SMYD3 polymorphism with the clinical parameters of breast cancer patients. Clinical characteristics P- value BMI**
0.739
First pregnancy (age)**
0.152
Age at breast cancer diagnosis**
0.074
Age at first menstruation**
0.606
Breastfeeding status*
0.534
Age at menopause**
0.860
Family history*
0.294
Allergy*
0.156
Smoking*
0.454
Co-morbidity*
0.301
*Genotype_phenotype association using Pearson Chi-squared test **Genotype_phenotype association using ANOVA test P-Value <0.05 considered as significant
Table 4: Association of SMYD3 VNTR gene polymorphism with pathological characteristics of breast cancer patients. Pathological characteristics P- value Progesterone receptor*
0.458
Estrogen receptor*
0.201
Human epidermal growth factor receptor 2 (Her2) marker*
0.320
IHC profile* LA vs LB vs TN
0.023
Tumor differentiation*
0.708
Axillary lymph nodes*
0.521
Tumor stage*
0.731
Histology classification*
0.343
Tumor size**
0.592
Lymph node involvement*
0.537
*Genotype_phenotype association using Pearson Chi-squared test **Genotype_phenotype association using ANOVA test P-Value <0.05 considered as significant IHC; the immunohistochemistry (IHC) profile: LA: ER(+) and /or PR(+) plus HER(-) LB: ER(+) and /or PR(+) plus HER(+) TN: ER(-) and PR(-) plus HER(-)
S0378-1119(19)30940-0 https://doi.org/10.1016/j.gene.2019.144281 GENE 144281
To appear in:
Gene Gene
Received Date: Revised Date: Accepted Date:
20 January 2019 18 November 2019 2 December 2019
Please cite this article as: L.N. AL-Eitan, D.M. Rababa'h, Correlation between a variable number tandem repeat (VNTR) polymorphism in SMYD3 gene and breast cancer: a genotype-phenotype study, Gene Gene (2019), doi: https://doi.org/10.1016/j.gene.2019.144281
This is a PDF file of an article that has undergone enhancements after acceptance, such as the addition of a cover page and metadata, and formatting for readability, but it is not yet the definitive version of record. This version will undergo additional copyediting, typesetting and review before it is published in its final form, but we are providing this version to give early visibility of the article. Please note that, during the production process, errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
© 2019 Published by Elsevier B.V.
Correlation between a variable number tandem repeat (VNTR) polymorphism in SMYD3 gene and breast cancer: a genotype-phenotype study. Laith N. AL-Eitan1,2*, Doaa M. Rababa’h2 1Department
of Applied Biological Sciences, Jordan University of Science and Technology, Irbid 22110, Jordan 2Department of Biotechnology and Genetic Engineering, Jordan University of Science and Technology, Irbid 22110, Jordan *Corresponding Author: Dr. Laith N Al-Eitan at Jordan University of Science and Technology. P.O. Box 3030, Irbid 22110, Jordan. Tel: + (962) -2 -7201000. Ext. 23464. Fax: + (962)-2-7201071. Email: [email protected] Highlights
Breast cancer (BC) is the most common cancer among women and consider the most lethal disease in the developing countries
This is the first study on Jordanian population of Arab descent to investigate the genetic association of SET and MYND domain containing protein 3 (SMYD3) gene polymorphisms with BC susceptibility and prognosis factors.
The SMYD3 gene encodes a methyltransferase enzyme, the overexpression of the SMYD3 gene could lead to cancer development
The variable number tandem repeat (VNTR) polymorphism within SMYD3 gene promoter was found to be associated with BC development and progression.
Abstract Genetic predisposition to breast cancer (BC) has become one of the most studied aspects of the disease. Advances in the field of cancer research have revealed the role of different genetic polymorphisms within genes of interest in the development of BC. This study aimed to explore the impact of a variable number tandem repeat (VNTR) genetic variant found within the SET and MYND domain containing protein 3 (SMYD3) gene on BC risk in Jordan and examine key clinical and pathological prognostic factors. Genotyping of blood samples from 180 cases with breast cancer and 180 healthy individuals from the Jordanian population was carried out via a combination of PCR and agarose gel electrophoresis. A highly significant association was found at level of genotype (P-value = 0.009) and allele (P-value = 0.0001) between BC development and the VNTR variant in the SMYD3 gene among Jordanian women. Moreover, we found that the VNTR of SMYD3 gene may interfere with BC risk among patients with different immunohistochemistry (IHC) profiles (P-value < 0.05). This study reported that there is a significant correlation between BC development and the VNTR in the SMYD3 gene. These findings can help alleviate the burden of BC in developing countries including Jordan and to
fill the gaps in current literature. Since this study was carried out on Jordanian Arabs, more studies on the link between BC and the SMYD3 VNTR variant are recommended to determine this polymorphism’s impact on other ethnic groups. Key words: Cancer; Breast; SMYD3; VNTR; Prognosis. Background BC is the most common type of cancer among women across the world.1 In Jordan, 1230 women were diagnosed with breast cancer in 2012 alone, making it the most prevalent type of cancer among Jordanian females2. Like other cancers, BC develops when the cells of the breast undergo rapid and abnormal growth3,4. Such uncontrolled growth results in the formation of a malignant tumor that could later invade the surrounding parts and tissues of the breast5. BC can be divided into two types depending on where it originates within the breast: ductal cancer (if it develops in the milk ducts) and lobular cancer (if it begins in the milk-producing glands)6. BC development and progression has been found to be influenced by environmental factors, individual physiological profiles, and inherited genetics, the latter of which has been the subject of much research in recent years7,8. SET and MYND domain containing protein 3 (SMYD3), is a member of the SMYD family of SET domain-containing proteins, that methylate’s Lys4 of histone H3 (H3-K4)9,10. However, as a methyltransferase enzyme, the overexpression of the SMYD3 gene could lead to cancer development because of its role in the catalysis of histone methylation. Regardless, studies suggested that SMYD3 labor an oncogenic effect by activating transcription of the downstream target genes11, 12. Specific genetic variants within genes of interest have been significantly associated with an increased susceptibility to BC in a number of studies that explored the impact of genetics on cancer risk13-15. The variable number tandem repeat (VNTR) is a genetic variant that has been previously implicated in BC and involves repeated nucleotides that are tandemly-arranged and of different lengths 13. In particular, the VNTR polymorphism in the promoter region of the SMYD3 gene has been implicated in many types of cancer such as colorectal, ovarian, and breast cancer as well as leukemia16-17. This VNTR polymorphism located in the promoter region of the SMYD3 and consist of five bases (CCGCC motif) and was shown to be a binding site for the transcription factor E2F-1. The wild type allele involves three repeats that has high binding affinity when compared to the two repeats allele18, 19.
In the present study, the relationship between the VNTR polymorphism in the SMYD3 gene and BC among Jordanian women was investigated. In addition, BC patients were screened for a group of prognosis parameters in order to determine the influence of this polymorphism in increased risk of BC. Materials and Methods Sample Collection Blood samples were collected from 180 women diagnosed with BC and 180 healthy women randomly selected from the Jordanian population. The two groups were matched by age, gender, and ethnicity. Ethical approval was obtained from the Intuitional Review Board (IRB) with ethical code number 32/104/2017 at Jordan University of Science and Technology. Written informed consent was obtained from all participants. In this study, the collected samples were obtained from the Jordanian Royal Medical Services (JRMS). Clinical and pathological features of BC patients In this study we analyzed group of clinical and pathological characteristics of BC patients involved in this study. All data (demographical, clinical and pathological) was obtained from the patients’ medical records. Table 1 summarizes these parameters and their details. All patients were female with average age of 53.9±9 years while the average age at BC diagnosis of the cohort was 50.5 ±17.5 years, in addition the average age at first pregnancy was 21.4±1.5 years, while it was 13.9±0.5 years for patients at their first menstruation. Genomic Extraction and Genotyping DNA was extracted from 5 ml of venous peripheral blood using the Wizard® Genomic DNA Purification Kit (Promega Corp., Madison, WI, USA) according to the manufacturer’s instructions. The NanoDrop® ND-1000 UV-Vis spectrophotometer (Thermofisher Scientific, USA) was used to detect the DNA quality (A260/280) and DNA quantity (ng/µl). SMYD3 Genotyping Traditional PCR and agarose gel electrophoresis techniques were used to genotype the VNTR in the regulatory region of the SMYD3 gene. Ready-made primers based on previously published data were used (F-5′GGCGTCTCACGGGCTGCCGGG3′ and R5′CGGAGCCTTACGACCACCTTC3′)16. The chosen PCR program entailed initial denaturation at 94℃for 5 minutes, 35 cycles of denaturation at 94℃, annealing at 58℃, and extension at 72℃for 30s each, and a final extension step at 72℃for 7 minutes. The sizes of the amplicons were 157and 162bp. Gel electrophoresis was subsequently employed in order
to detect the PCR product. PCR products were loaded onto 2% agarose gel and subsequently visualized by gel documentation under UV light. Band sizes were deduced through comparison with a 50 bp ladder. Statistical Analysis In this study, genotypic and allelic frequencies were statistically calculated using SNPstat software (version 1.14.0). Pearson's chi-squared and ANOVA tests were used to perform genetic association20. All P-values < 0.05 were accepted as statistically significant. The Statistical Package for the Social Sciences (SPSS), version 25.0 (SPSS, Inc., Chicago, IL) was used to conduct the phenotype-genotype statistical analyses. Results Genotypes assessment Figure 1 shows the three different genotypes that resulted from the PCR amplification. The 2R allele was detected at a size of 157bp, while the3R allele was detected at a size of 162bp. The heterozygous 2R\3R genotype was indicated by two bands at sizes of 157bp and 162bp. Allelic and Genotypic Frequency Distribution of SMYD3 VNTR Table 2 shows the frequency distribution of the SMYD3 VNTR genotypes and alleles. We found that 43% of healthy participants had the 2R allele compared to the 57% who had the 3R allele. In contrast, allelic frequencies among BC patients were 57.5% and 42.5% for the 2R and 3R alleles, respectively. Additionally, our results displayed that the frequency of the 3R allele among controls (57%) was significantly higher than its frequency in the BC group (42.5%). With regard to genotypic frequencies, we estimated a significant differences in the distribution of the homozygous 3R genotype among cases and controls. Correspondingly, 48.3% of the healthy group carried 3R/3R while 32.8% of the cases expressed the same genotypes. As table 2 illustrates, the distribution of 2R/2R genotype among patients (47.8%) was higher than it among controls (34.5%), however there was no significant variation in the heterozygous genotype distribution among cases and controls. To describe how the distribution of different genotypes and alleles among study cohorts impact the disease risk, a genetic association analysis was performed in this study and remarkably revealed a significant correlation with BC for alleles (P-value=1e-4) and genotypes (P-value=9e-3).
Genotype-Phenotype Analysis As shown in Tables 3 and 4, the correlation between the SMYD3 VNTR gene variant and a group of clinical and pathological features among BC patients was investigated. Clinical parameters include ages at first diagnosis with breast cancer, menarche, and pregnancy, involvement of other diseases (co-morbidity) and family history of breast cancer (Table 3). The age of first menarche as well as the age at first pregnancy were included to determine the effect of the duration of endogenous estrogen exposure on the BC progression. In this study we did not find any correlation between the investigated clinical features and SMYD3 variant. Furthermore, Table 4 illustrates the Pathological prognosis factors that have been investigated in this study that included the presence of progesterone and estrogen receptors, tumor size (<=2cm, >2cm<5cm, >=5cm), metastasis of the tumor to the axillary lymph nodes, and the tumor stages (stage 1 & 2 compared to stage 3 & 4). In addition, tumors were classified into two groups; in situ carcinomas and invasive carcinomas, while tumor differentiation was classified as low against tumor with medium and high differentiation. Moreover, we categorized the cases according to the immunohistochemistry (IHC) profile that based on progesterone and estrogen receptor status in addition to the expression of human epidermal growth factor receptor 2 (Her2). Our finding showed an association between IHC and the VNTR of Smyd3 gene (P-value= 0.023). However the other pathological parameters were not in correlation with Smyd3 variant (Table 4). Discussion This present study investigated the association between BC development and the VNTR variant in the SMYD3 gene. To the best of our knowledge, this study involved homogeneous cohort of a single ethnic group, comprising women randomly selected for BC. Several studies have investigated the relationship between the SMYD3 VNTR in its promoter region and cancer, suggesting that it may be related to individual susceptibility to tumorigenesis21-23. As a methyltransferase, the SMYD3 gene itself has been reported to be implicated in multiple cancers due to its role in transcriptional regulation24,25. However, the association between SMYD3 VNTR genotypes and BC showed disparity among different ethnic groups.25,26 According to our study, both the alleles and the genotypes of the VNTR in the SMYD3 gene are associated with BC risk among Jordanian females. In particular, we found that the 2R allele and the 2R\2R genotype may confer increased BC risk in Jordanian women. In contrast, Ma et al. (2017) found no such association between the SMYD3 VNTR variant and BC in Chinese
women27, as well as among Germany women26. Otherwise, an odd finding by Tsuge et al (2005) suggested in their study conducted in Japan that the three repeats VNTR of SMYD3 gene is a risk factor for BC risk 28. However more epidemiological studies are needed for better understanding of the fundamental role of SMYD3 genetic alteration among different populations. The association between prognostic factors of cancer types and SMYD3 polymorphism has been investigated in several studies14,29. Likewise, in the current study group of clinical and pathological features that could be linked to increased BC risk were explored. However, clinical features such as smoking, breastfeeding status, family history, allergy and body mass index did not show any correlation with the breast cancer increased risk. Moreover, we explored several pathological features that may be related to breast cancer development. An association between IHC profile of BC patients and SMYD3 variant genotypes was found. In regard, we suggest that the VNTR of SMYD3 gene may interfere BC risk among patients with different BC classes according to their IHC profile. However, except for IHC profile, in this study we suggested that the presence of progesterone or estrogen receptors, tumor differentiation, tumor stage, lymph node involvement and the histology classification of BC were not associated with breast cancer increased risk, even more they were not influenced by the VNTR in the SMYD3 gene. Overall, this study is the first in Jordan to investigate the genetic association of SMYD3 gene polymorphisms with BC susceptibility and prognosis factors. Although, the results of this study are limited to generate a background knowledge of genetic variations between BC patients and healthy individuals of Jordanian population. These findings may prove crucial to understanding the BC mechanism in Middle Eastern populations of Arab descent. Moreover, the identification of genetic variants that are associated with diseases in different ethnic backgrounds may enable researchers in the future to assess if the same gene variations are associated with the aetiology of BC and further assess the strength of the association. Comparative analyses with different ethnic groups could also assist in understanding the mechanisms that causes BC. Finally, this may lead to more accurate diagnosing of individuals to different classifications including cancer stage development and identify at an early stage individual at high risk for BC and therefore requiring more intensive intervention. To conclude, our study proved that there is a significant correlation between BC development and the VNTR in the SMYD3 gene among Jordanian women. Our findings can help alleviate
the burden of BC in the Jordanian population and to fill the gaps in current literature. Since this study was carried out on Jordanian Arabs, more studies on the link between BC and the SMYD3 VNTR variant are recommended to determine this polymorphism’s impact on other ethnic groups. Acknowledgements The authors thank the Royal Medical Services for approving the study in the first instance. This study was funded by the Deanship of Research (RN: 126/2017), Jordan University of Science and Technology.
Disclosure of interest The authors report no conflicts of interest. Informed consent Informed consent was obtained from all individual participants included in the study References 1- World Health Organization (WHO).Breast cancer: prevention and control. 2014. http://www.who.int/cancer/detection/breastcancer/en// 2- Laith N. AL-Eitan, Reem I. Jamous, Rame H. Khasawneh. Candidate Gene Analysis of Breast Cancer in the Jordanian Population of Arab Descent: A Case-Control Study, Cancer Investigation. 2017; [1289217] DOI: 10.1080/07357907.2017. 3- American Joint Committee on Cancer. Breast. In AJCC Cancer Staging Manual. New York: Springer. 2010;7: 345-376. 4- Benson JR, Jatoi I. The global breast cancer burden. Future Oncol. 2010; 8(6):697-702. 5- Sakorafas GH. Breast cancer surgery—historical evolution: current status, and future perspectives. Acta Oncologica. 2001;40:5–18. 6- U.S. National Library of Medicine. https://ghr.nlm.nih.gov/condition/breast-cancer.
Genetics
Home
Reference.
2017.
7- Yip CH, Smith RA, Anderson BO et al. Guideline implementation for breast healthcare in low- and middle-income countries: early detection resource allocation. Cancer. 2008;113:2244–2256. 8- Angahar LT. An overview of breast cancer epidemiology, risk factors, pathophysiology, and cancer risks reduction. MOJ Biol Med. 2017;1(4):92‒96. 9- Steel M, Thompson A, Clayton J. Genetic aspects of breast cancer. Br Med Bull. 1999;47:504–518.
10- Woldegiorgis S, Ahmed R.C, Zhen Y et al. Genetic Polymorphism in Three Glutathione S-transferase Genes and Breast Cancer Risk. California Breast Cancer Research Program of the University of California. 2002; 1-14. 11- Konwar R, Chaudhary P, Kumar S et al. Breast cancer risk associated with polymorphisms of IL-1RN and IL-4 gene in Indian women. Oncol Res. 2009; 17(8):367-72. 12- Han MR, Zheng W, Cai Q et al. Evaluating genetic variants associated with breast cancer risk in high and moderate-penetrance genes in Asians. Carcinogenesis. 2017; 38( 5): 511–518. 13- Alshareeda AT, Negm OH, Albarakati N et al. Clinicopathological significance of KU70/KU80, a key DNA damage repair protein in breast cancer. Breast Cancer Res Treat. 2013; 139:301–310. 14- Liu T, Xu H, Gao W et al. SET and MYND Domain-Containing Protein 3 (SMYD3) Polymorphism as a Risk Factor for Susceptibility and Poor Prognosis in Ovarian Cancer. Med Sci Monit.2016; 22: 5131-5140. 15- Oliveira-Santos W, Rabello DA, Lucena-Araujo AR, et al. Residual expression of SMYD2 and SMYD3 is associated with the acquisition of complex karyotype in chronic lymphocytic leukemia. Tumour Biol. 2016; 37(7):9473-81. 16-Barlési F, Giaccone G, Gallegos-Ruiz MI et al. Genotype analysis of the VNTR polymorphism in the SMYD3 histone methyltransferase gene: Lack of correlation with the level of histone H3 methylation in NSCLC tissues or with the risk of NSCLC. Int. J. Cancer. 2008;122: 1441–1442. 17- Orphanos G, Kountourakis P. Targeting the HER2 receptor in metastatic breast cancer. Hematol Oncol Stem Cell Ther. 2012; 5(3):127-137. 18- Wang H, Liu Y, Tan W et al. Association of the variable number of tandem repeats polymorphism in the promoter region of the SMYD3 gene with risk of esophageal squamous cell carcinoma in relation to tobacco smoking. Cancer Science. 2008; 99 (4):787-791. 19- Tsuge M, Hamamoto R, Silva F et al. A variable number of tandem repeats polymorphism in an E2F-1 binding element in the 5′ flanking region of SMYD3 is a risk factor for human cancers. Nature Genetics. 2005;37 (10): 1104 – 1107. 20- Preacher K. J. Calculation for the chi-square test: An interactive calculation tool for chisquare tests of goodness of fit and independence.2001; http://quantpsy.org/chisq/chisq.htm/ 21- Miremadi A1, Oestergaard MZ, Pharoah PD, Caldas C. Cancer genetics of epigenetic genes, Human Molecular Genetics. 2007; 16(1): 28–49. 22-Wang XQ, Miao X, Cai Q et al . SMYD3 tandem repeats polymorphism is not associated with the occurrence and metastasis of hepatocellular carcinoma in a Chinese population. Exp Oncol. 2007; 29: 71–3.
23-Lund AH, van Lohuizen M. Epigenetics and cancer. Genes Dev. 2004;18:2315–35. 24 - Sponziello M, Durante C, Boichard A et al. Epigenetic-related gene expression profile in medullary thyroid cancer revealed the overexpression of the histone methyltransferases EZH2 and SMYD3 in aggressive tumours. Mol Cell Endocrinol. 2014;392(1-2):8-13. 25-Hamamoto R, Furukawa Y, Morita M et al . SMYD3 encodes a histone methyltransferase involvedin the proliferation of cancer cel ls. Nat Cell Biol. 2004;6:731–40. 26-Frank B, Hemminki K, Wappenschmidt B et al. Variable number of tandem repeats polymorphism in the SMYD3 promoter region and the risk of familial breast cancer. Int J Cancer. 2016; 118: 2917–18. 27- Ma SJ, Liu YM, Zhang YL et al. Correlations of EZH2 and SMDY3 Gene Polymorphisms with Breast Cancer Susceptibility and Prognosis. Bioscience Reports. 2017; 10: 1-34.
28- Tsuge M, Hamamoto R, Silva FP et al. A variable number of tandem repeats polymorphism in an E2F‐1 binding element in the 5′ flanking region of SMYD3 is a risk factor for human cancers. Nat Genet2005; 37: 1104–7. 29- Chen LB, Xu JY, Yang Z et al. Silencing SMYD3 in hepatoma demethylates RIZI promoter induces apoptosis and inhibits cell proliferation and migration. World J Gastroenterol. 2007; 13: 5718–24.
Figure caption
Figure 1: Agarose gel electrophoresis of the different alleles of the VNTR polymorphism in the SMYD3 gene. Lane 1 represents the heterozygous genotype (2R\3R), which was indicated by two bands at sizes of 162 and 157bp. The two homozygous genotypes are represented by lanes 2 (3R\3R) and 3 (2R\2R).
*Abbreviations list BC: Breast Cancer IHC: Immunohistochemistry IRB: Institutional Review Board JRMS: Jordanian Royal Medical Services
PCR: Polymerase Chain Reaction SPSS: Statistical Package for the Social Sciences SMYD3: SET and MYND domain containing protein 3 VNTR: variable number tandem repeat
Highlights
Breast cancer (BC) is the most common cancer among women and consider the most lethal disease in the developing countries
This is the first study on Jordanian population of Arab descent to investigate the genetic association of SET and MYND domain containing protein 3 (SMYD3) gene polymorphisms with BC susceptibility and prognosis factors.
The SMYD3 gene encodes a methyltransferase enzyme, the overexpression of the SMYD3 gene could lead to cancer development
The variable number tandem repeat (VNTR) polymorphism within SMYD3 gene promoter was found to be associated with BC development and progression.
Author Contributions AL-Eitan designed the study. AL-Eitan and Rababa’h were responsible for sample, demographic and clinical data collection. AL-Eitan and Rababa’h analyzed the sample and interpreted the data. AL-Eitan and Rababa’h prepared the manuscript. Both authors helped in reviewing the manuscript.
Table 1: Clinical and pathological features of BC patients Clinical characteristics
Frequency (n=180)
Pathological characteristics
Frequency (n=180)
BMI
<=25
23.9%
Positive
50%
>25
76.1%
Progesterone receptor
Negative
50%
First pregnancy (age)
<20
19.0%
Estrogen receptor
Positive
76.6%
>=20
81.0%
Negative
23.4%
Age at breast cancer diagnosis
<45
33.9%
Low. differentiation
36.3%
>=45
66.1%
Tumor differentiation
Mid & High. differentiation
63.6%
Age at first menstruation
<13
30.6%
Free of tumor
50%
>=13
69.4%
Axillary nodes
Show metastatic Carcinoma
50%
Breastfeeding status
yes
66.3%
PT1-PT2
94.7%
No
33.7%
PT3-PT4
5.3%
<50
46.7%
In situ carcinoma
16.4%
>=50
53.3%
Histology classification
invasive carcinoma
83.6%
Yes
14.6%
Tumor size
<=2CM
20.5%
No
69.6%
2
35.5%
Yes
27.1%
>5
44.0%
No
72.8%
Yes
84.6%
Yes
27.7%
Lymph node involvement
No
15.3%
No
72.3%
Positive
39.6%
Yes
49.1%
Negative
60.4%
No
50.9%
Human epidermal growth factor receptor 2 (Her2) marker
Age menopause Family history
Allergy
Smoking
Co-morbidity
at
lymph
Tumor stage
Table 2: Genotypic and Allelic Frequency Distribution of the VNTR within the SMYD3Gene. Genotypes and alleles Control group Breast cancer group P- value* 2R
155 (43%)
205 (57.5%)
3R
207 (57%)
153 (42.5%)
2R\2R
62 (34.5%)
86 (47.8%)
3R\3R
87 (48.3%)
59 (32.8%)
2R\3R
31 (17.2%)
35 (19.4%)
1e-4
P-Value <0.05 considered as significant
9e-3
Table 3: Association of SMYD3 polymorphism with the clinical parameters of breast cancer patients. Clinical characteristics P- value BMI**
0.739
First pregnancy (age)**
0.152
Age at breast cancer diagnosis**
0.074
Age at first menstruation**
0.606
Breastfeeding status*
0.534
Age at menopause**
0.860
Family history*
0.294
Allergy*
0.156
Smoking*
0.454
Co-morbidity*
0.301
*Genotype_phenotype association using Pearson Chi-squared test **Genotype_phenotype association using ANOVA test P-Value <0.05 considered as significant
Table 4: Association of SMYD3 VNTR gene polymorphism with pathological characteristics of breast cancer patients. Pathological characteristics P- value Progesterone receptor*
0.458
Estrogen receptor*
0.201
Human epidermal growth factor receptor 2 (Her2) marker*
0.320
IHC profile* LA vs LB vs TN
0.023
Tumor differentiation*
0.708
Axillary lymph nodes*
0.521
Tumor stage*
0.731
Histology classification*
0.343
Tumor size**
0.592
Lymph node involvement*
0.537
*Genotype_phenotype association using Pearson Chi-squared test **Genotype_phenotype association using ANOVA test P-Value <0.05 considered as significant IHC; the immunohistochemistry (IHC) profile: LA: ER(+) and /or PR(+) plus HER(-) LB: ER(+) and /or PR(+) plus HER(+) TN: ER(-) and PR(-) plus HER(-)