Accumulation and detoxification dynamics of microcystin-LR and antioxidant responses in male red swamp crayfish Procambarus clarkii

Aquatic Toxicology 177 (2016) 8–18

Contents lists available at ScienceDirect

Aquatic Toxicology journal homepage: www.elsevier.com/locate/aquatox

Accumulation and detoxification dynamics of microcystin-LR and antioxidant responses in male red swamp crayfish Procambarus clarkii Julin Yuan a,b , Zhimin Gu b,∗∗ , Yao Zheng c , Yingying Zhang a , Jiancao Gao a , Shu Chen a , Zaizhao Wang a,∗ a College of Animal Science and Technology, Northwest A&F University, Shaanxi Key Laboratory of Molecular Biology for Agriculture, Yangling, Shaanxi 712100, China b Zhejiang Institute of Freshwater Fisheries, Freshwater Fishery Healthy Breeding Laboratory of Ministry of Agriculture, Huzhou, Zhejiang 313001, China c Freshwater Fisheries Research Center, Chinese Academy of Fishery Sciences; Scientific Observing and Experimental Station of Fishery Resources and Environment in the Lower Reaches of the Changjiang River, Wuxi 214081, China

a r t i c l e

i n f o

Article history: Received 10 January 2016 Received in revised form 30 April 2016 Accepted 6 May 2016 Available online 10 May 2016 Keywords: Procambarus clarkii Microcystin-LR Accumulation Detoxification Antioxidation

a b s t r a c t MC-LR is one of major microcystin isoforms with potent hepatotoxicity. In the present study, we aim to: 1) explore the dynamics of MC-LR accumulation and elimination in different tissues of male red swamp crayfish Procambarus clarkii; 2) reveal the mechanisms underlying hepatic antioxidation and detoxification. In the semi-static toxicity tests under the water temperature of 25 ± 2 ◦ C, P. clarkii were exposed to 0.1, 1, 10 and 100 ␮g/L MC-LR for 7 days for accumulation and subsequently relocated to freshwater for another 7 days to depurate MC-LR. MC-LR was measured in the hepatopancreas, intestine, abdominal muscle and gill by HPLC. The enzyme activities of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx) and glutathione S-transferase (GST), content of glutathione (GSH), and transcripts of Mn-sod, cat, gpx1, Mu-gst, heat shock protein90 (hsp90), hsp70 and hsp60 in hepatopancreas were detected. The results showed that P. clarkii accumulated more MC-LR in intestine, and less in abdominal muscle and gill during accumulation period and eliminated the toxin more quickly in gill and abdominal muscle, and comparatively slowly in intestine during depuration period. The fast increase of SOD and CAT activities at early stage, subsequent decrease at later stage of accumulation period and then fast increase during depuration period were partially consistent with the transcriptional changes of their respective genes. GPx was activated by longer MC-LR exposure and gpx1 mRNA expression showed uncoordinated regulation pattern compared with its enzyme. Hsp genes were up-regulated when P. clarkii was exposed to MC-LR. © 2016 Elsevier B.V. All rights reserved.

1. Introduction Worldwide, with the increasing incidence and intensity of cyanobacterial blooms in eutrophic aquatic systems, their ecotoxicological potential has received more and more attention in last decades (Corbel et al., 2015). Among algal toxins from blooms in most freshwater ecosystems, microcystins (MCs) are considered to be the most dangerous group, mainly because they are potent hepatotoxins (Ikehara et al., 2015). MCs are a family of cyclic peptide toxins produced by brackish and freshwater cyanobacteria of

∗ Corresponding author at: College of Animal Science and Technology, Northwest A&F University, 22 Xinong Road, Yangling, Shaanxi 712100, China. ∗∗ Corresponding author at: Zhejiang Institute of Freshwater Fisheries, 999 Hangchangqiao Road, Huzhou, Zhejiang 313001, China. E-mail addresses: [email protected] (Z. Gu), [email protected] (Z. Wang). http://dx.doi.org/10.1016/j.aquatox.2016.05.004 0166-445X/© 2016 Elsevier B.V. All rights reserved.

the genera Anabaena, Anabaenopsis, Chroococcus, Microcystis, Nostoc and Planktothrix (Pearson et al., 2010). To date, around 100 variants are known and the variations in the two variable L-amino acids lead to the main isoforms: microcystin-LR (MC-LR), MC-RR and MC-YR (Zastepa et al., 2015). With the help of activity of organic anion transporting polypeptides (OATP) (Fischer et al., 2005), these toxins can be easily absorbed by aquatic organisms including invertebrates, fish and aquatic plants (Galanti et al., 2013; Jiang et al., 2011; Khalloufi et al., 2013). MCs were detected in diverse organs in animals, such as liver, muscle, kidney and brain. MCs can trigger acute toxicity in the form of liver dysfunction and hemorrhage (van der Merwe et al., 2012). The mechanism of the MC toxicity is generally considered to be mediated by blocking serine/threonine protein phosphatases 1 (PP-1) and 2A (PP-2A) leading to increased protein phosphorylation (Toivola et al., 1994). Many studies have revealed that oxidative stress is also a toxicological consequence of the exposure to MCs

J. Yuan et al. / Aquatic Toxicology 177 (2016) 8–18

in different aquatic organisms (Jos et al., 2005; Paskerová et al., 2012; Bieczynski et al., 2013; Guzmán-Guillén et al., 2014). MCs could trigger the formation of excess reactive oxygen species (ROS), which results in lipid peroxidation (LPO), protein oxidation and DNA damage (Amado and Monserrat, 2010; Cadenas, 1989; Qian et al., 2014; Sun et al., 2012). In natural environments, MCs can accumulate in a wide range of aquatic biota such as fish (Bieczynski et al., 2014; Deblois et al., 2011), crustaceans (Galanti et al., 2013; Pinho et al., 2005; Sabatini et al., 2015), gastropods (Lance et al., 2010; Zhang et al., 2012c), mollusks (Sabatini et al., 2011) and macrophytes (Romero-Oliva et al., 2015; Zhang et al., 2011b). Aquatic organisms have developed a physiological antioxidant system with enzymatic components such as superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx), which protect cells from oxidative stress induced by MCs (Ding et al., 2001). Moreover, MCs biotransformation via glutathione S-transferase (GST) by conjugation with reduced glutathione (GSH) has been reported in aquatic organisms (Zhang et al., 2012b; Ortiz-Rodríguez and Wiegand, 2010; Pham et al., 2015; Wiegand and Pflugmacher, 2005). In the previous studies on depuration, MC content decreased in different organs of aquatic organisms. After 21 days of depuration of MCs in freshwater, MC-LR content decreased in the abdominal muscle of the red swamp crayfish P. clarkii (Tricarico et al., 2008). After 3 days of freshwater depuration following MC-LR exposure in Palaemonetes argentinus, the amount of MC-LR decreased by about 74% and the activities cytosolic GST and glutathione reductase (GR) increased (Galanti et al., 2013), suggesting that GSH played a key role in MC detoxification. Additionally, a set of heat shock proteins (HSPs) usually acts as a molecular chaperone and plays diverse roles in transporting, folding and assembling of degraded or misfolded proteins (Sørensen et al., 2003). The red swamp crayfish P. clarkii is one of the most widespread freshwater crayfish. Due to their high migration ability, resistance to environment changes and high tolerance to low water quality (Johnson and Avault, 1982), they are now spread all over China, especially around the Lake Tai region. However, the use of water contaminated with cyanobacteria in P. clarkii farm induced obvious lower production and food safety problem (Zhang et al., 2012a), which had seriously affected the healthy development of farming. The main goal of the present work was to investigate the accumulation and detoxification dynamics of MC-LR in different organs of P. clarkii exposed to different MC-LR concentrations. Additionally, we aimed to reveal the enzymatic activity of biotransformation and antioxidant enzymes and the transcriptional responses of genes encoding them and heat shock proteins in hepatopancreas in order to assess MCs toxicity and the defense mechanism in the aquatic invertebrate species.

9

dom and 40 individuals were initially exposed to 0.1, 1, 10 and 100 ␮g/L MC-LR dissolved in water for 7 d in triplicate in separate tanks (100 L) at the same time (Fig. 1). The control group contained individuals reared in freshwater without MC-LR. Half of the water was changed with corresponding concentration of MC-LR every day to maintain the concentration of MC-LR. Crayfish were fed with commercial pellet food once a day. Water quality was regularly monitored and no differences were recorded among tanks during the entire experimental period. After 8 h, 1 day, 3 days, 4 days and 7 days exposure, 5 crayfish of each groups were collected and dissected for hepatopancreas, intestine, abdominal muscle and gill samples. The different tissues of crayfish were preserved at −80 ◦ C until use. In the second phase of depuration, the remaining 15 crayfish in each group were relocated to freshwater (free of MC-LR) for another 7 days. After 2, 5 and7 days depuration, hepatopancreas, intestine, abdominal muscle and gill tissues were dissected and preserved at −80 ◦ C until use. No mortality and behavioural changes were found in crayfish during the accumulation and depuration period. 2.3. MC-LR extraction and quantification All above samples were lyophilized by a freeze drier (FreeZone, Labconco corporation). MC-LR was extracted and purified following the methods of Xie et al. (2005) with minor modification. Briefly, lyophilized samples (0.25 g dry weight(DW) for each sample) were homogenized in a mortar and extracted three times with 10 mL of BuOH: MeOH: H2 O (1:4:15) for 24 h while stirring. The extracts were centrifuged at 18000 rpm and the supernatants were diluted with water. These diluted extracts were directly applied to 2.5 mL of a reversed phase ODS cartridge, which had been preconditioned by washing with 25 mL of 100% MeOH and 25 mL of H2 O. The column containing sample was washed with water (25 mL), followed by water-MeOH (4:1, 50 mL). Elution from the column with 90% MeOH (50 mL) yielded the toxin-containing fractions. The toxin-containing fractions were evaporated to dryness. These fractions were dissolved with 100% MeOH and the methanol solution was subjected to a reverse-phase high-performance liquid chromatography (HPLC) equipped with an ODS column (Cosmosil 5C18 -AR, 4.6 × 150mm, Nacalai, Japan) and a SPD-10A UV–vis spectrophotometer set at 238 nm, A gradient starting at 50% (v/v) aqueous methanol with 0.05% trifluoroacetyl (TFA) was increased to 70%(v/v) in 25 min at a flow rate of 1 mL/min. MC-LR concentration was determined by comparing the peak areas of the test samples with those of the standards available (MC-LR, Alexis Biochemicals-Switzerland). 2.4. Enzyme activity assays following MC-LR exposure

2. Materials and methods 2.1. Animals and chemicals One-year old adult P. clarkii (weight, 34.2 ± 1.6 g) were bought from Huzhou fish farm (Zhejiang, China) and acclimated to controlled aquarium for 7d (dechlorinated tap water with temperature of 25 ± 2 ◦ C and the photoperiod of 14 h:10 h light/dark cycle). Males were chosen to minimize possible interfering effects of sex and fed with commercial shrimp pellet once a day. MC-LR (purity ≥ 98%) was purchased from Alexis Biochemicals (Lausen, Switzerland). 2.2. MC-LR exposure and sample preparation The exposure study was composed of two phases. In the first phase, 600 male crayfish were divided into fifteen groups at ran-

Three hepatopancreas samples (0.5 g wet weight, WW/each) were defrosted twice at random and homogenized on ice with 10 volumes of cold buffer (250 mM sucrose, 5 mM Tris-HCL, and 0.1 mM edetic acid-2Na; pH 7.5). The homogenates were centrifuged at 10000g and 4 ◦ C for 10 min to obtain the supernatant for the enzyme assays. Total protein concentration was measured according to Bradford (1976) with BSA as a standard. SOD, CAT, GPx, and GST activities, as well as GSH content were measured using commercial kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China), following the instructions from the kits and the established methods described by Liu et al. (2008). Briefly, one unit of SOD activity was defined as the amount of enzyme required to inhibit the oxidation reaction by 50% and was expressed as U/mg protein. One unit of CAT activity was defined as the amount of enzyme required to consume 1 ␮mol H2 O2 in 1s and was expressed as U/mg protein. One unit of GST and GPx activity was defined as the amount of enzyme consuming 1 ␮mol of substrate or generat-

10

J. Yuan et al. / Aquatic Toxicology 177 (2016) 8–18

Fig. 1. Schematic diagram of the experiment.

ing 1 ␮mol of product/min/mg soluble protein (U/mg protein). The GSH content was expressed as mg/g protein.

2.5. Gene expression analysis Total RNA was isolated from P. clarkii hepatopancreas (0.1 g WW/each) with TRIzol reagent (Takara Biochemicals, Dalian, China) according to the manufacturer’s protocol. The ratio of absorbance at 260 nm to 280 nm, as well as the banding pattern on a 1% agarose formaldehyde gels was used to verify the quality of the RNA in each sample. Subsequently, the RNA was denatured at 65 ◦ C for 15 min. The cDNAs were synthesized from 5 ␮g total RNA with M-MLV reverse transcriptase (Invitrogen) and the oligo (dT)18 primer in a 20 ␮L final volume. The qRT-PCR analysis was performed on a CFX96 real-time PCR detection system (Bio-Rad, Hercules, CA, USA) thermocycler with the SYBR Premix ExTaq II kit (TaKaRa Bio). The qRT-PCR reactions were carried out in a final volume of 25 ␮L using 1 × SYBR Premix Ex Taq, 0.4 ␮M of each primer, and 2.5 ␮L RT reaction solution. The reactions were denatured at 95 ◦ C for 30 s, followed by 40 cycles of denaturation at 95 ◦ C for 5 s, and annealing at 60 ◦ C for 30s. To assess the specificity of each amplicon, a melting curve analysis was performed at the end of each PCR thermal profile. CFX Manager software (Bio-Rad) was used to analyze SYBR Green I density and to determine the threshold cycle (Ct) value. All samples were run in triplicate. The qRT-PCR efficiency

(E) was calculated from the given slopes using CFX Manager software and a 10-fold diluted cDNA sample series with five dilution points measured in triplicate. E was determined using the equation: E = 10(−1/slope) . The gene expression patterns of hepatopancreatic Mn-sod, cat, Mu-gst, gpx1, hsp60, hsp70 and hsp90 were detected by qRT-PCR. Each transcript was analyzed in 6 individuals. The ˇ-actin gene was used as an endogenous control. Detailed information is shown in Table 1. Relative mRNA levels were calculated using the 2−Ct method and the formula F = 2−Ct , Ct = (Ct , targetgene −Ct , ˇ−actin ) MC-LR −(Ct , targetgene −Ct , ˇ−actin ) control (Livak and Schmittgen, 2001). Data are expressed as mean ± SD. Statistical differences were tested with analysis of variance and the least significant difference test. Results were considered significant at P < 0.05.

3. Results 3.1. Accumulation and depuration dynamics of MC-LR in different organs MC-LR was detected in all four tissues with the content order of intestine > hepatopancreas > gill > muscle. In the intestine (Fig. 2a), MC-LR was first detected after 1 day with 100 ␮g/L MC-LR exposure. From 3 to 7 days of accumulation, the content of MC-LR increased in both time- and concentration-dependent manners. After 2 days of

J. Yuan et al. / Aquatic Toxicology 177 (2016) 8–18

11

Table 1 Sequence of primer pairs used in the real-time quantitative PCR reaction. Target gene

Primer sequences

Product length(bp)

Accession number

Mn-sod

F:AGGTTCAATGGAGGAGGTCACA R:ATTTGGAGTGCCCCCTTTTG

22 20

EU254488

cat

F:CGACCATACACCGCTTCAC R:TTTCAGGAATGCGTTCTCTATC

19 22

KM068092

Mu-gst

F:CGTCGCAGCAAGAAGCAG R:CCCGATGTAGCGGAGGAT

18 18

HQ414581

gpx1

F:GAAAAGACTGAGGTCAATGGCG R:GGGTGGTAGCGAGTGTATGGC

22 21

JN835259

hsp60

F:GGAGAAGCCTTGAGCACACT TTACCCTTGCCCTTCAGCAG

20 20

HG001456

hsp70

F:AGCGTAGACCACGAGACCG R:AAGACGCTCTGTGTCGGTGA

19 20

DQ301506

hsp90

F:GATTGGGCAGTTTGGTGTGG R:CCACCTCCTTGATGCGGC

20 18

JQ995601

ß-actin

F:AGTXGCCGCCCTGGTTGTAGAC R:TTCTCCATGTGGTCCCAGT

22 19

DA14612

Fig. 2. The changes in MC-LR concentrations (mg/kg DW) in intestine (a), hepatopancreas (b), gill(c) and muscle (d) of freshwater red swamp crayfish P. clarkii. Different small letter superscripts indicate significant differences between different groups (P < 0.05).

depuration in freshwater without MC-LR, intestinal MC-LR content did not decrease in any of the exposure groups, whereas it dramatically dropped in all exposure groups after 5 and 7 days depuration, becoming even undetectable at end of depuration (7 days), decreas-

ing, respectively, by 100%, 98.60%, 97.53% and 95.25% in groups from 0.1 to 100 ␮g/L. In hepatopancreas, MC-LR was initially detected after 8 h of 100 ␮g/L MC-LR exposure (Fig. 2b). From 1 to 7 days of accumula-

12

J. Yuan et al. / Aquatic Toxicology 177 (2016) 8–18

Fig. 3. Glutathione (GSH) content in the hepatopancreas of male P. clarkii. Values are expressed as mean ± SD (n = 9). Different small letter superscripts indicate significant differences between different groups (P < 0.05).

tion, MC-LR content was gradually increased in both concentrationand time-dependent manners. After 7 days of MC-LR exposure, the accumulated MC-LR in hepatopancreas reached the maximum in 0.1–100 ␮g/L groups (0.012 ± 0.002, 0.034 ± 0.024, 0.059 ± 0.009 and 0.099 ± 0.024 mg/kg, respectively). During the depuration period, the content of MC-LR in hepatopancreas dramatically decreased. In gill tissue, although MC-LR content was much lower than in intestine and hepatopancreas, accumulation can be detected as early as 8 h after accumulation with 0.1 ␮g/L (Fig. 2c). Throughout the whole exposure, the MC-LR accumulation showed an increase in both time- and concentration-dependent manners. During the depuration period, the MC-LR content rapidly decreased in gill and was even undetectable in all treatment groups at the end of depuration period. Compared to other tissues, MC-LR accumulation in the muscle was the lowest and the time for detectable MC-LR was the latest (Fig. 2d). During the MC-LR exposure, MC-LR accumulation in muscle was first detected after 3 days with 100 ␮g/L MC-LR exposure. The maximum MC-LR accumulation in 0.1–100 ␮g/L groups was at the end of exposure (7 days), with concentrations of 0.002 ± 0.001, 0.005 ± 0.004, 0.008 ± 0.002 and 0.018 ± 0.003 mg/kg, respectively. In the depuration period, the MC-LR residues were gradually decreased and undetectable for all groups one week later. It was noted that the order of MC-LR accumulation rate in 4 organs was intestine > hepatopancreas > gill > muscle, whereas the order of MC-LR depuration rate was gill > muscle > hepatopancreas > intestine.

3.2. Effects of MC-LR on GSH content and enzyme activities in hepatopancreas GSH content changes in response to MC-LR exposure and depuration are shown in Fig. 3. Throughout the 7 days of MCLR accumulation, GSH content in hepatopancreas decreased in both time- and concentration-dependent manners. After 7 days of

MC-LR exposure at 0.1, 1, 10, 100 ␮g/L, the GSH contents were reduced by 26.18%, 37.99%, 42.13% and 66.02% compared to controls, respectively (P < 0.05). After 2 days of depuration, GSH content was significantly decreased in all exposure groups. However, after 5 and 7 days of depuration, the decrease of GSH content was attenuated to no significant differences compared to controls. GST activity changes in response to MC-LR and after depuration are shown in Fig. 4a. After 8 h and 1 day of MC-LR exposure, GST activity had no significant changes. From 3 to 7 days of exposure, MC-LR significantly increased GST activity in a concentrationdependent manner (P < 0.05). After 2 days of depuration, GST activity was significantly higher in all treatment groups than in controls. After 5 and 7 days of depuration GST activity showed no significant increases in any exposure compared to controls. The SOD activity changes in hepatopancreas of P. clarkii after exposure to MC-LR are shown in Fig. 4b. SOD activity was first significantly increased after 8 h of exposures except with 0.1 ␮g/L (P < 0.05). After that, it decreased significantly from 3 to 7 days in animals exposed to 1, 10 and 100 ␮g/L MC-LR. In exposures to 0.1 ␮g/L MC-LR, SOD activity was significantly stimulated by MCLR only after 3 days of exposure and did not change significantly at other time points of exposure. During the depuration, SOD activity rapidly increased in animals previously exposed to 0.1 and 1 ␮g/L MC-LR, especially after 5 days of depuration (1.52- and 1.38-fold, P < 0.05, respectively). The CAT activity of hepatopancreas during MC-LR exposure and depuration is shown in Fig. 4c. CAT activity showed an opposed trend compared to SOD activity during MC-LR exposure. Throughout the 7 days of exposure, 0.1 ␮g/L MC-LR increased CAT activity in a time-dependent manner, with significant increase from 4 to 7 days. From 8 h to 3 days of MC-LR exposure, both 10 and 100 ␮g/L MC-LR significantly stimulated CAT activity, except 3-day MC-LR exposure at 10 ␮g/L. However, from 4 to 7 days of MC-LR exposure, CAT activity significantly decreased. During the depuration period, CAT activity increased in all groups, especially in 10 and 100 ␮g/L groups after 7 days of depuration.

J. Yuan et al. / Aquatic Toxicology 177 (2016) 8–18

13

Fig. 4. Glutathione S-transferase (GST) (a), superoxide dismutase (SOD) (b), catalase (CAT) (c) and selenium-dependent glutathione peroxidase (GPx) (d) enzyme activities in the hepatopancreas of male P. clarkii. Values are expressed as mean ± SD (n = 9). Different small letter superscripts indicate significant differences between different groups (P < 0.05).

GPx activity changes in response to MC-LR and after depuration are shown in Fig. 4d. MC-LR had no significant effects on GPx activity from 8 h to 3 days of MC-LR exposure. However, after 4 days of MC-LR exposure, GPx activity was significantly increased from 1.76- to 3.82-fold in all groups (P < 0.05). At the end of MC-LR exposure (7 days), there were no significant differences for GPx activity between different groups. After 2 and 5 days of depuration, GPx activity significantly increased in all groups. At the end of depuration (7 days), there were no significant differences between groups. 3.3. Expression profiles of hepatopancreas antioxidant enzyme genes in P. clarkii exposed to MC-LR The changes in Mn-sod, cat, Mu-gst, gpx1 mRNA expression are shown in Fig. 5. After 8 h of MC-LR exposure, Mu-gst mRNA expression was significantly up-regulated for 1.48 and 1.78 times in 10 and 100 ␮g/L MC-LR-exposed groups, respectively (P < 0.05, Fig. 5a). And after 1 day of MC-LR exposure, it was significantly stimulated from 1.42- to 2.68-fold in 1–100 ␮g/L MC-LR-exposed groups. However, after 3 days of MC-LR exposure, 0.1, 1, 10 and 100 ␮g/L

MC-LR caused 0.29- to 0.44-fold significant decrease in Mu-gst transcript (P < 0.05). From 4 to 7 days of MC-LR exposure, Mu-gst expression was significantly up-regulated by 1–100 ␮g/L MC-LR in concentration-dependent manner (P < 0.05). During the depuration period, MC-LR significantly down-regulated Mu-gst expression by 0.44- to 0.81-fold after 2 days of depuration. At the following time points of depuration (5 and 7 days), Mu-gst transcription groups had no significant changes in any group. One, 10 and 100 ␮g/L MC-LR caused significant decreases in Mnsod transcription after 8 h, 1 day and 3 days of exposure (P < 0.05) (Fig. 5b). However, after 4 days and 7 days of MC-LR exposure, there were no significant changes in Mn-sod transcript level. After 2 days of depuration, Mn-sod transcript level was significantly elevated (2.79- to 5.83-fold, P < 0.05) in previously 1, 10 and 100 ␮g/L MCLR-exposed groups. After 5 and 7 days of depuration, MC-LR had no significant effects on Mn-sod mRNA expression any more, except in the 0.1 ␮g/L group after 5 days (1.35-fold increase, P < 0.05). After 8 h of MC-LR exposure, cat mRNA expression was significantly up-regulated by MC-LR in concenration-dependent manner (1.77- to 4.14-fold, P < 0.05, Fig. 5c). From 1 to 4 days of MC-LR expo-

14

J. Yuan et al. / Aquatic Toxicology 177 (2016) 8–18

Fig. 5. Effects of MC-LR on mRNA expression of genes encoding antioxidant enzymes in hepatopancreas of male P. clarkii. Mu-glutathione S-transferase (Mu-gst) (a), Mnsuperoxide dismutase (Mn-sod) (b), catalase (cat) (c) and selenium-dependent glutathione peroxide (gpx1) (d). Crayfish were first exposed to MC-LR at 0.1–100 ␮g/L for 7 days and then depurated in freshwater for another 7 days. Nine crayfish from each group were randomly selected for sampling at each time point (three crayfish from every triplicate tank with a given exposure concentration). The qRT-PCR data were obtained as Ct values. The mRNA amounts for each target gene were normalized to ˇ-actin. Transcript abundance was expressed relative to that of control group (freshwater without MC-LR). All data were analyzed by the One-way ANOVA and finally indicated as mean ± SD. A Tukey post hoc test was carried out in the data sets with a significant difference. Different small letter superscripts indicate significant difference between different groups (P < 0.05). Analyses were performed with SPSS Statistics 17.0.

sure, 1, 10 and 100 ␮g/L MC-LR inhibited cat mRNA expression, whereas 0.1 ␮g/L MC-LR significantly stimulated its expression at the 3 time points of exposure (P < 0.05). There were no significant changes in cat mRNA expression after 7 days of exposure to 0.1, 1, 10 and 100 ␮g/L MC-LR. After 2, 5, and 7 days of depuration, previous exposure to 0.1–100 ␮g/L MC-LR still caused significantly up-regulated cat mRNA expression (1.36- to 4.2-fold, P < 0.05), with the exception of 7 days of depuration after exposure to 1 and 10 ␮g/L MC-LR. After the 8 h of MC-LR exposure, gpx1 mRNA expression was significantly up-regulated for 1.58- and 1.60-fold in animals exposed to 1 and 100 ␮g/L MC-LR, respectively (P < 0.05, Fig. 5d). After 1 day and 4 days of exposure, MC-LR had no significant effects on gpx1 mRNA expression. Exposures with 0.1–100 ␮g/L MC-LR significantly up-regulated gpx1 mRNA expression by 1.39- to 6.24-fold after 72 h of exposure (P < 0.05). On the other hand, 7-days MC-LR exposure with 0.1–100 ␮g/L MC-LR resulted in 0.14- to 0.66-fold significant decreases of gpx1 transcript compared to controls. During the depuration period, 1.38- to 2.11-fold significant increases

in gpx1 transcript were shown after 2 days of depuration after 0.1, 1, 10 and 100 ␮g/L MC-LR exposure (P < 0.05), and there were no significant changes on gpx1 transcript after 5 and 7 days.

3.4. Expression profiles of hsps in hepatopancreas in response to MC-LR The mRNA expression profile in hsp90 of hepatopancreas in response to MC-LR is shown in Fig. 6 a. After 8 h of exposure, 0.1–100 ␮g/L MC-LR led to 0.12- to 0.22-fold decrease of hsp90 transcript. From 1–7 days of exposure, hsp90 was upregulated by 0.1–100 ␮g/L MC-LR. Two days of depuration of previously MC-LR exposed animals, up-regulated hsp90 expression in a concentration-dependent manner, with maximum increase of 9.61-fold in the 100 ␮g/L MC-LR group. After 5 days of depuration, hsp90 was less intensively stimulated by MC-LR only with significant increase in the 100 ␮g/L group. However, after 7 days of depuration, previous exposure to MC-LR from 0.1 to 100 ␮g/L significantly inhibited hsp90 expression from 0.40- to 0.75- fold.

J. Yuan et al. / Aquatic Toxicology 177 (2016) 8–18

15

Hsp70 expression profile in response to MC-LR is shown in Fig. 6b. After 8 h of exposure, hsp70 expression was down-regulated by MC-LR with significant decrease in 100 ␮g/L MC-LR exposed group (0.14-fold, P < 0.05). From 1 to 7 days of exposure, hsp70 mRNA level increased in 0.1–100 ␮g/L MC-LR exposed groups except for after 4 days of exposure with 0.1 ␮g/L MC-LR. After 2 days of depuration, hsp70 transcript showed significant increases at lower level in all groups. From 5 and 7 days of depuration, hsp70 transcript had no significant changes. The expression profile of hsp60 in response to MC-LR is shown inFig. 6c. Like hsp70 and hsp90, hsp60 expression was inhibited by MC-LR after 8 h of exposure. From 1 to 7 days, hsp60 was upregulated by MC-LR at almost all concentrations, with a smaller increase compared to hsp70 and hsp90. After 2 days of depuration, hsp60 expression was significantly up-regulated 1.38- to 2.36-fold in all groups (P < 0.05). After 5 days of depuration, hsp60 transcript was also significantly increased in the group previously exposed to 10 ␮g/L MC-LR. However, at the end of depuration, hsp60 was significantly suppressed in all groups. 4. Discussion 4.1. Accumulation and elimination of MC-LR in different organs of aquatic animals It is well known that MCs can induce liver cancer and the exposure route of MCs to humans is mainly through drinking water and/or eating freshwater products (Kuiper-Goodman et al., 1999; van der Merwe et al., 2012; Wang et al., 2013). P. clarkii is cultured with high output as an important food in south China and it frequently lives in water polluted with cyanobacterial blooms which produce MCs. So it is essential to analyze the accumulation and elimination dynamics of MCs in P. clarkii to assess its hazard to human health. There were some reports about MC accumulation/depuration dynamics in aquatic organisms (Tricarico et al., 2008; Zhang et al., 2012c; Galanti et al., 2013), but most of them focused on MC concentration in one organism or the whole body. This is the first study comparing the MC-LR accumulation and depuration capability of different tissues in crustacean species, and indicates that MC-LR mostly accumulates in intestine and less in muscle in P. clarkii. The present study suggests that intestine is the main accumulation organ of MC-LR. In this study, MC-LR concentrations in hepatopancreas, gill and muscle of P. clarkii showed a fast decrease after they were transferred to freshwater without MC-LR, which was consistent with the results reported in the freshwater shrimp Palaemonetes argentinus (Galanti et al., 2013). However, in depuration experiment for P. clarkii collected in Massaciuccoli Lake of Italy, the MC content in abdominal muscle showed slow decrease with only about 50% decrease compared to controls in 21 days of depuration (Tricarico et al., 2008). In animal tissues, MCs exists mainly in two forms, covalently bound MCs and methanol-extractable forms (Williams et al., 1997a,b; Yuan et al., 2006). For determination of MC contents, MeOH extraction and Lemieux oxidation methods have proven to be, respectively, suitable for free and covalently bound MCs (Williams et al., 1997a). MC concentration determination in salmon liver and Dugeness crab larvae by MeOH extraction and Lemieux oxidation methods have demonstrated the presence of significant Fig. 6. Effects of MC-LR on hsp mRNA expression in hepatopancreas of male P. clarkii. hsp90 (a) hsp70 (b), hsp60 (c). Crayfish were first exposed to MC-LR at 0.1–100 ␮g/L for 7 days and then depurated in freshwater for another 7 days. Nine crayfish from each group were randomly selected for sampling at each time point (three crayfish from every triplicate tank with a given exposure concentration). The qRT-PCR data were obtained as Ct values. The mRNA amounts for each target gene

were normalized to ˇ-actin. Transcript abundance was expressed relative to that of control group (freshwater without MC-LR). All data were analyzed by the One-way ANOVA and finally indicated as mean ± SD. A Tukey post hoc test was carried out in the data sets with a significant difference. Different small letter superscripts indicate significant difference between different groups (P < 0.05). Analyses were performed with SPSS Statistics 17.0.

16

J. Yuan et al. / Aquatic Toxicology 177 (2016) 8–18

pools of covalently bound MC in vivo (Williams et al., 1997a). In the present study and the previous study of Tricarico et al. (2008) both on P. clarkii, MCs were extracted by MeOH method. Presumably, the much slower decrease of MeOH-extractable MCs in depuration for P. clarkii in the wild exposed to MCs for the whole life history compared to those exposed to MC-LR for short term in laboratory suggests that long-term exposure might result in an increase of covalently bound MC forms and a decrease of methanol-extractable forms in tissues. 4.2. Detoxification in hepatopancreas GSH acts directly as a free radical scavenger and by conjugation to MCs plays an important role in the metabolic pathway leading to MC degradation (Goncalves-Soares et al., 2012). The conjugation is generally considered the primarily route for MC degradation in aquatic organisms. Conjugation increases the polarity of compound, facilitating its excretion (Beattie et al., 2003; Amado et al., 2011). In this study, MC-LR exposure at 0.1–100 ␮g/L from 8 h to 7 days caused a decrease of GSH in time- and concentrationdependent manners in hepatopancreas, suggesting quick and persistent responses of GSH in MC-LR detoxification. Since the GSH content in all groups was still decreased after 2 days of depuration, the persistence of MC-LR in hepatopancreas after short time of depuration could consume GSH. GST is a key enzyme for MC biotransformation by conjugation to GSH. In the present study, GST was activated by MC-LR at all concentrations at the later stage of exposure, which indicated a high metabolism rate of MC-LR. Several studies on other aquatic organisms have shown similar results. Galanti et al. (2013) showed that GST activity increased in hepotopancreas of Palaemonetes argentinus exposed to cyanotoxins. Oberemm et al. (1997) reported that GST activity of Danio rerio embryos was significantly enhanced when the embryos were exposed to 25 ␮g/L MC-LR. In Chasmagnathus granulates gavaged with Microcystis aeruginosa extracts, the GST activity in hepatopancreas was activated (Dewes et al., 2006). In this study, the changes of GST activity had a negative correlation with GSH content during both exposure and depuration. In the early stages (8 h and 1 day) of exposure, Mu-gst mRNA expression was stimulated by higher concentrations of MC-LR, suggesting that the response of Mu-gst transcription to MC-LR is quicker than that of its enzyme activity. In addition, the significant decrease of Mu-gst transcript is in contrast to increased GST activity after 3 days of accumulation and 2 days of depuration. A possible explanation for the results was that GST contains a group of enzymes encoded by several gene subtypes (Omega, Zeta, Mu, Pi, Alpha, Sigma and Kappa) in crustacean species (Boutet et al., 2004; Contreras-Vergara et al., 2004; Rhee et al., 2008; Feng et al., 2010) and the change of Mu-gst transcript cannot represent all transcripts determining the total GST activity. 4.3. Antioxidant response in hepatopancreas More evidences have indicated that MCs can induce oxidative stress to lead to severe adverse effects on cells and tissues (Goncalves-Soares et al., 2012; Hou et al., 2014; Li et al., 2003; Sedan et al., 2010). Antioxidant enzymes, such as SOD, CAT and GPx play an important role in aquatic species in scavenging excess ROS, produced by oxidative stress in order to protect organisms (Amado and Monserrat, 2010; Lushchak, 2011). In recent studies, Pham et al. (2015) reported that SOD and CAT activity in freshwater clam Corbicula leana were elevated in gill and mantle during exposure to toxic cyanobacteria. Burmester et al. (2012) reported that SOD activity in freshwater mussel Dreissena polymorpha was induced in most tissues after exposure to MC-LR, whereas CAT activity was barely affected. In the present study, low concentration of MC-LR (0.1 and 1 ␮g/L) activated or did not affect SOD and

CAT in hepatopancreas at any time of the exposure. However, high concentrations of MC-LR (10 and 100 ␮g/L) increased SOD and CAT activities at the early stages of exposure (SOD: 8 h; CAT: 8 h-3days), and their activities decreased at later stages (SOD: 1–7 days; CAT: 4 and 7 days). During depuration from 2 to 7 days, activities of both SOD and CAT showed increased trend during recovery from exposure to some concentrations or at some time points. The change of CAT activity during MC-LR exposure in this study was in line with a previous study on estuarine crab Chasmagnathus granulates (Pinho et al., 2005), in which CAT activity showed a peak and then a reduction after MC exposure. In a study on bighead carp Aristichthys nobilis exposed to MCs, antioxidant enzymes showed a biphasic activity change with an increase followed by a decrease, suggesting a potential adaption to the oxidative conditions (Li et al., 2010). The increased antioxidant enzyme activities could result from activation of available enzymes, and/or up-regulation of enzyme synthesis (Kaushik and Kaur, 2003). The decrease of their activities might be due to down-regulation of enzyme synthesis or secondary effects such as substrate inhibition of existing molecules (Cazenave et al., 2006). In the present study, changes in Mn-sod and cat transcripts are partially consistent with changes of SOD and CAT activities during exposure and depuration, suggesting that the increase or decrease of SOD and CAT activities at each MC-LR concentration and time point could be due to transcriptional regulation of enzyme synthesis in most cases. The decrease of SOD and CAT activities at later stages of MC-LR treatment at higher concentrations combined with the fast increase of their activities in subsequent depuration suggests that MC-LR even at higher concentrations (10 and 100 ␮g/L) might result in reversible damage of hepatocyte in P. clarkii and the decrease of SOD and CAT activities could be reversible as the MC-LR was removed from water. GPx is an important participant in eliminating and detoxifying excess ROS at the expense of GSH in antioxidant protection (Muthukumar et al., 2011). Consistent with the insensitivity of GPx activity of freshwater shrimp P. argentinus after 3 days of MC-LR exposure (Galanti et al., 2013), this study indicated that GPx activity of P. clarkii did not change significantly under MC-LR treatment for 3 days. However, after 4 days of exposure, 0.1–100 ␮g/L MCLR caused an increase of GPx activity, indicating that GPx enzyme could be activated by prolonged exposure, being involved in regulating GSH metabolism. Interestingly, GPx activity increased during 2 and 5 days of depuration, which was inconsistent with P. argentinus exposed to MC-LR (Galanti et al., 2013). This might be due to different MC-LR detoxification mechanism of different species. The uncoordinated regulation pattern between mRNA expression and enzyme activity for GPx might be due to that the mRNA level of an enzyme gives a snapshot of the transcription of the gene encoding the enzyme at any given time point, whereas enzyme activity may be regulated post-transcriptionally (Li et al., 2008). Meanwhile, it may be relevant to different gene subtypes. In this study, only gpx1 was monitored, which cannot represent all transcripts to determine the total GPx activity. Apart from the gene encoding Gpx1, GPx contains other enzyme subtypes, encoded by gpx2, gpx3 and gpx4 in crustacean species, which can be divided into two main subtypes (selenium-dependent and selenium-independent enzymes) (Liu et al., 2010a,b; Mu et al., 2010; Zhang et al., 2011a). In addition to various antioxidant enzymes, there are convincing data showing the ability of induced HSPs to protect against oxidative stress (Gautier et al., 2001; Won et al., 2015). In the present study, significantly elevated levels of hsp90, hsp70 and hsp60 were observed in the 0.1–100 ␮g/L MC-LR exposure from 1 to 7 days. Markedly stimulated gene expression of hsp70 by MC-LR as early as 1 day indicates that transcription of hsp70 was more sensitive to MC-LR compared to the other two hsp subtypes. The mechanism of up-regulation of hsp genes was thought to be a cellular defense to decrease ROS by increasing the level of GSH (Mehlen et al.,

J. Yuan et al. / Aquatic Toxicology 177 (2016) 8–18

1996), preventing the improper folding of antioxidant enzymes and increasing their levels and activities (Currie and Tanguay, 1991). In addition, HSPs could also protect against oxidative stress-induced apoptosis by functioning at multiple sites in the apoptotic-signaling pathway (Corrido et al., 2001). The present result is consistent with a previous study on zebrafish larvae exposed to MC-LR (Li et al., 2009a, 2009b). 5. Conclusion In the present study, MC-LR was accumulated more in intestine, less in abdominal muscle and gill during 7 days of MC-LR exposure in P. clarkii and eliminated more quickly in gill, abdominal muscle and comparatively slowly in intestine during 7 days of depuration. The fast increase of SOD and CAT activities at early stage, subsequent decrease at later stage of MC-LR exposure, and fast increase during depuration were almost consistent with the transcriptional changes of their respective genes. GPx was activated by longer MCLR exposure and gpx1 mRNA expression showed uncoordinated regulation pattern compared with its enzyme. Hsp genes were upregulated in P. clarkii exposed to MC-LR. Conflicts of interests There are no conflicts of interests in this paper. Acknowledgments The work was supported by the Special Fund for Agro-scientific Research in the Public Interest, China (No.201003070). Reference: Amado, L.L., Monserrat, J.M., 2010. Oxidative stress generation by microcystins in aquatic animals: why and how. Environ. Int. 36, 226–235. Amado, L.L., Garcia, M.L., Ramos, P.B., Yunes, J.S., Monserrat, J.M., 2011. Influence of a toxic Microcystis aeruginosa strain on glutathione synthesis and glutathione-S-transferase activity in common carp Cyprinus carpio. Arch. Environ.Contam. Toxicol 60, 319–326. Beattie, K.A., Ressler, J., Wiegand, C., Krause, E., Codd, G.A., Steinbergd, C.E.W., Pfluglnacher, S., 2003. Comparative effects and metabolism of two microcystins and nodularin in the brine shrimp Artemia salina. Aquat. Toxicol. 62, 219–226. Bieczynski, F., Bianchi, V.A., Luquet, C.M., 2013. Accumulation and biochemical effects of microcystin-LR on the Patagonian pejerrey (Odontesthes hatcheri) fed with the toxic cyanobacteria Microcystis aeruginosa. Fish Physiol. Biochem. 39, 1309–1321. Bieczynski, F., Anna, J.S.D., Pirez, M., 2014. Cellular transport of microcystin-LR in rainbow trout (Oncorhynchus mykiss) across the intestinal wall: possible involvement of multidrug resistance-associated proteins. Aquat. Toxicol. 154, 97–106. Boutet, I., Tanguy, A., Moraga, D., 2004. Characterization and expression for four mRNA sequences encoding glutathione S-transferase pi mu, omega and sigma classes in the Pacific oyster Crassostrea gigsa exposed to hydrocarbons and pesticides. Mar. Biol. 146, 53–64. Bradford, M.M., 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Burmester, V., Nimptsch, J., Wiegand, C., 2012. Adaptation of freshwater mussels to cyanobacterial toxins: response of biotransformation and antioxidant enzymes. Ecotoxicol. Environ. Safe. 78, 296–309. Cadenas, E., 1989. Biochemistry of oxygen toxicity. Annu. Rev. Biochem. 58, 79–110. Cazenave, J., Bistoni, D., Pesce, S.E., Wunderlin, D.A., 2006. Differential detoxification and antioxidant response in diverse organs of Corydoras paleatus experimentally exposed to microcystin-RR. Aquat. Toxicol. 76, 1–12. Contreras-Vergara, C.A., Harris-Valle, C., Sotelo-Mundo, R.R., Yepiz-Plascencia, G., 2004. A mu-class glutathione S-transferase from the marine shrimp Litopenaeus vannamei: molecular cloning and active-site structure modeling. J. Biochem. Mol. Toxicol. 18, 245–252. Corbel, S., Mougin, C., Martin-Laurent, F., Crouzet, O., Bru, D., Nélieu, S., Bouaïcha, N., 2015. Evaluation of phytotoxicity and ecotoxicity potentials of a cyanobacterial extract containing microcystins under realistic environmental concentrations and in a soil–plant system. Chemosphere 128, 332–345. Corrido, C., Curbuxani, S., Ravagnan, L., Kroemer, G., 2001. Heat shock proteins: endogenous modulators of apoptotic cell death. Biochem. Biophys. Res. Commun. 286, 433–442.

17

Currie, R., Tanguay, R., 1991. Analysis of RNA for transcripts for catalase and HSP70 in rat hearts after in vivo hyperthermia. Biochem. Cell Biol. 69, 375–382. Deblois, C.P., Gianit, A., Bird, D.F., 2011. Experimental model of microcystin accumulation in the liver of Oreochromis niloticus exposed subchronically to a toxic bloom of Microcystis sp. Aquat. Toxicol. 103, 63–70. Dewes, L.J., Sandrini, J.Z., Monserrat, J.M., Yunes, J.S., 2006. Biochemical and physiological responses after exposure to microcystin in the crab Chasmagnathus granulated. Ecotoxicol. Environ. Safe. 65, 201–208. Ding, W., Shen, H., Ong, C.N., 2001. Critical role of reactive oxygen species formation in microcystin-induced cytoskeleton disruption in primary cultured hepatocytes. J. Toxicol. Environ. Health. 64, 507–509. Feng, B., Dong, L., Niu, D., Meng, S., Zhang, B., Liu, D., Hu, S., Li, J., 2010. Identification of immune genes of the Agamaki Clam (Sinonovacula constricta) by sequencing and bioinformatic analysis of ESTs. Mar. Environ. Res. 58, 1–17. Fischer, W.J., Altheimer, S., Cattori, V., Meier, P.J., Dietrich, D.R., Hagenbuch, B., 2005. Organic anion transporting polypeptides expressed in liver and brain mediate uptake of microcystin. Toxicol. Appl. Pharmacol. 203, 257–263. Galanti, L.N., Amé, M.V., Wunderlin, D.A., 2013. Accumulation and detoxification dynamics of cyanotoxins in the freshwater shrimp Palaemonetes argentinus. Harmful Algae 27, 89–97. Gautier, J.P., Holzhaeuser, D., Markovic, J., Germaud, E., Schilter, B., Turesky, R.J., 2001. Oxidative damage and stress response from ochratoxin: an exposure in rats. Free Rad. Biol. Med. 30, 1089–1098. Goncalves-Soares, D., Zanette, J., Yepiz-Plascencia, G.M., Bainy, A.C.D., 2012. Expression and activity of glutathione S-transferases and catalase in the shrimp Litopenaeus vannamei inoculated with a toxic Microcystis aeruginosa strain. Marine Environ. Res. 17, 54–61. Guzmán-Guillén, R.A., Prieto, I., Moreno, I., Ríos, V., Vasconcelos, V.M., Cameán, A.M., 2014. Effects of depuration on oxidative biomarkers in tilapia (Oreochromis niloticus) after subchronic exposure to cyanobacterium producing cylindrospermopsin. Aquat. Toxicol. 149, 40–49. Hou, J., Li, L., Xue, T., Long, M., Su, Y., Wu, N., 2014. Damage and recovery of the ovary in female zebrafish i.p.-injected with MC-LR. Aquat. Toxicol. 155, 110–118. Ikehara, T., Nakashima, J., Nakashima, S., Yasumoto, T., 2015. Different responses of primary normal human hepatocytes and human hepatoma cells toward cyanobacterial hepatotoxin microcystin-LR. Toxicon 105, 4–9. Jiang, J., Gu, X., Song, R., Zhang, Q., Geng, J., Wang, X., Yang, L., 2011. Time-dependent oxidative stress and histopathological changes in Cyprinus carpio L. exposed to microcystin-LR. Ecotoxicology 20, 1000–1009. Johnson, J.W.B., Avault, J.J.W., 1982. Effects of poultry waste supplementation to rice-crayfish (Orysa sativa-Procambarus clarkii) culture ponds. Aquaculture 29, 109–123. Jos, Á., Pichardo, S., Prieto, A.I., Repetto, G., Vázquez, C.M., Moreno, I., Cameán, A.M., 2005. Toxic cyanobacterial cells containing microcystins induce oxidative stress in exposed tilapia fish (Oreochromis sp.) under laboratory conditions. Aquat. Toxicol. 72, 261–271. Kaushik, S., Kaur, J., 2003. Chronic cold exposure affects the antioxidant defense system in various rat tissues. Clin. Chim. Acta 333, 69–77. Khalloufi, F.E.I., Oufdou, K., Lahrouni, M., Faghire, M., Peix, A., Ramírez-Bahena, M.H., Vasconcelos, V., Oudra, B., 2013. Physiological and antioxidant responses of Medicago sativa-rhizobia symbiosis to cyanobacterial toxins (Microcystins) exposure. Toxicon 15, 167–177. Kuiper-Goodman, T., Falconer, I., Fitzgerald, J., 1999. Human health aspect. In: Chros, Bartram (Ed.), Toxic Cyanobacteria in Water: A Guide to Their Public Health Consequences, Monitoring and Management. World Health Organism, E&F N Spon, London/Routledge, pp. 113–153. Lance, E., Brient, L., Carpentier, A., Acou, A., Marion, L., Bormans, M., Gérard, C., 2010. Impact of toxic cyanobacteria on gastropods and microcystin accumulation in a eutrophic lake (Grand-Lieu, France) with special reference to Physa acuta. Sci. Total Environ. 408, 3560–3568. Li, X., Liu, Y., Song, L., Liu, J., 2003. Responses of antioxidant systems in the hepatocytes of common carp (Cyprinus carpio L.) to the toxicity of microcystin-LR. Toxicon 42, 85–89. Li, G., Xie, P., Fu, J., Hao, L., Xiong, Q., Li, H., 2008. Microcystin-induced variations in transcription of GSTs in an omnivorous freshwater fish, goldfish. Aquat. Toxicol. 88, 75–80. Li, H., Xie, P., Zhang, D., Chen, J., 2009a. The first study on the effects of microcystin-RR on gene expression profiles of antioxidant enzymes and heat shock protein-70 in Synechocystis sp. PCC6803. Toxicon 53, 595–601. Li, Y., Sun, B., Wu, H., Nie, P., 2009b. Effects of pure microcystin-LR on the transcription of immune related genes and heat shock proteins in larval stage of zebrafish (Danio rerio). Aquaculture 289, 154–160. Li, L., Xie, P., Guo, L., 2010. Antioxidant response in liver of the phytoplanktivorous bighead carp (Aristichthys nobilis) intraperitoneally-injected with extracted microcystins. Fish Physiol. Biochem. 36, 165–172. Liu, Y., Wang, J., Wei, Y., Zhang, H., Xu, M., Dai, J., 2008. Induction of time-dependent oxidative stress and relative transcriptional effects of perfluorododecanoic acid in zebrafish liver. Aquat. Toxicol. 89, 242–250. Liu, C., Tseng, M., Cheng, W., 2010a. Identification and cloning of the antioxidant enzyme glutathione peroxidase, of white shrimp, Litopenaeus vannamei, and its expression following Vibrio alginolyticus infection. Fish Shellfish Immunol. 23, 34–45. Liu, K., Yeh, M., Kou, G., Cheng, W., Lo, C., 2010b. Identification and cloning of a selenium-dependent glutathione peroxidase fromtiger shrimp Penaeus

18

J. Yuan et al. / Aquatic Toxicology 177 (2016) 8–18

monodon, and its transcription following pathogen infection and related to the molt stages. Dev. Comp. Immunol. 34, 935–944. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(−DeltaDeltaC(T)) method. Methods 25, 402–408. Lushchak, V.L., 2011. Environmentally induced oxidative stress in aquatic animals. Aquat. Toxicol., 13–30. Mehlen, P., Kretz-Remy, C., Preville, X., Arrig, A., 1996. Human Hsp 27, Drosophila Hsp27 and human alpha B crystallin expression–mediated increase in glutathione is essential for the protective activity of these proteins against TNF alpha-induced cell death. EMBO J. 15, 2695–2706. Mu, C., Ni, D., Zhao, J., Wang, L., Song, L., Li, L., Zhang, H., Qiu, L., Cong, M., 2010. cDNA cloning and mRNA expression of a selenium-dependent glutathione peroxidase from Zhikong scallop Chlamys farreri. Comp. Biochem. Physiol. B 157, 182–188. Muthukumar, K., Rajakumar, S., Sarkar, M.N., Nachiappan, V., 2011. Glutathione peroxidase 3 of Saccharomyces cerevisiae protects phospholipids during cadmium-induced oxidative stress. Anton Van Leeuwenhoek 99, 761–771. Oberemm, A., Fastner, J., Steinberg, C., 1997. Effects of microcystin-LR and cyanobacterial crude extracts on embryo-larval development of zebrafish (Danio rerio). Water Res. 31, 2918–2921. Ortiz-Rodríguez, R., Wiegand, C., 2010. Age related acute effects of microcystin-LR on Daphnia magna biotransformation and oxidative stress. Toxicon 56, 1342–1349. Paskerová, H., Hilscherová, K., Bláha, L., 2012. Oxidative stress and detoxification biomarker responses in aquatic freshwater vertebrates exposed to microcystins and cyanobacterial biomass. Environ. Sci. Pollut. Res. 19, 2024–2037. Pearson, L., Mihali, T., Moffitt, M., Kellmann, R., Neilan, B., 2010. On the chemistry toxicology and genetics of the cyanobacterial toxins, microcystin, nodularin saxitoxin and cylindrospermopsin. Mar. Drugs 8, 1650–1680. Pham, T., Shimizu, K., Dao, T., Hong-Do, L., Utsumi, M., 2015. Microcystin uptake and biochemical responses in the freshwater clam Corbicula leana P. exposed to toxic and non-toxic Microcystis aerugenosa: Evidence of tolerance to cyanotoxins. Toxicol. Rep. 2, 88–98. Pinho, G.L.L., Rosa, C.M., Maciel, F.E., Bianchini, J.S., Yunes, L.A.O., Proenc¸a, J.M.M., 2005. Antioxidant responses and oxidative stress after microcystin exposure in the hepatopancreas of an estuarine crab species. Ecotoxicol. Environ. Safe. 61, 353–360. Qian, Z., Liu, T., Liu, Q., He, S., Liu, Y., Hou, F., Wang, X., Mi, X., Cai, C., Liu, X., 2014. P53 is involved in shrimp survival via its regulation roles on MnSOD and GPx in response to acute environmental stress. Comp. Biochem. Physiol. C 159, 38–51. Rhee, J.S., Raisuddin, S., Hwang, D.S., Horiguchi, T., Cho, H.S., 2008. A mu-class glutathione S-transferase (GSTM) from the rock shell Thais clavigera. Comp. Biochem. Physiol. C 146, 471–477. Romero-Oliva, C.S., Valeska, C.J., Pflugmacher, S., 2015. Antioxidative response of the three macrophytes Ceratophyllum demersum, Egeria densa and Hydrilla verticillata to a time dependent exposure of cell-free crude extracts containing three microcystins from cyanobacterial blooms of Lake Amatitlán. Guatemala. Aquat. Toxicol. 163, 130–139. Sørensen, J.G., Kristensen, T.N., Loeschcke, V., 2003. The evolutionary and ecological role of heat shock proteins. Ecol. Lett. 6, 1025–1037. Sabatini, S.E., Brena, B.M., Luquet, C.M., Julián, M.S., Pirez, M., Molina, M.C.R., 2011. Microcystin accumulation and antioxidant response in the freshwater clam Diplodon chilensis patagonicus upon subchronic exposure to toxic Microcystis aeruginosa. Ecotoxicol. Environ. Safe. 74, 1188–1194. Sabatini, S.E., Brena, B.M., Pirez, M., Molina, M.C.R., Luquet, C.M., 2015. Oxidative effects and toxin bioaccumulation after dietary microcystin intoxication in the hepatopancreas of the crab Neohelice (Chasmagnathus)granulata. Ecotoxicol. Environ. Safe. 120, 136–214. Sedan, D., Andrinolo, D., Telese, L., Giannuzzi, L., Alaniz, M.J.T., Marra, C.A., 2010. Alteration and recovery of the antioxidant system induced by sub-chronic

exposure to microcystin-LR in mice: its relation to liver lipid composition. Toxicon 55, 333–342. Sun, H., Lü, K., Minterc, E.J.A., Chen, Y., Yang, Z., Montagnes, D.J.S., 2012. Combined effects of ammonia and microcystin on survival, growth, antioxidant responses, and lipid peroxidation of bighead carp Hypophthalmythys nobilis larvae. J. Hazard. Mater. 221/222, 213–219. Toivola, D.M., Eriksson, J.E., Brautigan, D.L., 1994. Identification of protein phosphatase 2A as the primary target for microcystin-LR in rat liver homogenates. FEBS Lett. 344, 175–180. Tricarico, E., Bertocchi, S., Brusconi, S., Casalone, E., Gherardi, F., Giprgi, G., Mastromei, G., Parisi, G., 2008. Depuration of microcystin-LR from the red swamp crayfish Procambarus clarkii with assessment of its food quality. Aquaculture 285, 90–95. van der Merwe, D., Sebbag, L., Nietfeld, J.C., Aubel, M.T., Foss, A., Carney, E., 2012. Investigation of a Microcystis aeruginosa cyanobacterial freshwater harmful algal bloom associated with acute microcystin toxicosis in a dog. J. Vet. Diagn. Invest. 24, 679–687. Wang, X., Chen, Y., Zuo, X., Ding, N., Zeng, H., Zou, X., Han, X., 2013. Microcystin (-LR) induced cell apoptosis via up-regulating apoptosis-related genes in vivo. Food Chem.Toxicol. 60, 309–317. Wiegand, C., Pflugmacher, S., 2005. Ecotoxicological effects of selected cyanobacterial secondary metabolites a short review. Toxicol. Appl. Pharmacol. 203, 201–218. Williams, D.E., Craig, M., Dawe, S.C., Kent, M.L., Andersen, R.J., Holmes, C.F.B., 1997a. C-14- Labeled microcystin-LR administered to Atlantic salmon via intraperitoneal injection provides in vivo evidence for covalent binding of microcystin-LR in salmon livers. Toxicon 35, 985–989. Williams, D.E., Dawe, S.C., Kent, M.L., Andersen, R.J., Craig, M., Holmes, C.F.B., 1997b. Bioaccumulation and clearance of microcystins from salt water mussels, Mytilus edulis, and in vivo evidence for covalently bound microcystins in mussel tissues. Toxicon 35, 1617–1625. Won, E., Han, J., Lee, Y., Kumar, K., Shin, K., Lee, S., Park, H., Lee, J., 2015. In vivo effects of UV radiation on multiple endpoints and expression profiles of DNA repair and heat shock protein (Hsp) genes in the cycloid copepod Paracyclopina nana. Aquat.Toxicol. 165, 1–8. Xie, L., Xie, P., Guo, L., Li, L., Miyabara, Y., Park, H., 2005. Organ distribution and bioaccumulation of microcystins in freshwater fish at different trophic levels from the eutrophic Lake Chaohu, China. Environ. Toxicol. 20, 293–300. Yuan, M., Carmichael, W.W., Hilborn, E.D., 2006. Microcystin analysis in human sera and liver from human fatalities in Caruaru, Brazil, 1996. Toxicon 48, 627–640. Zastepa, A., Pick, F.R., Blais, J.M., Saleem, A., 2015. Analysis of intracellular and extracellular microcystin variants in sediments and pore waters by accelerated solvent extraction and high performance liquid chromatography-tandem mass spectrometry. Anal. Chim. Acta. 872, 26–34. Zhang, L., Liu, X., Chen, L., You, L., Pei, D., Cong, M., Zhao, J., Li, C., Liu, D., Yu, J., Wu, H., 2011a. Transcriptional regulation of selenium-dependent glutathione peroxidase from Venerupis philippinarum in response to pathogen and contaminants challenge. Fish Shellfish Immunol. 31, 831–837. Zhang, M., Wang, Z., Xu, J., Liu, Y., Ni, L., Cao, T., Xie, P., 2011b. Ammonium, microcystins, and hypoxia of blooms in eutrophic water cause oxidative stress and C-N imbalance in submersed and floating-leaved aquatic plants in Lake Taihu, China. Chemosphere 82, 329–336. Zhang, B., Yang, G., Yu, X., Mao, H., Xing, C., Liu, J., 2012a. Haff disease after eating crayfish in east China. Intern. Med. 51, 487–489. Zhang, D., Yang, Q., Xie, P., Deng, X., Chen, J., Dai, M., 2012b. The role of cysteine conjugation in the detoxification of microcystin-LR in liver of bighead carp (Aristichthys nobilis): a field and laboratory study. Ecotoxicology 21, 244–252. Zhang, J., Wang, Z., Song, Z., Xie, Z., Li, L., Song, L., 2012c. Bioaccumulation of microcystins in two freshwater gastropods from a cyanobacteria-bloom plateau lake, Lake Dianchi. Environ. Poll. 164, 227–234.