A Toll receptor in shrimp

Molecular Immunology 44 (2007) 1999–2008

A Toll receptor in shrimp Li-Shi Yang a,1 , Zhi-Xin Yin a,1 , Ji-Xiang Liao a , Xian-De Huang a , Chang-Jun Guo a , Shao-Ping Weng a , Siu-Ming Chan c , Xiao-Qiang Yu b,∗ , Jian-Guo He a,∗∗ a

State Key Laboratory for Biocontrol, School of Life Sciences, Zhongshan University, 135 Xingang Road West, Guangzhou 510275, PR China Division of Cell Biology and Biophysics, School of Biological Sciences, University of Missouri-Kansas City, Kansas City, MO 64110, USA c Department of Zoology, The University of Hong Kong, Pokfulam Road, Hong Kong SAR, PR China

b

Received 31 August 2006; received in revised form 19 September 2006; accepted 25 September 2006 Available online 23 October 2006

Abstract Outbreaks of infectious diseases have resulted in high mortality and huge economic losses in penaeid shrimp culture. Interest in understanding shrimp immunity has increased because of its importance in disease control. Here we report cDNA cloning of a Toll receptor from the white shrimp Litopenaeus vannamei. L. vannamei Toll (lToll) is 926 residues, with a putative signal peptide of 19 residues. The protein contains distinct structural/functional motifs of the Toll like receptor (TLR) family, including an extracellular domain containing 16 leucine-rich repeats (LRRs) flanked by cysteine-rich motifs and a cytoplasmic Toll/interleukin-1 receptor (TIR) domain. The lToll TIR domain showed high similarity to Apis mellifer Toll and Drosophila melanogaster Toll, with 59.9% and 54.3% identity, respectively. Reverse-transcription polymerase chain reaction (RT-PCR) analysis showed that lToll was expressed in hemocyte, gill, heart, brain, stomach, intestine, pyloric caecum, muscle, nerve and spermary, with a lower expression level in eyestalk and hepatopancreas. Identification of lToll will help to elucidate the Toll pathway in shrimp innate immunity. © 2006 Elsevier Ltd. All rights reserved. Keywords: Toll-like receptor; Shrimp; Innate immunity; Toll/interleukin-1 receptor

1. Introduction Aquaculture, including production of farmed fish, crustaceans and mollusks, represents one of the fastest growing food-producing sectors in the world. Penaeid shrimp culture has developed rapidly since 1970s, and has now become one of the large and flourishing fishery industries in China and Southern Asia. The white shrimp, Litopenaeus vannamei, which was introduced into China in 1988, has now become the primary farmed shrimp species throughout the world. The farmed production in China reached 420,000 metric tons in 2004. There is no doubt that the white shrimp culture has developed into a major aquaculture industry. With the rapid development of shrimp aquaculture, diseases have become a major constraint and the most limiting factor ∗

Corresponding author. Tel.: +1 816 235 6379; fax: +1 816 235 1503. Corresponding author. Tel.: +86 20 8411 0976; fax: +86 20 8411 3819. E-mail addresses: [email protected] (X.-Q. Yu), [email protected] (J.-G. He). 1 These authors contributed equally to this work. ∗∗

0161-5890/$ – see front matter © 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.molimm.2006.09.021

for the shrimp culture industry. Various bacteria, such as Pseudomonas and Aeromonas, have been reported to cause larval mortalities. Vibrio species have caused mass mortalities in different cultured shrimp larvae and juveniles such as Penaeus japonicus and L. stylirostris (Costa et al., 1998; Delapena et al., 1993, 1995; Hameed, 1995; Karunasagar et al., 1994; Robertson et al., 1998; Tansutapanit and Ruangpan, 1987; Vandenberghe et al., 1998). Within the past decade, viral diseases have emerged as serious economic impediments to successful shrimp farming in many of the shrimp-farming countries in the world. In Southeast Asia, the Indian continent, and South and Central America, white spot syndrome virus (WSSV), recognized in 1993, has become a significant pathogen of cultured shrimp. It causes up to 100% mortality within 7–10 days in commercial shrimp farms, resulting in large economic losses (Chou and Huang, 1995; He et al., 1996; Inouye et al., 1994; Lightner, 1996; Wang et al., 1995; Wongteerasupaya et al., 1996). At the same time in the western hemisphere, the viral agents of Taura syndrome (TS) and infectious hypodermal and hematopoietic necrosis (IHHN) have caused serious disease epizootics throughout the shrimpgrowing regions in America and Hawaii (Lightner et al., 1997).

2000

L.-S. Yang et al. / Molecular Immunology 44 (2007) 1999–2008

This situation indicates that there is an urgent need to explore every possible avenue for developing novel control strategies against the diseases. Host defense in shrimp is believed to rely largely on innate immunity (Loker et al., 2004). Innate immunity is a sensitive non-self recognizing system triggered by components of pathogens, called pathogen-associated molecular patterns (PAMPs), such as lipopolysaccharide (LPS), peptidoglycan, lipoteichoic acid, and non-methylated CpG DNA (Hoffmann et al., 1999; Soderhall and Cerenius, 1998). PAMPs are recognized by a set of germline-encoded receptors referred to as pattern-recognition receptors (PRRs). During the recent years, Tolls and Toll-like receptors (TLRs) have been recognized as major PRRs and they play an essential role in recognition of microbes during host defense (Akira et al., 2001, 2006; Lemaitre et al., 1996; Medzhitov et al., 1997). TLRs are evolutionarily conserved transmembrane glycoproteins characterized by an extracellular domain containing various numbers of leucinerich-repeat (LRR) motifs and a cytoplasmic signaling domain homologous to that of the interleukin 1 receptor (IL-1R), termed the Toll/IL-1R homology (TIR) domain (Bowie and O’Neill, 2000). Twelve TLRs have been identified in mammals (Akira et al., 2006). TLRs are capable of inducing antimicrobial responses through production of proinflammatory cytokines and chemokines, up-regulation of costimulatory molecules and activation of antigen presentation (Akira and Takeda, 2004; Akira et al., 2006). TLRs can be further divided into several subfamilies, and each subfamily recognizes related PAMPs: the subfamilies of TLR1, TLR2 and TLR6 recognizes lipids, whereas the highly related TLR7, TLR8 and TLR9 recognize nucleic acids (Akira et al., 2006). Toll is initially identified in Drosophila (named dToll) and it participates in pattern formation in embryogenesis (Anderson and Nussleinvolhard, 1984). Later, it was shown that dToll plays a critical role in antifungal and anti Gram-positive bacterial response of flies in the Toll pathway (Lemaitre et al., 1996; Rutschmann et al., 2002). Recently, the Toll pathway was also identified as a vital part of the Drosophila antiviral response (Zambon et al., 2005). Unlike mammalian TLRs, dToll does not function as a PRR. The ligand for dToll is Spaetzle, a cytokine-like molecule that is proteolytically produced through an up-stream event during immune responses. Binding of Spaetzle to dToll activates the downstream adaptors such as Tube, dMyD88 (myeloid differentiation primary-response protein 88) and the cytoplasmic serine kinase Pelle. Activation of Pelle promotes degradation of the ankyrin-repeat protein Cactus, which is a member of the I-␬B family. Once Cactus is degraded in response to a Toll-mediated signal, the Rel-type NF-␬B proteins, Dorsal and Dorsal-immune factor (Dif), are free to translocate to the nucleus where they regulate transcription of specific target genes (Belvin and Anderson, 1996; Lemaitre et al., 1996; Takeda et al., 2003). Flies possess other pathogen-specific pattern recognition receptors which account for discrimination of different microbes. In recent years, putative pattern recognition receptors have been implicated in the upstream events leading to activation of the Toll pathway and immune deficiency

(IMD) pathway: peptidoglycan recognition proteins (PGRP-SA and PGRP-SD) that recognize Gram-positive bacteria (Bischoff et al., 2004; Michel et al., 2001), and PGRP-LC and PGRPLE that recognize Gram-negative bacteria (Choe et al., 2002; Takehana et al., 2002, 2004). Compared with insects and mammals, shrimp defense mechanisms, including the Toll signaling system, are poorly understood. Nonetheless, interest in understanding shrimp immunity has increased because of its importance in the control of diseases. In recent years, expressions of some defense-related genes such as anti-LPS factor, lysozyme (Somboonwiwat et al., 2006) and antibacterial peptides (Destoumieux et al., 2000; Munoz et al., 2002) were reported to be regulated by bacterial inoculation. However, the mechanisms were not fully understood. In the last decade, some pattern-recognition protein genes have been cloned in penaeid shrimps. ␤-1,3-Glucan binding protein genes have been cloned from Penaeus monodon (Sritunyalucksana et al., 2002) and L. vannamei (Romo-Figueroa et al., 2004). LPS and ␤-1,3-glucan binding protein genes have been cloned from L. vannamei (Cheng et al., 2005) and L. stylirostris (Roux et al., 2002). Lectin genes have been cloned from P. monodon (Luo et al., 2006) and Litopenaeus schmitti (Cominetti et al., 2002). However, the Toll homolog in shrimp has not been reported so far. In this study, we report identification of a Toll receptor in L. vannamei. 2. Materials and methods 2.1. Shrimps Healthy white shrimps (weight 8–9 g, body length 8–10 cm) were obtained from Hengxing shrimp farm in Zhanjiang, Guangdong Province, China. They were kept in an indoor tank with sand filtering aerated sea water at 27 ◦ C, and fed with a commercial diet at 5% of the body weight per day for 7 days. Three shrimps were randomly selected, and hemolymph (0.5 ml) was collected individually from hemolymph sinus of each shrimp, then centrifuged at 2000 × g at 4 ◦ C for 5 min to remove the serum. The hemocytes were stored in TRIzol reagent (Invitrogen, USA). The shrimps were sacrificed and eyestalk, gill, brain, heart, hepatopancreas, stomach, intestine, nerve, muscle, pyloric caecum, spermary and epidermis were removed aseptically for dissection. The tissues from each shrimp were stored in RNAlater (Ambion, USA) at −20 ◦ C, and then transported to the laboratory. 2.2. Cloning of a partial Toll cDNA from L. vanaamei Two degenerated oligonucleotide primers (TIR-F and TIRR, Table 1) were designed based on the conserved amino acid sequence (CLHYRDW and EKLRY) of the lobster TIR domain (GenBank accession no. CN852754). Total RNA was extracted from the hepatopancreas using RNeasy Mini Kit (Qiagen, Germany) following the manufacturer’s instructions. Hepatopancreas cDNA was used as a template for reverse-transcription polymerase chain reaction (RT-PCR). PCR reactions were performed using primers TIR-F and TIR-R (Table 1), with 1 cycle of

L.-S. Yang et al. / Molecular Immunology 44 (2007) 1999–2008

2001

Table 1 PCR primers used for cloning of lToll cDNA and RT-PCR Primers

Primer sequences (5 –3 )

Product size (bp)

Amplification of the partial lToll cDNA TIR-F TIR-R

TGYCTYCACTAYCGYGACTGa GATGTANCGNAGCTTYTC

306

5 -RACE 5 -R1 5 -GeneRacer 5 -R1-nested 5 -GeneRacer nested

CGTAACTTCTCGTCCAACTCGCTCT CGACTGGAGCACGAGGACACTGA CACTTTGCAGGATCTGGTTCTGGATG GGACACTGACATGGACTGAAGGAGTA

3 -RACE 3 -F1 3 -GeneRacer 3 -F1-nested 3 -GeneRacer-nested

AGCGAGTTGGACGAGAAGTTACGA GCTGTCAACGATACGCTACGTAACG GAAGACCTACGTCAAGTGGGGAGA CGCTACGTAACGGCATGACAGTG

RT-PCR analysis TLR-F TLR-R ␤-Actin-F ␤-Actin-R

ATATCCCAGGGCTCCGATTT GTCCGACACGAAGTGAATGG GAAGTAGCCGCCCTGGTTG CGGTTAGCCTTGGGGTTGAG

a

614 338

Y = C or T; N = A, T, C or G.

denaturation at 94 ◦ C for 2 min, 30 cycles of 94 ◦ C for 30 s, 50 ◦ C for 30 s, and 72 ◦ C for 1 min, followed by a 8 min extension at 72 ◦ C. The PCR products were cloned into pGEM-T Easy vector (Promega, USA) and sequenced using BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Perkin-Elmer, USA) on an Applied Biosystems model 3730 automatic DNA sequencer in Invitrogen (Shanghai, China).

using Bootstrap N-J method of phylip 3.63 programs. Trees were output using the program Treeview 1.6.6 (Page, 1996). Simple modular architecture research tool (SMART, http://smart.emblheidelberg.de) (Schultz et al., 1998) was used to analyze the deduced amino acid sequence of lToll.

2.3. Rapid amplification of cDNA ends (RACE)

Total RNA was extracted from shrimp homocytes using TRIzol and from other tissues using RNeasy Mini Kit. Traces of genomic DNA were removed by incubation of total RNA with RNase-free DNaseI (Qiagen, Germany). One microgram of total RNA was reverse transcribed to cDNA using moloney murine leukemia virus (MMLV) reverse transcriptase (Promega, USA) with oligo(dT)18 as a primer following the manufacturer’s instructions. The lToll cDNA fragment was amplified using the primer pairs of TLR-F and TLR-R (Table 1) under the following conditions: pre-denaturation at 94 ◦ C for 2 min, 30 cycles of 94 ◦ C for 30 s, 55 ◦ C for 30 s, 72 ◦ C for 60 s, followed by elongation at 72 ◦ C for 8 min. The PCR product was sequenced to confirm the identity of lToll cDNA. As an internal loading control, the shrimp ␤-actin cDNA fragment was amplified with primers ␤-actin-F and ␤-actin-R (Table 1) using the same PCR conditions.

RACE was performed for L. vannamei Toll (lToll) using the GeneRacer Kit (Invitrogene, USA). Total RNA was extracted from the hepatopancreas of shrimp as described above. 5 -R1/5 GeneRacer and 3 -F1/3 -GeneRacer primers (Table 1) were used for the first round of 5 -end and 3 -end PCR, respectively. The PCR reactions were performed with denaturation at 94 ◦ C for 2 min, 5 cycles of 94 ◦ C for 30 s and 72 ◦ C for 3 min, 5 cycles of 94 ◦ C for 30 s and 70 ◦ C for 3 min, then 25 cycles of 94 ◦ C for 30 s, 60 ◦ C for 30 s, and 68 ◦ C for 3 min. With the firstround PCR products as templates, nested amplifications were carried out with 5 -R1-Nested/5 -GeneRacer-Nested and 3 -F1Nested/3 -GeneRacer-Nested primers (Table 1), respectively. Amplification conditions were as follows: denaturation at 94 ◦ C for 2 min, then 26 cycles of denaturation at 94 ◦ C for 1 min, annealing at 60 ◦ C for 30 s, and elongation at 68 ◦ C for 3 min, followed by a 10 min extension at 68 ◦ C. The PCR products were cloned into pGEM-T Easy vector and sequenced. 2.4. Alignments of sequences and construction of a phylogenetic tree Sequence alignments were performed using the ClusterX v1.83 program (Thompson et al., 1997). Bootstrap sampling was reiterated 1000 times. The phylogenetic tree was constructed

2.5. RT-PCR analysis

3. Results 3.1. Nucleotide and deduced amino acid sequences of L. vannamei Toll Through PCR amplification with degenerated primers and RACE, a full length cDNA of L. vannamei Toll (lToll) was obtained. lToll cDNA is 3456 bp long, with an open reading frame of 2781 bp, which encodes a putative protein of 926

2002

L.-S. Yang et al. / Molecular Immunology 44 (2007) 1999–2008

Fig. 1. Nucleotide sequence and deduced amino acid sequence of lToll from L. vannamei. Amino acid sequence is shown with one-letter codes below the nucleotide sequence. The initiation codon (ATG) and the stop codon (TAA) are highlighted in bold. The predicted signal peptide is shown in italic type. The potential N-linked glycosylation sites in the extracellular domain are shown in box. The predicted cysteine-rich motifs are shaded in gray, in which the characteristic cysteine residues are double underlined. The transmembrane region and the TIR domain are shown by dotted line and underline, respectively.

L.-S. Yang et al. / Molecular Immunology 44 (2007) 1999–2008

2003

a single pass transmembrane segment (residues 708–730) and an intracellular TIR domain (residues 761–898). A signal peptide of 19 amino acids was predicted by the SignalP program (http://www.cbs.dtu.dk/services/SignalP/) (Nielsen et al., 1997). Thirteen potential N-linked glycosylation sites were predicted by the SCAN PROSITE program (www.expasy.ch/prosite/, Fig. 1). Using the prevailing LRR consensus sequence in TLRs [50], 16 LRRs flanked by characteristic cysteine-rich motifs were identified in lToll (Fig. 3). In the LRRs of lToll, an invariant asparagine residue was identified at position 10, while highly conserved leucine residues were found at positions 2, 5 and 7 of each LRR. In addition, an insertion of seven residues was identified in LRR-10. 3.2. Analysis of lToll and comparison of lToll with other known Tolls/TLRs

Fig. 2. Schematic diagram of Tolls and TLRs. The ectodomain of Tolls/TLRs usually consists of leucine-rich repeats (LRRs), flanked by C-terminal (LRR-CT) and N-terminal (LRR-NT) cysteine-rich motifs. The other types of cysteine-rich motifs are presented as solid circles. lToll has a similar domain architecture to AmToll, TcToll, dToll and tToll.

amino acids (Fig. 1). The deduced amino acid sequence of lToll has a typical organization that is characteristic of Toll proteins (Fig. 2): an extracellular domain (residues 134–642) composed of leucine rich repeats (LRRs) flanked by cysteine-rich motifs,

Comparison of the lToll TIR domain with other known TIRs showed that lToll is most similar to Apis mellifer Toll (59.9% identity), followed by Aedes aegypti AeToll (55.8%), Tribolium castaneum TcToll (55.6%), and Drosophila melanogaster dToll (54.3%) (Fig. 4). However, the TIR domain of lToll shares low similarity to TLR3 of chicken (28.4%), zebrafish (28.7%), human (28.7%), and TLR2.1 of urchin (28.8%). In the TIR domain of mouse TLR4, a mutation (P712H) causes the loss of TLR4 function (Poltorak et al., 1998). The alignment results showed that this proline residue is conserved in most vertebrate TLRs. There is also proline at the same position of lToll reported in this paper. The same proline was found in A. aegypti AeToll and T. castaneum TcToll. However, the proline residue is not conserved in Tolls from A. mellifer, D. melanogaster, Caenorhabditis elegan, Euprymna scolopes and Tachypleus tridentatus (Fig. 4). A phylogenetic tree based on the full length sequences of known TLRs was constructed, and the results showed that TLRs can be divided into several groups (Fig. 5). lToll is placed in a

Fig. 3. Alignment of leucine-rich repeats (LRRs) in lToll. LRRs of lToll are aligned with the 24-residue prevailing LRR consensus sequence of TLRs (Bell et al., 2003). X refers to any amino acid, φ is any hydrophobic residue, and L and F are frequently replaced by other hydrophobic residues. Residues that are conserved to the consensus sequence are shaded in grey.

2004

L.-S. Yang et al. / Molecular Immunology 44 (2007) 1999–2008

Fig. 4. Alignment of the lToll TIR domain with other TIRs. The TIR of lToll and TIRs of Tolls/TLRs from different organisms are aligned using ClusterX v1.83. Identical or highly conserved residues are shaded in black, while similar residues are shaded in grey. The proline residue, which is critical to mouse TLR4 function, is indicated by an asterisk. The consensus residues are presented at the bottom of the sequences. Sequences for the alignment are obtained from GenBank: AeToll (EAT40676), AmToll (XP 396158), cToll1 (AAK37544), dToll (AAQ64935), d18w (AAF57509), dToll3 (AAF54021), dToll4 (AAF52747), dToll5 (AAF86227), dToll6 (AAF49645), dToll7 (AAF57514), dToll8 (AAF49650), dToll9 (AAF51581), EsTLR (AAY27971), SpToll 1.1 (AAK25761), SpToll 1.2 (AAK25762), SpToll 2.1 (AAK21261), TcToll (XP 967796), tToll (BAD12073), zTLR2 (AAQ90474), zTLR3 (AAI07956), zTLR4b (AAH68358), chTLR1 (CAG32465), chTLR2 (BAB16113), chTLR3 (ABG79022), chTLR5 (AAY21236), chTLR7 (CAG32163), chTLR15 (ABB71177), hTLR1 (AAI09095), hTLR2 (AAC34133), hTLR3 (AAH96335), hTLR4 (AAI17423), hTLR5 (BAB43955), hTLR6 (BAA7863), hTLR7 (AAF60188), hTLR8 (AAF78036), hTLR9 (AAH32713), hTLR10 (AAK26744). Abbreviations: Ae, Aedes aegypti; Am, Apis mellifera; c, Caenorhabditis elegans; d, Drosophila melanogaster; Es, Euprymna scolopes; Sp, Strongylocentrotus purpuratus; Tc, Tribolium castaneum; t, Tachypleus tridentatus; z, Danio rerio; ch, Gallus gallus; h, Homo sapiens.

L.-S. Yang et al. / Molecular Immunology 44 (2007) 1999–2008

2005

Fig. 5. A phylogenetic tree of TLRs. The full length amino acid sequences of TLRs from different organisms are aligned using the ClusterX v1.83 program (Thompson et al., 1997). The phylogenetic tree was constructed using Bootstrap N-J method of phylip 3.63 programs and the tree was output using the program Treeview 1.6.6 (Page, 1996). Amino acid sequences are obtained from the GenBank as described in Fig. 4 legend.

group that includes AmToll from A. mellifer, TcToll from T. castaneum, dToll from D. melanogasterin and AeToll from A. aegypti. In the mean time, this group is close to a group containing dToll3, dToll4 and dToll5 from Drosophila. However, dToll6, dToll7 and dToll8 from D. melanogasterin, EsToll from E. scolopes and cToll1 from C. elegan are placed in another group. All the invertebrate Tolls, except dToll9 and Strongylocentrotus purpuratus Tolls, form a large cluster, which is far from the vertebrate Tolls. 3.3. Expression of lToll in different tissues Tissue expression profile of lToll was analyzed by RT-PCR. Expression of lToll was observed in hemocyte, gill, brain, heart, stomach, intestine, nerve, muscle, pyloric caecum, spermary and

epidermis (Fig. 6). An apparently lower expression level of lToll was also observed in eyestalk and hepatopancreas. 4. Discussion Toll and TLRs are conserved receptors critical in innate immunity and inflammation response in insects and mammals (Akira et al., 2006). TLRs have been identified from different animals, such as C. elegans (Pujol et al., 2001), S. purpuratus (GenBank accession no. AAK25761), E. scolopes (GenBank accession no. AAY27971), insects (Luna et al., 2003; Naitza and Ligoxygakis, 2004), T. tridentatus (Inamori et al., 2004), fishes (Meijer et al., 2004), chickens (Fuku et al., 2001), and mammals (Akira et al., 2006). However, no Toll homolog has been identified in shrimp so far. In this study, we cloned and char-

Fig. 6. Expression of lToll in different tissues. Expression profile of lToll in different tissues was analyzed by RT-PCR. ␤-Actin cDNA fragment amplified from the same RNA samples was used as an internal loading control. DNA markers (M), hemocyte (lane 1), eyestalk (lane 2), gill (lane 3), brain (lane 4), heart (lane 5), hepatopancreas (lane 6), stomach (lane 7), intestine (lane 8), nerve (lane 9), muscle (lane 10), pyloric caecum (lane 11), spermary (lane 12) and epidermis (lane 13).

2006

L.-S. Yang et al. / Molecular Immunology 44 (2007) 1999–2008

acterized a Toll homolog from the white shrimp L. vannamei and designated it as lToll after the genus Litopenaeus. lToll contains characteristic domains of Toll proteins: an extracellular domain composed of LRRs flanked by cysteinerich motifs and an intracellular TIR domain (Takeuchi and Akira, 2001). lToll shows high similarity with Tolls from A. mellifera, T. castaneum, D. melanogasterin and A. aegypti in both the overall amino acid sequences and the domain architecture. Both D. melanogaster Toll (dToll) and A. aegypti Toll (AeToll) were reported to activate transcription of drosomycin promoter in Aedes and Drosophila cells (Luna et al., 2003; Tauszig et al., 2000). Therefore, it is possible that lToll is also involved in regulating synthesis of proteins related to innate immunity of shrimp. Mammalian TLRs can recognize distinct PAMPs (Akira et al., 2006). It was proposed that the LRRs may form a horseshoeshape structure with the ligand binding to the concave surface (Bell et al., 2003). Furthermore, LRRs in human TLRs contain large insertions in the position-10 or -15, and these insertions were suggested to be involved in interaction with PAMPs (Bell et al., 2003). However, no insertion in LRRs is identified in dToll, and dToll does not function as a PRR but interacts with a cytokine-like ligand spaetzle (Levashina et al., 1999). Similarly, T. tridentatus tToll does not possess any insertion in LRRs, and it was suggested that tToll may not directly recognize any PAMP (Inamori et al., 2004). In lToll LRRs, a 7-residue insertion was identified in LRR-10. What the ligand of lToll is will be answered by further experiments. The TIR domain is an evolutionarily ancient protein–protein interaction domain that occurs in a large group of host defense associated proteins from diverse species, including vertebrates, invertebrates and plants (Jebanathirajah et al., 2002). In the human genome, TIR-domain containing proteins comprise members of the TLR family, members of the IL-1/IL-18 receptor group, and cytosolic proteins that function as adaptor proteins connecting the Toll-like or interleukin receptors with the downstream signaling pathways (O’Neill et al., 2003). When the cells are stimulated with a TLR ligand, adaptor proteins, such as myeloid differentiation factor 88 (MyD88), are recruited to the cytoplasmic portion of the TLRs through homophilic interaction of their TIR domains. This results in triggering of the downstream signaling cascades and production of proinflammatory cytokines and chemokines (Akira et al., 2006). A mutation in the TIR domain of mouse TLR4 (P712H) leads to the loss of function and confers resistance to LPS (Poltorak et al., 1998). Similar mutations in A. aegypti AeToll1A (P931H or P931K) and a deletion mutant (931) also caused a loss of function (Luna et al., 2003). Alignment of the TIR domains revealed that this proline residue is conserved in Tolls of A. aegypti, T. castaneum, mammals, and L. vannemei of this study. However, the corresponding position in Drosophila Toll (dToll) is a valine residue, and mutation of proline to valine (P931V) in AeToll-1A did not result in a loss of function (Luna et al., 2003). These results indicate that substitution of the proline with a valine in the TIR domain has a little effect on Tolls/TLRs to transduce signals. lToll was expressed in many tissues including hemocyte, gill, heart, brain, stomach, intestine, pyloric caecum, muscle, nerve,

spermary and epidermis, with a lower expression level in the eyestalk and hepatopancreas. Non-specific expression of lToll in tissues is similar to the expression profile of tToll from T. tridentatus (Inamori et al., 2004). In Drosophila, dToll was shown to play a critical role in innate immune responses against fungal and bacterial infections (Lemaitre et al., 1996; Rutschmann et al., 2002). The Toll pathway controls induction of antimicrobial peptides and a substantial number of other innate immune responsive genes through an intracellular signaling cascade resulting in the nuclear translocation of two NF-␬B related transcriptional regulators, Dorsal and Dif (De Gregorio et al., 2002). In the meantime, the Toll pathway is also a vital part of Drosophila antiviral response, and it is required specifically for inhibition of Drosophila X virus replication and spread during infection. It was suggested that the Toll-mediated antivirus response is a cellular response, maybe mediated through hemocytes, which are effectors of the cellular immune response (Qiu et al., 1998). Hemocytes play a critical role in immune responses such as phagocytosis and may transduce signaling to the fat body. In the shrimp culture industry, virus diseases are the most important threat. Future work is to investigate whether lToll plays a role in the shrimp antivirus immunity. Acknowledgements This research was supported by National Natural Science Foundation of China under grant no. 30325035, National Basic Research Program of China under grant no. 2006CB101802, Guangdong Province Natural Science Foundation under grant no. 20023002, and Foundation from Science and Technology Bureau of Guangdong Province. The nucleotide sequence of lToll has been submitted to NCBI database and GenBank accession number is DQ923424. References Akira, S., Takeda, K., 2004. Toll-like receptor signalling. Nat. Rev. Immunol. 4, 499–511. Akira, S., Takeda, K., Kaisho, T., 2001. Toll-like receptors: critical proteins linking innate and acquired immunity. Nat. Immunol. 2, 675–680. Akira, S., Uematsu, S., Takeuchi, O., 2006. Pathogen recognition and innate immunity. Cell 124, 783–801. Anderson, K.V., Nussleinvolhard, C., 1984. Information for the Dorsal ventral pattern of the Drosophila embryo is stored as maternal messenger-Rna. Nature 311, 223–227. Bell, J.K., Mullen, G.E.D., Leifer, C.A., Mazzoni, A., Davies, D.R., Segal, D.M., 2003. Leucine-rich repeats and pathogen recognition in Toll-like receptors. Trends Immunol. 24, 528–533. Belvin, M.P., Anderson, K.V., 1996. A conserved signaling pathway: the Drosophila Toll-Dorsal pathway. Annu. Rev. Cell. Dev. Biol. 12, 393–416. Bischoff, V., Vignal, C., Boneca, I.G., Michel, T., Hoffmann, J.A., Royet, J., 2004. Function of the Drosophila pattern-recognition receptor PGRP-SD in the detection of Gram-positive bacteria. Nat. Immunol. 5, 1175–1180. Bowie, A., O’Neill, L.A.J., 2000. The interleukin-1 receptor/Toll-like receptor superfamily: signal generators for pro-inflammatory interleukins and microbial products. J. Leukoc. Biol. 67, 508–514. Cheng, W.T., Liu, C.H., Tsai, C.H., Chen, J.C., 2005. Molecular cloning and characterisation of a pattern recognition molecule, lipopolysaccharide- and beta-1,3-glucan binding protein (LGBP) from the white shrimp Litopenaeus vannamei. Fish Shellfish Immunol. 18, 297–310.

L.-S. Yang et al. / Molecular Immunology 44 (2007) 1999–2008 Choe, K.M., Werner, T., Stoven, S., Hultmark, D., Anderson, K.V., 2002. Requirement for a peptidoglycan recognition protein (PGRP) in relish activation and antibacterial immune responses in Drosophila. Science 296, 359–362. Chou, H., Huang, C., 1995. Pathogenicity of a baculovirus infection causing white spot syndrome in cultured penaeid shrimp in Taiwan. Dis. Aqua. Organ. 23, 165–173. Cominetti, M.R., Marques, M.R.F., Lorenzini, D.M., Lofgren, S.E., Daffre, S., Barracco, M.A., 2002. Characterization and partial purification of a lectin from the hemolymph of the white shrimp Litopenaeus schmitti. Dev. Comp. Immunol. 26, 715–721. Costa, R., Mermoud, I., Koblavi, S., Morlet, B., Haffner, P., Berthe, F., Legroumellec, M., Grimont, P., 1998. Isolation and characterization of bacteria associated with a Penaeus stylirostris disease (Syndrome 93) in New Caledonia. Aquaculture 164, 297–309. De Gregorio, E., Spellman, P.T., Tzou, P., Rubin, G.M., Lemaitre, B., 2002. The Toll and Imd pathways are the major regulators of the immune response in Drosophila. EMBO J. 21, 2568–2579. Delapena, L.D., Nakai, T., Muroga, K., 1995. Dynamics of Vibrio sp. Pj in Organs of Orally Infected Kuruma Prawn, Penaeus-Japonicus. Fish Pathol. 30, 39–45. Delapena, L.D., Tamaki, T., Momoyama, K., Nakai, T., Muroga, K., 1993. Characteristics of the Causative Bacterium of Vibriosis in the Kuruma Prawn, Penaeus-Japonicus. Aquaculture 115, 1–12. Destoumieux, D., Munoz, M., Cosseau, C., Rodriguez, J., Bulet, P., Comps, M., Bachere, E., 2000. Penaeidins, antimicrobial peptides with chitin-binding activity, are produced and stored in shrimp granulocytes and released after microbial challenge. J. Cell Sci. 113, 461–469. Fuku, A., Inoue, N., Matsumoto, M., Nomura, M., Yamada, K., Matsuda, Y., Toyoshima, K., Seya, T., 2001. Molecular cloning and functional characterization of chicken Toll-like receptors—a single chicken Toll covers multiple molecular patterns. J. Biol. Chem. 276, 47143–47149. Hameed, A.S.S., 1995. Susceptibility of three Penaeus species to a Vibrio campbellii-like Bacterium. J. World Aqua. Soc. 26, 315–318. He, J., Deng, M., Long, Q., Wu, B., 1996. Construction and application of methods of PCR and DNA probe for MBV. J. Sun Yatsen Univ. Suppl., 158–163. Hoffmann, J.A., Kafatos, F.C., Janeway, C.A., Ezekowitz, R.A.B., 1999. Phylogenetic perspectives in innate immunity. Science 284, 1313–1318. Inamori, K., Ariki, S., Kawabata, S., 2004. A Toll-like receptor in horseshoe crabs. Immunol. Rev. 198, 106–115. Inouye, K., Miwa, S., Oseko, N., Nakano, K., Kimura, T., 1994. Mass mortality of cultured kuruma shrimp Penaeus japonicus in Japan in 1993: electron microscopic evidence of the causative virus. Fish pathol. 29, 149– 158. Jebanathirajah, J.A., Peri, S., Pandey, A., 2002. Toll and interleukin-1 receptor (TIR) domain-containing proteins in plants: a genomic perspective. Trends Plant Sci. 7, 388–391. Karunasagar, I., Pai, R., Malathi, G.R., Karunasagar, I., 1994. Mass mortality of Penaeus monodon larvae due to antibiotic-resistant Vibrio-Harveyi infection. Aquaculture 128, 203–209. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.M., Hoffmann, J.A., 1996. The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973–983. Levashina, E.A., Langley, E., Green, C., Gubb, D., Ashburner, M., Hoffmann, J.A., Reichhart, J.M., 1999. Constitutive activation of Toll-mediated antifungal defense in serpin-deficient Drosophila. Science 285, 1917– 1919. Lightner, D.V., 1996. Epizootiology, distribution and the impact on international trade of two penaeid shrimp viruses in the Americas. Rev. Sci. Tech. 15, 579–601. Lightner, D.V., Redman, R.M., Poulos, B.T., Nunan, L.M., Mari, J.L., Hasson, K.W., 1997. Risk of spread of penaeid shrimp viruses in the Americas by the international movement of liver and frozen shrimp. Rev. Sci. Tech. 16, 146–160. Loker, E.S., Adema, C.M., Zhang, S.M., Kepler, T.B., 2004. Invertebrate immune systems—not homogeneous, not simple, not well understood. Immunol. Rev. 198, 10–24.

2007

Luna, C., Hoa, N.T., Zhang, J., Kanzok, S.M., Brown, S.E., Imler, J.L., Knudson, D.L., Zheng, L.B., 2003. Characterization of three Toll-like genes from mosquito Aedes aegypti. Insect Mol. Biol. 12, 67–74. Luo, T., Yang, H.J., Li, F., Zhang, X.B., Xu, X., 2006. Purification, characterization and cDNA cloning of a novel lipopolysaccharide-binding lectin from the shrimp Penaeus monodon. Dev. Comp. Immunol. 30, 607–617. Medzhitov, R., PrestonHurlburt, P., Janeway, C.A., 1997. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388, 394–397. Meijer, A.H., Krens, S.F.G., Rodriguez, I.A.M., He, S.N., Bitter, W., SnaarJagalska, B.E., Spaink, H.P., 2004. Expression analysis of the Toll-like receptor and TIR domain adaptor families of zebrafish. Mol. Immunol. 40, 773–783. Michel, T., Reichhart, J.M., Hoffmann, J.A., Royet, J., 2001. Drosophila Toll is activated by Gram-positive bacteria through a circulating peptidoglycan recognition protein. Nature 414, 756–759. Munoz, M., Vandenbulcke, F., Saulnier, D., Bachere, E., 2002. Expression and distribution of penaeidin antimicrobial peptides are regulated by haemocyte reactions in microbial challenged shrimp. Eur. J. Biochem. 269, 2678–2689. Naitza, S., Ligoxygakis, P., 2004. Antimicrobial defences in Drosophila: the story so far. Mol. Immunol. 40, 887–896. Nielsen, H., Engelbrecht, J., Brunak, S., vonHeijne, G., 1997. Identification of prokaryotic and eukaryotic signal peptides and prediction of their cleavage sites. Protein Eng. 10, 1–6. O’Neill, L.A., Fitzgerald, K.A., Bowie, A.G., 2003. The Toll-IL-1 receptor adaptor family grows to five members. Trends Immunol. 24, 286–290. Page, R.D., 1996. TreeView: an application to display phylogenetic trees on personal computers. Comput. Appl. Biosci. 12, 357–358. Poltorak, A., He, X., Smirnova, I., Liu, M.Y., Van Huffel, C., Du, X., Birdwell, D., Alejos, E., Silva, M., Galanos, C., Freudenberg, M., Ricciardi-Castagnoli, P., Layton, B., Beutler, B., 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282, 2085– 2088. Pujol, N., Link, E.M., Liu, L.X., Kurz, C.L., Alloing, G., Tan, M.W., Ray, K.P., Solari, R., Johnson, C.D., Ewbank, J.J., 2001. Reverse genetic analysis of components of the Toll signaling pathway in Caenorhabditis elegans. Curr. Biol. 11, 809–821. Qiu, P., Pan, P.C., Govind, S., 1998. A role for the Drosophila Toll/Cactus pathway in larval hematopoiesis. Development 125, 1909–1920. Robertson, P.A.W., Calderon, J., Carrera, L., Stark, J.R., Zherdmant, M., Austin, B., 1998. Experimental Vibrio harveyi infections in Penaeus vannamei larvae. Dis. Aqua. Organ. 32, 151–155. Romo-Figueroa, M.G., Vargas-Requena, C., Sotelo-Mundoa, R.R., VargasAlbores, F., Higuera-Ciapara, I., Soderhall, K., Yepiz-Plascencia, G., 2004. Molecular cloning of a beta-glucan pattern-recognition lipoprotein from the white shrimp Penaeus (Litopenaeus) vannamei: correlations between the deduced amino acid sequence and the native protein structure. Dev. Comp. Immunol. 28, 713–726. Roux, M.M., Pain, A., Klimpel, K.R., Dhar, A.K., 2002. The lipopolysaccharide and beta-1,3-glucan binding protein gene is upregulated in white spot virusinfected shrimp (Penaeus stylirostris). J. Virol. 76, 7140–7149. Rutschmann, S., Kilinc, A., Ferrandon, D., 2002. Cutting edge: the Toll pathway is required for resistance to Gram-positive bacterial infections in Drosophila. J. Immunol. 168, 1542–1546. Schultz, J., Milpetz, F., Bork, P., Ponting, C.P., 1998. SMART, a simple modular architecture research tool: identification of signaling domains. Proc. Natl. Acad. Sci. U.S.A. 95, 5857–5864. Soderhall, K., Cerenius, L., 1998. Role of the prophenoloxidase-activating system in invertebrate immunity. Curr. Opin. Immunol. 10, 23–28. Somboonwiwat, K., Supungul, P., Rimphanitchayakit, V., Aoki, T., Hirono, I., Tassanakajon, A., 2006. Differentially expressed genes in hemocytes of Vibrio harveyi-challenged shrimp Penaeus monodon. J. Biochem. Mol. Biol. 39, 26–36. Sritunyalucksana, K., Lee, S.Y., Soderhall, K., 2002. A beta-1,3-glucan binding protein from the black tiger shrimp, Penaeus monodon. Dev. Comp. Immunol. 26, 237–245. Takeda, K., Kaisho, T., Akira, S., 2003. Toll-like receptors. Annu. Rev. Immunol. 21, 335–376.

2008

L.-S. Yang et al. / Molecular Immunology 44 (2007) 1999–2008

Takehana, A., Katsuyama, T., Yano, T., Oshima, Y., Takada, H., Aigaki, T., Kurata, S., 2002. Overexpression of a pattern-recognition receptor, peptidoglycan-recognition protein-LE, activates imd/relish-mediated antibacterial defense and the prophenoloxidase cascade in Drosophila larvae. Proc. Natl. Acad. Sci. U.S.A. 99, 13705–13710. Takehana, A., Yano, T., Mita, S., Kotani, A., Oshima, Y., Kurata, S., 2004. Peptidoglycan recognition protein (PGRP)-LE and PGRP-LC act synergistically in Drosophila immunity. EMBO J. 23, 4690–4700. Takeuchi, O., Akira, S., 2001. Toll-like receptors; their physiological role and signal transduction system. Int. Immunopharmacol. 1, 625–635. Tansutapanit, D.S.O.A., Ruangpan, L., 1987. Vibrio harveyi, a causative agent of mortality in white shrimp nauplii, Penaeus merguiensis. Abstract. Tech. Paper no. 6/30. In Third National Seminar of Marine Science, NSRC, Bangkok, Thailand. Tauszig, S., Jouanguy, E., Hoffmann, J.A., Imler, J.L., 2000. Toll-related receptors and the control of antimicrobial peptide expression in Drosophila. Proc. Natl. Acad. Sci. U.S.A. 97, 10520–10525. Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. The CLUSTAL X windows interface: flexible strategies for multi-

ple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882. Vandenberghe, J., Li, Y., Verdonck, L., Li, J., Sorgeloos, P., Xu, H.S., Swings, J., 1998. Vibrios associated with Penaeus chinensis (Crustacea: Decapoda) larvae in Chinese shrimp hatcheries. Aquaculture 169, 121– 132. Wang, C., Lo, C., Leu, J., Chou, C., Yeh, P., Chou, H., Tung, M., Chang, C., Su, M., Kou, G., 1995. Purification and genomic analysis of baculovirus associated with white spot syndrome (WSBV) of Penaeus monodon. Dis. Aqua. Organ. 23, 239–242. Wongteerasupaya, C., Wongsisansri, S., Boonsaeng, V., Panyim, S., Pratanpipat, P., Nash, G., Withyachumnarnkul, B., Flegel, T., 1996. DNA fragment of Penaeus monodon baculo-virus PmNOB II gives positive in situ hybridization with white-spot viral infections in six penaeid shrimp species. Aquaculture 143, 23–32. Zambon, R.A., Nandakumar, M., Vakharia, V.N., Wu, L.P., 2005. The Toll pathway is important for an antiviral response in Drosophila. Proc. Natl. Acad. Sci. U.S.A. 102, 7257–7262.