A toxin-like gene in rainbow trout: Cloning, expression, and gene organization

ARTICLE IN PRESS

Toxicon 49 (2007) 1002–1009 www.elsevier.com/locate/toxicon

A toxin-like gene in rainbow trout: Cloning, expression, and gene organization Eleftheria Georgakaa,b, Vassilios Nastopoulosb, Sofia Eleftherioua, Ioannis K. Zarkadisa, a

Department of Biology, School of Medicine, University of Patras, Rion 26500 Patras, Greece b Department of Chemistry, University of Patras, Rion 26500 Patras, Greece

Received 26 September 2006; received in revised form 24 January 2007; accepted 25 January 2007 Available online 12 February 2007

Abstract The ‘three-finger’ protein family consists of structurally related proteins which display a variety of biological functions. Snake venom a-neurotoxins, Ly-6 alloantigens, urokinase-type plasminogen activator receptor (uPAR) and the complement regulatory protein CD59 are members of this protein family. Their characteristic feature is the disposition of four disulfide bridges forming a hydrophobic core. Here it is reported the cloning and characterization of a toxin-like gene (toxin-1) in the rainbow trout (Oncorhynchus mykiss). Phylogenetic analysis showed that trout toxin-1 classified into the short-chain neurotoxins (60–65 residues), confining to a distinct group. Trout toxin-1 gene contains three exons interrupted by two introns, in line with the other toxin members of the ‘three-finger’ family. Trout liver, brain, and spleen express the toxin-1 gene and its encoded protein is identified in trout plasma. This is the first report of a toxin-like gene which has been described so far in teleost. r 2007 Elsevier Ltd. All rights reserved. Keywords: Ly-6 family; Cloning; Rainbow trout; Gene organization; Phylogenetic analysis; Toxin-1

1. Introduction The members of the ‘three-finger’ protein family share a similar three-dimensional structure defined by a distinct disulfide bonding pattern between 8 or 10 cysteine residues (Endo and Tamiya, 1991) and they display a great variety of biological functions (Tsetlin, 1999). The characteristic feature of all ‘three-finger’ proteins is the disposition of four or five disulfide bridges forming a hydrophobic core. Corresponding author. Tel.: +30 2610 997621; fax: +30 2610 991769. E-mail address: [email protected] (I.K. Zarkadis).

0041-0101/$ - see front matter r 2007 Elsevier Ltd. All rights reserved. doi:10.1016/j.toxicon.2007.01.012

From this core protrude three disulfide-confined loops I, II and III (Tsetlin, 1999; Hatanaka et al., 1994). Although the overall sequence homology between the members of the family is relatively poor, the crucial 8 cysteine residues are highly conserved. Moreover, all family members share the consensus sequence motif -CCXXXXCN- at the C-terminal end (He et al., 2004). Snake venom a-neurotoxins, Ly-6 alloantigens, urokinase-type plasminogen activator receptor (uPAR) and the complement regulatory protein CD59 are members of this superfamily (Chang et al., 2002a; Gumley et al., 1995; Ploug and Ellis, 1994; Kieffer et al., 1994). Most of the Ly-6 proteins

ARTICLE IN PRESS E. Georgaka et al. / Toxicon 49 (2007) 1002–1009

seem to have non-toxic function, while the vast majority of the secreted three-finger proteins are abundant in the venoms of elapid and hydrophiid snakes performing highly toxic functions. Another small group of proteins similar to cardiotoxins and short-chain neurotoxins, in terms of their chain length and cysteine deposition, are the xenoxins (Kolbe et al., 1993). The presence of two more cysteine residues forming an additional disulfide bond at the tip of loop I in proteins such as Ly-6 and the so called ‘weak’ toxins, does not destroy the kinship (Shafqat et al., 1991). Although the presence of b-sheet is the dominant secondary feature among three-finger proteins an a-helix segment in loop III of the CD59 brings about no notable differences in the three-finger conformation (Kiffer et al., 1994). Based on differences in their polypeptide length and number of disulfide bridges, the a-neurotoxins could be further categorized into two classes: the short-chain toxins, consisting of 60–65 residues (four disulfide bonds), and the long-chain toxins, consisting of 70–75 residues (five disulfide bonds) (Nirthanan and Gwee, 2004). An evolutionary relationship between the two subfamilies has been proposed based on the conservation of intron–exon boundaries in the coding portions of these genes. Most of them seem to have a conserved intron dividing the signal sequence into two exons and another intron interrupting the mature polypeptide between the third and fourth conserved cysteine residues. (Chang et al., 2002b, 2004). An extra intron inside the 50 UTR is present in some Ly-6 genes (Gumley et al., 1995). To date the X-ray and NMR solution structures have been elucidated for many peptides and protein neurotoxins. Here, it is reported the cDNA cloning, gene organization, tissue expression profile, and phylogenetic analysis of a toxin-like gene from rainbow trout. Moreover, the toxin-1 protein is identified in the trout plasma and the recombinant protein has been expressed in bacteria.

2. Materials and methods 2.1. Chemicals The following reagents were obtained from the indicated sources: restriction enzymes from New England Biolabs Inc. (Beverly, MA) and Minotech (Crete, Greece), RNA isolation kit from Promega, RT-PCR kit from Finnzymes, T/A cloning kit from

1003

Promega, and nylon membrane Zeta-Probe from Biorad (Hercules, CA). 2.2. Cloning of trout toxin-1 2.2.1. RNA isolation and cDNA library construction Trout liver cDNA library was prepared from total RNA extracted from a single trout liver as previously described (Zarkadis et al., 2001). 2.2.2. Screening of liver trout cDNA library After screening of a trout liver lgt11 cDNA library under low stringency conditions some positive phage clones were isolated, using as probe a cDNA fragment of the trout CD59-2 (accession number AJ880383). One of those was the full-length cDNA of a toxin-like gene. The recombinant phage DNA was isolated, and the insert cDNA, 482 bp in size, was subcloned into pGEM-T easy vector and sequenced. 2.3. PCR amplification of trout toxin-1 gene The presence of introns in the coding area of the mature protein, was investigated by a PCR reaction, using as template trout genomic DNA (1 mg). Primers were designed according to the 50 and 30 end of the mature protein coding fragment: TtoxF2: 50 -GACTACAACATTGAATGTTAC-30 and TtoxR1: 50 -GGCATTGCAGCGGTC CTCAT-30 . These primers were subsequently applied in a PCR reaction using the Promega PCR kit. The program was as follows: 95 1C for 5 min, 30 cycles of 95 1C for 1 min, 52 1C for 1 min and 72 1C for 1 min, followed by a final extension at 72 1C for 10 min. The PCR products were subjected to electrophoresis on a 1% agarose gel, purified using the QIA quick gel extraction kit and sequenced. 2.4. Sequencing of trout toxin-1 DNA sequence analysis of the trout toxin-1 cDNA and genomic clones were performed by the dideoxy chain method (Amersham Sequenase kit) using the Vistra Sequencer 725 (Applied Biosystems). All sequences were determined at least twice for both strands. 2.5. Database search/multiple sequence alignment/ phylogenetic analysis Analysis and assembly of data derived from DNA sequencing was performed with the Gene Tool Lite

ARTICLE IN PRESS 1004

E. Georgaka et al. / Toxicon 49 (2007) 1002–1009

software. Basic Local Alignment Search Tool (BLAST, www.ncbi.nlm.nih.gov/blast) (Altschul et al., 1990) was employed for GenBank search, identity/similarity assessment and protein domain determination and characterization. Deduced amino acid sequences were obtained from EMBL and GenBank databases. Amino acid multiple alignments were generated using the Clustal W program (Thompson et al., 1994) within MEGA version 3 (Kumar et al., 2004). Phylogenetic tree was constructed based on the deduced amino acid sequences of three-finger family proteins using the neighborjoining (NJ) algorithm (Saitou and Nei, 1987) within MEGA version 3 (Kumar et al., 2004). The phylogenetic tree was constructed using the Poisson correction and branch points were validated by 1000 bootstrap replications. All other conditions were set as ‘‘default’’. Image analysis was carried out with Kodak Digital Science (Electrophoresis Documentation and Analysis System 120). 2.6. Southern blot analysis Genomic DNA was extracted from trout liver and (12) 12 mg were digested at 37 1C overnight with the restriction enzymes BamHI, EcoRI or HindIII. Restricted DNA was analyzed by electrophoresis on 0.8% agarose gel and transferred onto a nylon membrane (Zeta Probe Bio Rad). Transferred DNA was prehybridized at 65 1C for 30 min and then hybridized with a 230 bp (a-32P)—radiolabeled DNA probe at 65 1C for 16 h. The probe was generated by PCR, using the primers TtoxF1: 50 -ATGAGAG CCTACCTGGTCCTG-30 and TtoxR1: 50 -GGCATTGCAGCGGTCCTCAT-30 which span from 53 to 280 nucleotides of the trout toxin-1 cDNA sequence, and labeled using the random primed DNA labeling kit (Boehringer Mannheim). The above primers are found in different exons of the trout toxin-1 gene. After hybridization, blots were washed twice with 40 mM sodium phosphate buffer (pH 7.2) containing 1 mM EDTA and 5% SDS at room temperature for 15 min. The X-ray film was developed after 3 days of exposure and the hybridized bands were visualized by autoradiography. 2.7. RT-PCR analysis RNA was extracted from different trout tissues using the SV Total RNA Isolation system (Promega). Total RNA, 50 ng, from the trout brain, heart,

intestine, kidney, liver or spleen, were reverse transcribed using the one-step RT-PCR Robus T I kit (Finnzymes) with the primers TtoxF1: 50 -ATGAGAGCCTACCTGGTCCTG-30 and TtoxR1: 50 -GGCATTGCAGCGGTCCTCAT-30 . The above primers are found in different exons of the trout toxin-1 gene amplifying a cDNA fragment, 227 bp in size. The program was as follows: 55 1C for 30 min, 95 1C for 15 min, 30 cycles of 95 1C for 30 s, 55 1C for 30 s, 72 1C for 30 s, followed by a final extension at 72 1C for 10 min. Trout b-actin mRNA was amplified using the following primers: b-actinF: 50 -CACCTTCTACAATGAGCTGC-30 , and b-actinR: 50 -AGGCAGCTCGTAGCTCTTCT-30 . Amplification products were analyzed and visualized by electrophoresis on a 2.5% agarose gel. 2.8. Production of recombinant trout toxin-1 protein 2.8.1. Subcloning of trout toxin-1 Primers were designed according to the 50 and 30 ends of the mature protein coding area, having an additional restriction site at the 50 end (NdeI for the TtoxF2 and XhoI for the TtoxR2): TtoxF2: 50 -CACACATATGGACTACAACATTGAATGT30 and TtoxR2: 50 -CACACTCGAGGGCATTGCAGCGGTCCTC-30 . These primers were subsequently applied in a PCR reaction using as template the recombinant phage DNA. The program was as follows: 95 1C for 5 min, 30 cycles of 95 1C for 45 s, 52 1C for 30 s and 72 1C for 30 s, followed by a final extension at 72 1C for 10 min. The PCR product (180 bp) was initially subcloned in a pGEM-T Easy vector. The recombinant plasmid was isolated and treated with NdeI and XhoI restriction enzymes. The proper fragment of this digestion was subcloned into the pET-30Ek/LIC vector (Novagen) and subsequently BL21 (DE3) Escherichia. coli bacterial cells (Novagen) were transformed. 2.8.2. Expression and purification of recombinant trout toxin-1 Recombinant trout toxin-1 was produced in BL21 bacterial cells as a fusion molecule to a 6 His tag. Bacteria were grown in 1 l SOB medium supplemented with kanamycin (5 ng/ml) at 37 1C. The expression of recombinant protein was induced by adding IPTG in a final concentration of 2 mM, when OD 600 nm ¼ 8 and keeping the temperature at 37 1C for 4 h. The recombinant protein was isolated from the inclusion bodies of bacteria and purified by affinity chromatography using a Ni2+

ARTICLE IN PRESS E. Georgaka et al. / Toxicon 49 (2007) 1002–1009

1005

charged column (Ni-NTA Agarose, Qiagen) under reducing and non reducing conditions. The production of recombinant trout toxin-1 was verified by Western blot analysis using the QIAexpress detection system (Qiagen) (His–tag detection).

radish-peroxidase conjugated) at dilution 1:2000 in PBS-T for 1 h. The immunoreacted proteins were detected by the enhanced chemiluminescence method (ECL), according to the manufacturer’s instructions (Pierce, Rockford, IL, USA).

2.9. Antibodies production and Western blot analysis

2.10. Determination of proteins and protein free sulfhydryl groups

2.9.1. Production of a polyclonal antibody Purified recombinant trout toxin-1 protein (2 mg) was subjected to preparative SDS-PAGE on a 18% polyacrylamide gel under reducing conditions (Laemmli, 1970). After staining with Coomassie Blue and de-staining of the gel, the area containing the toxin-1 band (7 kDa) was cut off, washed with 10 mM phosphate buffer/0.15 M NaCl (pH 7.4) (PBS), homogenized in the same buffer and used for the immunization of rabbits. Aliquots of suspension (0.5 ml), containing 200–300 mg of initial protein, were emulsified with an equal volume of Freund’s complete adjuvant for the first and incomplete adjuvant for the subsequent injections, and injected subcutaneously on days 0, 15, 21, 28, 35, 42, 48 and 54. The animals were bled prior to the first injection and then 1 week after each boost and the sera were kept at 20 1C until further use. Titration of collected sera showed that the sera obtained after the fifth week were of high titer and they were used in this study. 2.9.2. Detection of trout toxin-1 in trout plasma by western blot analysis Trout plasma (2 ml) was enriched in proteins of low molecular mass by solid-phase extraction on Bond Elut C18 cartridges (Waters), equilibrated in 0.1% trifluoroacetic acid (TFA). The cartridges were washed with 0.1% TFA and then eluted with 80% acetonitrile (CH3CN) in 0.1% TFA. The 80% CH3CN fraction was lyophilized and reconstituted in 12 ml of sterile water. Five microliter of the enriched trout plasma or recombinant trout toxin-1 (200 ng) were dissolved in Laemmli sample buffer, treated with 2-mercaproethanol, subjected to SDSPAGE (Laemmli, 1970) on a 18% polyacrylamide gels and after electrophoresis the separated proteins were electrotransferred onto nylon membranes (Zeta-Probe, Bio Rad). After blocking of empty sites on the membranes with 5% skim milk in PBS containing 0.05% Tween-20 (PBS-T), they were incubated with the sixth week antiserum at dilution 1:1000 in PBS-T (first antibody) for 1 h and then with second antibody (goat anti-rabbit IgG horse-

The determination of proteins was performed by Bradford method, using bovine serum albumin as the standard (Bradford, 1976) and of protein free sulfhydryl groups using the Ellman’s reagent (Habbeb, 1972). 3. Results and discussion Sequence analysis of the trout toxin-1 cDNA, 482 bp in size, revealed a short 50 -UTR of 52 bp followed by an open reading frame of 228 bp encoding a protein of 76 aa with a predicted size of 7.5 kDa, and a 30 -UTR of 250 bp containing a polyadenylation signal and a poly(A) track. Analysis of the predicted polypeptide sequence (http:// www.cbs.dtu.dk/services/SignalP/) demonstrated that trout toxin-1 codes for a protein containing an N-terminal signal peptide of 16 residues (Fig. 1). The Kozak sequence -(A/G)NNATG-, recognized by ribosomes as the translational start site and thus required for protein expression, is present within the trout toxin-1 50 UTR sequence. A Blast search using trout toxin-1 against the Swiss Prot database revealed over 100 similar proteins which belong to the secreted elapid snake venom neurotoxins and the Ly-6 GPI-anchored superfamily with a significant sequence identity. The deduced amino acid sequence of mature trout toxin1 was aligned with the above snake neurotoxins and Ly-6 proteins. The most similar sequence to the trout toxin-1 is an unnamed protein from bony fish Tetraodon nigroviridis (accession number CAG05132) showing 62% identity. The identity with the snake neurotoxins and Ly-6 proteins ranges from 25 to 50%. No significant similarity was found after comparison with trout CD59s. A characteristic feature of the a-neurotoxin and Ly-6 proteins is the presence of a cysteine-rich consensus motif consisting of an N-terminal leucine/isoleucine, eight cysteines, and a C-terminal asparagine. Multiple alignment of trout toxin-1 with the Ly-6 proteins and the snake neurotoxins demonstrated that trout toxin-1 contains the above signature motif (Fig. 2).

ARTICLE IN PRESS E. Georgaka et al. / Toxicon 49 (2007) 1002–1009

1006

cgctcactggcagactatccgctgctaagagaatcttcgactgagaccaacaatgagagcc M

A

3

tacctggtcctgcttctgctgctccctctctgcacagccgactacaacattgaatgttac

120

Y

L

V

L

L

L

L

L

P

L

C

T

A

D

Y

N

I

E

R

60

C

Y

ggcgaggacttcctgatgctgaggaaccagctcctacagtgctcaagcagaacacagcag G

E

D

F

L

M

L

R

N

Q

L

L

Q

C

S

S

R

T

Q

Q

gcctgctacaccaggaagactggggagaagggctgtgctcggctggagttgtgctctcga A

C

Y

T

R

K

T

G

E

K

G

C

A

R

L

E

L

C

S

R

tcaggctggaagtgctgctatgaggaccgctgcaatgcctagagctgattccaggggaca S

G

W

K

C

C

Y

E

D

R

C

N

A

*

23 180 43 240 63 300 76

ctaactccacggcccaggaaaggcagaggacgaagagctgtgatatcagccgacagcaat

360

ttgctgtttagcacttggtgaatggaatgtgtttgtataaataacgtgacaaaaataact

420

ttaatttgatgtaaagtcacatga aataaa gtcctacgaaattgtaaaaaaaaaaaaa

480

aaa

483

Fig. 1. Nucleotide and deduced amino acid sequences of trout toxin-1. A putative leader sequence is shown in underlined. Boxes indicate the 8 conserved cysteine residues and box in bold indicates a putative polyadenylation signal found in the 30 UTR of trout toxin-1.

OHLNTX NAJSPMTXL7 k-BTX OHWTOX NAJATCTX-6 NAJSPCTX-1 TTOX-1 TETTOXL

MKTLLLTLVVVTIMCLDLGYTTKCYVTPDV----TSQTC-PDGQNICYTETWCDAWCGSR MKTLLLTLVLVTIMCLDLGYTIRCFITPDV----TSTDC-PNG-HVCYTKTWCDGFCSSR MKTLLLTLVVVTIVCLDLGYTRTCLISPSS----TPQTC-PNGQDICFLKAQCDKFCSIR MKTLLLTLVVVTIVCLDLGYSLICFNQETYRPE-TTTTC-PDGEDTCYSTFWND----HR MKTLLLTLVVVTIVCLDLGYTLKCNQLIPP----FYKTC-AAGKNLCYKMFMVA----AP MKTLLLTLVVVTIVCLDLGYTLKCNKLVPL----FYKTC-PAGKNLCYKIFMVA----TP MRAYLVLLL-LLPLCT-ADYNIECYGEDFLMLRNQLLQCSSRTQQACYTR--------KT MKVYLLLLLVLLPLCSAADHEIRCYGEDFLMVRNLQLDCRSEVKQACYTR--------DN *:. *: *: : :* .: * * . . *:

OHLNTX NAJSPMTXL7 k-BTX OHWTOX NAJATCTX-6 NAJSPCTX-1 TTOX-1 TETTOXL

GKRVNLGCAAT--CPKVNPG-VDIICCSTDNCNPFPKRS GRRVELGCAAT--CPTVKPG-VDIQCCSTDNCNPFPTRP GPVIEQGCVAT--CPQFRSNYRSLLCCTTDNCNH----GVKIERGCG----CPRVNPG-ISIICCKTDKCNN----KVPVKRGCID--VCPKSSLL-VKYVCCNTDRCN-----KVPVKRGCID--VCPKSSLL-VKYVCCNTDRCN-----G---EKGCARLELCSRSG-----WKCCYEDRCNA----G---EKGCTTLHHCSKRG-----WSCCHTDLCNA----: ** * ** * **

Fig. 2. Multiple alignment of representative members of the short and long chain toxins was performed using the Clustal W program. OHLNTX (Ophiophagus hannah, GenBank accession number AAT97251), NAJSPMTXL7 (Naja sputatrix, O42257), k-BTX (Bungarus multicinctus, P01398), OHWTOX (Ophiophagus hannah, ABB83636), NAJATCTX-6 (Naja atra, P80245), NAJSPCTX-1 (Naja sputatrix, AAC27684), TTOX-1 (Oncorhynchus mykiss, AF363273), TETTOXL (Tetraodon negroviridis, CAG05132). Cystein residues of the mature toxins are boxed. (*) indicates totally conserved residues. (:) indicates conservation of strong groups and (.) indicates conservation of weak groups.

All 8 cysteine residues of the mature amino acid sequence of trout toxin-1 which are putatively involved in disulfide bond formation, are fully conserved (Fig. 2).

To better determine the evolutionary position of trout toxin-1, a phylogenetic tree was constructed using the NJ method. The phylogenetic tree, based on the mature amino acid sequences indicates that

ARTICLE IN PRESS E. Georgaka et al. / Toxicon 49 (2007) 1002–1009

fish toxin sequences are clustered in the same group as the short neurotoxins. In addition, the groups of long neurotoxins and Ly-6 sequences seem to comprise well-defined clusters within the evolutionary scenery and are supported by high bootstrap values (Fig. 3). As shown in Table 1, trout toxin-1 gene is organized in three exons interrupted by two introns. The exon–intron boundaries follow the universal GT/AG rule (Csank et al., 1990). Moreover the splice donor and acceptor sequences are highly conserved (Table 1). Exon 1 encodes most of the signal peptide (15 aa), exon 2 the latter part of the signal peptide (1 aa) and the N-terminal half of the mature toxin-1 protein. Exon 3 encodes the carboxy-terminal half of the protein and the following three-noncoding region. Structurally, the organization of trout toxin-1 gene is the same as that reported for the most a-neurotoxins (Chang

OHLNTX

73 62

NAJSPMTXL7

88

k-BTX

31

1007

et al., 1997, 1999, 2002a; Afifiyan et al., 1999) including similar introns insertions. In contrast to the finding that the intron 2 of trout toxin-1 has a similar size with other knwn short and long neurotoxins, a notable variation with the size of intron 1 was observed. The hypothesis that the intron 2 may play a more critical role in pre-mRNA stability and/or processing remains unclear. In order to elucidate whether toxin-1 gene exists in multiple copies in the trout genome, a Southern blot analysis was carried out after digestion of trout genomic DNA with three restriction endonucleases: EcoRI, HindIII and PstI. As a result, three bands appeared in the EcoRI lane, two in the HindIII lane, and only one band was recognized in the PstI lane, suggesting that the toxin-1 gene probably exists as a single copy in the trout genome (Fig. 4). To gain insight into the trout toxin-1 mRNA tissue distribution, semi-quantitative RT-PCR analysis was performed with primers from different exons, using RNA from trout brain, kidney, liver, and spleen. As shown in Fig. 5, toxin-1 gene is expressed mainly in liver, brain, spleen, and at a lower level in kidney and spleen (Fig. 5).

TTXO-1 99

tI

Kb

TETTOXL

23

HCD59 97

nd

I

NAJHATOXW2A

Ps

38

A

Hi

NAJSPCTX-1

oR

100

Ec

NAJATCTX-6

31

III

OHWTOX

9.0

RATCD59 XLXEN-1

100

2.2

XLXEN-2 25

2.0

HLy6 100

MLy6

0.1

Fig. 3. Phylogenetic tree analysis of representative members of ‘‘three-finger family’’. The results of a multiple alignment (data not shown) have used for the construction of the tree. NAJATCTX-6 (Naja atra, GenBank accession number P80245), NAJSPCTX-1 (Naja sputatrix, AAC27684), OHLNTX (Ophiophagus hannah, AAT97251), NAJSPMTXL7 (Naja sputatrix, O42257), k-BTX (Bungarus multicinctus, P01398), OHWTOX (Ophiophagus hannah, ABB83636), HLy6 (Homo sapiens, NP803430), MLy6 (Mus musculus, AAH37541), TTOX-1 (Oncorhynchus mykiss, AF363273), TETTOXL (Tetraodon negroviridis, CAG05132), HCD59 (Homo sapiens, AAH01506), RATCD59 (Rattus norvegicus, NP037057), XLXEN-1 (Xenopus leavis, Q09022), XLXEN-2 (Xenopus leavis, P38951), NAJHATOXW2A (Naja haje, P25678).

B Exon Intron

2 (101bp)

1 (98bp) 1 (1235bp)

3 (268bp)

2 (570bp)

Fig. 4. (A) Southern blot analysis of trout genomic DNA using as probe a trout toxin-1 cDNA fragment (227 bp). The positions of the DNA standards are shown on the left. (B) Structure and organization of the trout toxin-1 gene. The exons are shown as boxes and introns as thin lines. Closed boxes represent the signal peptide coding region, and open boxes represent the mature protein coding region. The sizes of the exons and introns are shown.

ARTICLE IN PRESS E. Georgaka et al. / Toxicon 49 (2007) 1002–1009

Trout toxin-1 cDNA fragment that refers to the mature protein was amplified by PCR, cloned in pET 30/ELC expression vector, and BL21(DE) E. coli bacterial cells were transformed. Gene expression was induced by IPTG. The protein was expressed as a fusion to a six histidine tag. After SDS-PAGE of the lysed bacteria (soluble and insoluble fractions), two discrete bands (7 and 14 kDa) of the recombinant protein were mostly found in the insoluble fraction (Fig. 6A). The production of the recombinant trout toxin-1 was verified by Western blot analysis using anti-6His antibodies. Both bands (7 and 14 kDa) were 1

2

3

4

5

-actin

470bp 340bp -

trout toxin-1 150bp Fig. 5. RT-PCR analysis of trout toxin-1 mRNA expression in various trout tissues. 1. DNA ladder (l phage DNA is digested with Pvu II), 2. Brain, 3. Kidney, 4. Liver, 5. Spleen. Beta-actin mRNA amplification was included as an internal control and as a measure of RNA integrity.

detected, suggesting the presence of a dimeric form of the toxin-1 protein in the samples (data not shown). The recombinant protein was purified by affinity chromatography using a Ni2+ charged column and the collected fractions were subjected to SDS-PAGE (Fig. 6A). Two discrete protein bands, one major and another minor of molecular mass 7 and 14 kDa, respectively, were detected in fractions collected with pH 5.9 and 4.5. The 7 kDa band corresponds to toxin-1 protein while that of 14 kDa may represent a dimeric form of toxin-1 protein. No free sulfhydryl groups were detected when the affinity purified recombinant protein was subjected to reaction with Ellman’s reagent, indicating that during refolding process disulfide bonds were formed. Whether the recombinant protein was appropriately folded, acquired its biologically active toxin-like conformation, remains unsolved. It will be elucidated when recombinant protein will be subjected to toxicity experiments. It is under consideration. In order to certify the presence of trout toxin-1 protein in the trout plasma, it was enriched by solid phase extraction and subjected to Western blot analysis, using the polyclonal antibodies produced by immunization of rabbits with recombinant protein (Fig. 6B). Two immunoreactive bands of molecular mass 7 and 14 kDa, respectively, were detected in both samples (recombinant protein and enriched trout plasma), indicated that the toxin-1 protein indeed occurs in trout plasma. It means that the toxin-1 protein is produced in various organs and then may be released in circulation or it is

B 1

10kDa

2

3 4

5 6

7

8

RT

to

x

A 9 10 11 12 13 14 15

T Pl rou as t ma

1008

14kDa 14kDa 7.0kDa 7.0kDa

Fig. 6. (A) SDS-PAGE of fractions obtained from affinity chromatography of bacteria clear lysate, using a Ni2+ charged column (NiNTA Agarose). Molecular weight protein markers (lane 1), clear lysate (lane 2), flow-through (lane 3), washes (lanes 4–7), elusion with pH 5.9 (lanes 8–11) and elusion with pH 4.5 (lanes 12–15). (B) Western blot analysis of the recombinant trout toxin-1 (RTtox) and the native protein in trout plasma, using the produced polyclonal antibodies against RTtox.

ARTICLE IN PRESS E. Georgaka et al. / Toxicon 49 (2007) 1002–1009

intracellular protein and released in circulation because of programmed cell death. Acknowledgments This work was supported by grants to: PENED 99ED483 founded by E.C. and GSRT, (IKZ) and K. Karatheodori (2455) from Research Committee, University of Patras (VN). The sequence described in this paper has been deposited in the EMBL database, GenBank accession no. AF363273 (trout toxin-1). References Afifiyan, F., Amugam, A., Tan, C.H., Gopalakrishnakone, P., Jeyaseelan, K., 1999. Postsynaptic a-neurotoxin gene of the spitting cobra, Naja. naja. sputatrix: structure, organization and phylogenetic analysis. Genome Res. 9, 259–266. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403–410. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Ann. Biochem. 72, 248–254. Chang, L.S., Jin, J., Wu, P.F., Chang, C.C., Hong, E., 1997. cDNA sequence analysis and expression of k-bungarotoxin from Taiwan banded krait. Biochem. Biophys. Res. Commun. 230, 192–195. Chang, L.S., Lin, S.K., Huang, H.B., Hsiao, M., 1999. Genetic organization of a-bungarotoxins from Bungarus multicinctus (Taiwan banded krait): evidence showing that the production of a-bungarotoxin isotoxins is not derived from edited mRNAs. Nucl. Acids Res. 27, 3970–3975. Chang, L.S., Chung, C., Lin, J., Hong, E., 2002a. Organization and phylogenetic analysis of k-bungarotoxin genes from Bungarus multicinctus (Taiwan banded krait). Genetica 115, 213–221. Chang, L.S., Liou, J.C., Lin, S.R., Huang, H.B., 2002b. Purification and characterization of a neurotoxin from the venom of Ophiophagus hannah (King Cobra). Biochem. Biophys. Res. Commun. 294, 574–578. Chang, L.S., Lin, S.K., Chung, C., 2004. Molecular cloning and evolution of the genes encoding the precursors of Taiwan cobra cardiotoxin and cardiotoxin-like basic protein. Biochem. Genet. 42, 429–440. Csank, C., Taylor, F.M., Martindale, D.W., 1990. Nuclear premRNA introns: analysis and comparison of intron sequences from Tetrahymena thermophila and other eukaryotes. Nucl. Acids Res. 18 (17), 5133–5141. Endo, T., Tamiya, N., 1991. Structure–function relationship of postsynaptic neurotoxins from snake venoms. In: Harvey, A.L. (Ed.), Snake Toxins. Pergamon Press, New York, pp. 165–222.

1009

Gumley, T.P., McKenzie, I.F.C., Sandrin, M.S., 1995. Tissue expression, structure and function of the murine Ly-6 family of molecules. Immunol. Cell Biol. 73, 277–296. Habbeb, A.F.S.A., 1972. Reaction of protein sulfhydryl groups with Ellman’s reagent. In: Hirs, C.H.W., Timasheff, S.N. (Eds.), Methods in Enzymology, Vol. XXV, part B. Academic Press, New York, San Francisco, London, pp. 457–464. Hatanaka, H., Oka, M., Kohda, D., Tate, S., Suda, A., Tamiya, N., Inagaki, F., 1994. Tertiary structure of erabutoxin b in aqueous solution as elucidated by two-dimensional nuclear magnetic resonance. J. Mol. Biol. 240, 155–166. He, Y.Y., Lee, W.H., Zhang, Y., 2004. Cloning and purification of a-neurotoxins from king cobra (Ophiophagus hannah). Toxicon 44, 295–303. Kieffer, B., Driscoll, P.C., Campbell, I.D., Willis, A.C., van der Merwe, P.A., Davis, S.J., 1994. Three-dimensional solution structure of the extracellular region of the complement regulatory protein CD59, a new cell-surface protein domain related to snake venom neurotoxins. Biochemistry 33, 4471–4482. Kolbe, H.V., Huber, A., Cordier, P., Rasmussen, U.B., Bouchon, B., Jaquinod, M., Vlasak, R., Delot, E.C., Kreil, G., 1993. Xenoxins, a family of peptides from dorsal gland secretion of Xenopus laevis related to snake venom cytotoxins and neurotoxins. J. Biol. Chem. 268, 16458–16464. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5, 150–163. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685. Nirthanan, S., Gwee, M.C., 2004. Three-finger alpha-neurotoxins and the nicotinic acetylcholine receptor, 40 years on. J. Pharmacol. Sci. 94, 1–17. Ploug, M., Ellis, V., 1994. Structure-function relationships in the receptor for urokinase-type plasminogen activator. Comparison to other members of the Ly-6 family and snake venom aneurotoxins. FEBS Lett. 349, 163–168. Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Shafqat, J., Siddiqi, A.R., Zaidi, Z.H., Jornvall, H., 1991. Extensive multiplicity of the miscellaneous type of neurotoxins from the venom of the cobra Naja naja naja and structural characterization of major components. FEBS Lett. 284, 70–72. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. ClustalW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucl. Acids Res. 22, 4673–4680. Tsetlin, V., 1999. Snake venom a-neurotoxins and other ‘threefinger’ proteins. Eur. J. Biochem. 264, 281–286. Zarkadis, I.K., Sarrias, M.R., Sfyroera, G., Sunyer, O.J., Lambris, J.D., 2001. Cloning and structure of three rainbow trout C3 molecules: a plausible explanation for their functional diversity. Dev. Comp. Immunol. 25, 11–24.