Akirin2 homologues from rock bream, Oplegnathus fasciatus: Genomic and molecular characterization and transcriptional expression analysis

Fish & Shellfish Immunology 35 (2013) 740e747

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Akirin2 homologues from rock bream, Oplegnathus fasciatus: Genomic and molecular characterization and transcriptional expression analysis Saranya Revathy Kasthuri a, Navaneethaiyer Umasuthan a, Ilson Whang a, *, Qiang Wan a, Bong-Soo Lim b, Hyung-Bok Jung b, Jehee Lee a, b, * a

Department of Marine Life Sciences, School of Marine Biomedical Sciences, Jeju National University, Jeju Self-Governing Province 690-756, Republic of Korea Marine and Environmental Institute, Jeju National University, Jeju Special Self-Governing Province 690-814, Republic of Korea

b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 6 January 2013 Received in revised form 8 May 2013 Accepted 3 June 2013 Available online 13 June 2013

Akirins are conserved nuclear resident NF-kB signaling pathway molecules. Isoforms of akirins found in various organisms are known to play diverse roles. In this study, we have characterized two akirin2 homologues from rock bream, OfAk2(1) and OfAk2(2). The proteins derived from OfAk2(1) and OfAk2(2) revealed the presence of nuclear localization signal. Multiple sequence alignment and pairwise alignment of OfAk2(1) and OfAk2(2) with the akirin homologues, revealed high conservation and identity. Phylogenetic tree analysis revealed that the distinct position of OfAk2(1) and OfAk2(2) was close to the fish homologues and separated from the mammals and invertebrates. Genomic structure characterization revealed two distinct structures. OfAk2(1) possessed 6 exons interrupted by 5 introns whereas OfAk2(2) possessed 5 exons interrupted by 4 introns. The promoter analysis revealed the presence of significant transcription factors, which suggests its regulation by diverse stimuli. In addition, transcript expression analysis using real time quantitative reverse-transcriptase polymerase chain reaction post immune challenges with lipopolysaccharide, Edwardsiella tarda and poly I:C revealed upregulation of both OfAk2(1) and OfAk2(2) in liver, spleen and head kidney. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: Akirin Genomic structure Promoter analysis Expression analysis Immune challenges

1. Introduction Innate immune pathogen recognition through the conserved PAMPs is accomplished by the limited number of non-clonally distributed germ-line encoded pathogen recognition receptors (PRRs), of which toll-like receptors (TLRs) are exclusively investigated [1e3]. PRR recognition of the PAMPs leads to various downstream signaling cascades and activation of genes encoding immune mediator molecules like cytokines and anti-microbial peptides (AMPs), leading to the destruction of the invading pathogens [4]. The entire process depends on a number of inducible transcription factors, among which the evolutionarily conserved NF-kB plays a decisive role in triggering and coordination of innate

* Corresponding authors. Marine Molecular Genetics Lab, Department of Marine Life Sciences, College of Ocean Science, Jeju National University, 66 Jejudaehakno, AraDong, Jeju 690-756, Republic of Korea. Tel.: þ82 64 754 3472; fax: þ82 64 756 3493. E-mail addresses: [email protected] (I. Whang), [email protected], [email protected] (J. Lee). 1050-4648/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2013.06.006

and adaptive immune responses and also is a crucial regulator of stress responses, apoptosis and differentiation [5]. A significant molecule like NF-kB is under tight regulation at both the transcriptional level and post translational modifications [6e8]. Activation of NF-kB in the immune pathways by diverse stimuli, its role in the regulation of many genes, generation of distinct transcriptional responses in particular tissues/organs, and its dysregulation in various diseases has raised intriguing questions on its mechanism of action leading to intense research, since the day of its discovery [9], resulting in the innovation of new regulators of NF-kB like akirins. Akirins are conserved nuclear proteins, first discovered in Drosophila melanogaster, engaged in the immune deficiency (Imd) pathway leading to the synthesis of AMPs against the invasion of Gram-negative bacteria [10]. Akirins also possess diverse functions and are classified into five groups based on function [11e14]. An akirin homologue from Aedes albopictus was identified as a vaccine candidate to control mosquito and sand fly infestations [15]. Akirins’ function during innate immune/inflammatory response, at the level of transcription factor NF-kB, in mice and Drosophila, and downstream activation of genes for immune agility like cytokine IL-6 in

S.R. Kasthuri et al. / Fish & Shellfish Immunology 35 (2013) 740e747

mammals have been studied [10]. Many vertebrates including humans, African western clawed frog, mouse and zebrafish were found to have two homologs (akirin1 and akirin2) whereas only one was found in insects and chicken; no akirin homologs were found in plants, yeast or bacteria [10]. The earlier studies in fish were about the evolutionary emergence of akirin genes, and genomic organization in fish [16]. These studies revealed that the introneexon structure of metazoan akirin genes were formed preliminary to bilateria development and a single orthologue duplicated in the vertebrates leading to the formation of akirin1 and akirin2. Further duplication of akirins in teleost lineage led to lineage-specific patterns of paralogues loss. Macqueen et al. showed the higher expression of akirin genes by RT-PCR, along with the catabolic genes coding the NF-kB p65 subunit, E2 ubiquitin-conjugating enzymes, E3 ubiquitin ligases, and IGF-I receptors [17]. The immunological relevance of akirin in teleosts was revealed when an akirin1 isoform was characterized from Scophthalmus maximus and its transcriptional expression patterns post immune challenges were discussed by Yang et al. [18]. In this study, we report the rescue and characterization of two akirin2 genes which possess a variation of 30% at the amino acid level, from rock bream Oplegnathus fasciatus, designated as Ofakirin2(1) [OfAk2(1)] and Ofakirin2(2) [OfAk2(2)]. Also, we have analyzed the transcriptional expression patterns of OfAk2 genes post immune challenges. The genomic characterization, elevated expression pattern post challenges suggests their involvement in immune related function in rock bream. 2. Materials and methods 2.1. Animal rearing, cDNA library construction, OfAk2 genes identification A cDNA GS-FLX shotgun library was created as described earlier [19]. Two cDNA contigs, homologous to the earlier defined akirin sequences were rescued from the cDNA library and confirmed by homology screening by BLAST (http://blast.ncbi.nlm.nih.gov/Blast) and designated OfAk2(1) and OfAk2(2). 2.2. BAC library creation and identification of BAC clone Rock bream were obtained from the Jeju Special SelfGoverning Province Ocean and Fisheries Research Institute (Jeju, Republic of Korea). Blood was harvested aseptically from the caudal fin using a sterile 1 mL syringe with 22 gauge needles, and a BAC library was constructed from the isolated blood cells (Lucigen Corp., USA). Briefly, genomic DNA obtained from blood cells was randomly sheared and the blunt ends of large inserts (>100 kb) were ligated to pSMART BAC vector to obtain an unbiased, full coverage library. Around 92,160 clones, possessing an average insert size of 110 kb, were arrayed in 240 microtiter plates with 384 wells. A two-step PCR based screening method was used to identify the clone of interest based on manufacturer’s instructions. A gene specific clone was isolated and purified using Qiagen Plasmid Midi Kit (Hidden, Germany). The sequence was confirmed by pyrosequencing (GS-FLX titanium sequencing, Macrogen, Republic of Korea). The genomic sequence of Ofak(1) and Ofak(2) were determined by aligning the full length cDNA using the Spidey program available on NCBI (http://www.ncbi.nlm.nih.gov/spidey/). The gene specific primers (50 e30 ) used in the identification of the clone from the BAC library were (F)ATGAATGTTTCCAGCATGCCAGGG and (R) CCTTTCTTTCAGCAGGCGTTCACA for OfAk2(1); (F) TCGATCCTCTAATGAGCTCGGCTT and (R) GCCGCTTGTACTCCTGTTTGATGT for OfAk2(2).

741

2.3. Sequence characterization of OfAk2 genes The full length cDNA sequences of OfAk2(1) and OfAk2(2) were analyzed using BLAST and confirmed by comparing with akirin homologues reported in other organisms. DNAssist2.2 was used to predict the open reading frame (ORF) and translate nucleotide to protein. Nuclear localization signal (NLS) was predicted using PSORT II server (http://psort.ims.u-tokyo.ac.jp). ClustalW was used to perform pairwise alignment and multiple sequence alignment (MSA) [20]. Phylogenetic analysis was performed using minimum evolution method in MEGA 5.0. [21]. The stability and accuracy of inferred topologies were assessed via bootstrap analysis of 5000 replications. The amino acid identity percentages were calculated by MatGAT program using default parameters [22]. The transcription factor binding sites (TFBs) in the promoter region were predicted using TFSEARCH, TESS and TRANSFAC. The exoneintron structure was determined by aligning mRNA to the genomic sequences of OfAk2 obtained from the BAC library using Spidey available on NCBI (http://www.ncbi.nlm.nih.gov/spidey/) [23]. The mRNA and genomic sequences used for the comparison of the genome structures were evaluated from the sequences obtained from GenBank. 2.4. Expression profile of OfAk2 genes in normal and challenged tissues 2.4.1. LPS, poly I:C and bacterial challenge To evaluate the defense responses of Ofak(1) and Ofak(2), we performed an in vivo time course experiment with immunostimulants like lipopolysaccharide (LPS), poly I:C, and Edwardsiella tarda. For LPS challenge, purified LPS from Escherichia coli (055:B5; Sigma) was dissolved in PBS and intraperitoneally administered at the rate of 125 mg per fish (w50 g). For bacterial challenge, fish were intraperitoneally (i.p.) injected with live E. tarda (5  103 CFU/ml) suspended in 1 phosphate buffered saline (PBS; 100 ml/animal). In brief, the E. tarda strain was obtained from the department of aquatic life medicine, Chonnam national university, Republic of Korea, and cultured in BHIS (Brain Heart Infusion with Saline) broth at 25  C for 12 h. The culture was then centrifuged at 7000 g at 4  C for 5 min and the supernatant was discarded. The bacterial pellet was resuspended in PBS and diluted to appropriate concentrations and used for the challenge experiments. For poly I:C challenge, animals were intraperitoneally injected with a 100 ml suspension of poly I:C in PBS (1.5 mg/ml; Sigma). For all the above challenges, PBS-injected animals were used as controls. Liver, spleen and head kidney tissues from the un-injected, PBS-injected and immune challenged animals were collected at time points of 3, 6, 12, 24, and 48 h post injection/infection (p.i.). 2.4.2. RNA isolation and cDNA synthesis To determine the expression pattern of OfAk2 genes, gills, liver, heart, brain, kidney, head kidney, spleen, intestine, muscle and skin tissues and blood cells from un-injected fish were harvested and total RNA isolation, quantification and dilution were performed as described earlier [19]. After challenge, liver, spleen and head kidney tissues were harvested from PBS-injected and immune-challenged animals at the corresponding time points. Then, 2.5 mg of RNA was used to synthesize cDNA from each tissue using a PrimeScriptÔ first strand cDNA synthesis kit (TaKaRa). Concisely, RNA was incubated with 1 ml of 50 mM oligo(dT)20 and 1 ml of 10 mM dNTPs for 5 min at 65  C. After incubation, 4 ml of 5 PrimeScriptÔ buffer, 0.5 ml of RNase inhibitor (20 U), 1 ml of PrimeScriptÔ RTase (200 U), were added and incubated for 1 h at 42  C. The reaction was terminated by adjusting the temperature to 70  C for 15 min. Finally, synthesized cDNA was diluted 40-fold before storing at 20  C.

742

S.R. Kasthuri et al. / Fish & Shellfish Immunology 35 (2013) 740e747

2.4.3. Tissue distribution Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to examine tissue distribution of OfAk2 mRNAs in tissues (Section 2.4.2) of healthy fish with gene specific primers (50 e30 ) (Section 2.2) and b-actin (Accession No. FJ975145; F: TCATCACCATCGGCAATGAGAGGT and R: TGATGCTGTTGTAGGTGGTCTCGT). qRT-PCR was performed in a 15 ml reaction volume containing 4 ml of diluted cDNA, 7.5 ml of 2 SYBR Green Master Mix, 0.6 ml of each primer (10 pmol/ml) and 2.3 ml of PCR grade water and subjected to the following conditions: one cycle of 95  C for 3 min, amplification for 35 cycles of 95  C for 20 s, 58  C for 20 s, 72  C for 30 s. The baseline was set automatically by the Thermal Cycler DiceÔ Real Time System software (version 2). In order to confirm that a single product was amplified by the primer pair used in the reaction, a dissociation curve was generated at the end of the reaction by heating from 60  C to 90  C, with a continuous registration of changes in fluorescent emission intensity. The Ct for the akirin genes (target) and b-actin (internal control) were determined for each sample. The differences between the target and internal control Ct, called DCt were calculated to normalize the differences in the amount of total cDNA added to each reaction and the efficiency of the RT-PCR. The DCt for each sample was subtracted from DCt of the calibrator and this difference was called DDCt. The Ofakirin2 gene expression was determined by Livak comparative Ct method. The PCR efficiency of the primers used in the assay was calculated using the Ct slope method and was determined to be in the favorable range of 95e105%. The relative expression level calculated in each tissue was compared with respective expression level in muscle. 2.4.4. Temporal OfAk2 mRNA expression analysis post immune challenges To investigate the expression of OfAk2 transcripts after immune challenges, expression was analyzed in PBS-injected and immunechallenged fish by qRT-PCR, with the gene specific oligos. Studies were performed in liver, head kidney and spleen tissues isolated from LPS, poly I:C, and E. tarda challenged animals. qRT-PCR conditions were the same as used for tissue distribution profiling. The DCt for each sample was determined by the method described above and subtracted from DCt of the un-injected control and this difference was called DDCt. The relative expression of OfAk2 was determined by the Livak method. The relative fold change in expression after immune challenges was obtained by comparing the relative expression to corresponding PBS-injected controls. The expression normalized to PBS-injected controls is represented in the figures. All data have been presented in terms of relative mRNA expressed as means  standard deviation (S.D.). All experiments were performed in triplicate. Statistical analysis was performed using un-paired two-tailed Student’s t-Test. P-values of less than 0.01 were considered to indicate statistical significance. 3. Results and discussion 3.1. Sequence characterization of OfAk2 genes, multiple sequence alignment and phylogenetic studies In this study, two full length cDNA sequences corresponding to rock bream OfAk2(1) and OfAk2(2) were identified by homology screening using BLAST and ORF was confirmed by cloning. The molecular characteristics of OfAk2(1) and OfAk2(2) are compiled in Table 1. The complete cDNA sequence and predicted amino acid sequence of OfAk2(1) and OfAk2(2) are presented in Supplementary Fig. 1A and B, respectively. Analysis of the protein sequence for the motifs, domains and signal peptide, revealed the absence of a signal peptide, indicating it to be a non-secretory protein. The presence of

Table 1 Compilation of characteristic features of OfAk2 isoforms. Features

OfAk2(1)

OfAk2(2)

GenBank accession number Length of cDNA Open reading frame (ORF) 50 UTR 30 UTR Poly A tail (position denoted from TIS) RNA instability motif Amino acids Molecular mass of protein Isoelectric point of protein Signal peptide Nuclear localization signal (NLS) Second NLS Genome size Number of exons Number of introns

JQ780820 1613 555 bp 408 bp 650 bp 2810 AATAAA2815 1511 ATTTA1516 184 21 kDa 8.9 Nil 19 PTSPKRRRCI28 Nil 2851 bp 6 5

KC436005 1731 bp 540 bp 561 bp 630 bp 4467 AATAAA4472 1343 ATTTA1347 179 20 kDa 9.1 Nil 19 SASPKRRRCA28 73 KRRH76 4458 bp 5 4

a 10-peptide NLS in the N-terminal region in both OfAk2(1) (19PTSPKRRRCI28) and OfAk2(2) (19SASPKRRRCA28), approved its presence in the nucleus. A putative second NLS was observed in OfAk2(2) (73KRRH76), but was absent in OfAk2(1). The OfAk2(1) and OfAk2(2) possessed a variation of 30% at the amino acid level (Fig. 1). The derived molecular masses of the OfAk2(1)and OfAk2(2) proteins were 21 kDa and 20 kDa, respectively, consistent with molecular mass of akirin2 homologues from other fish species. Although, it is traditional that akirin is a nuclear protein, an akirin1 gene of C2C12 myoblasts was found to be expressed in both the nucleus and cytoplasm [24]. The presence of a second NLS in one of the OfAk2 protein (OfAk2(2)), similar to that in invertebrates and its absence in the other suggests that the extra NLS may enhance the transport of OfAk2(2) to the nucleus, while OfAk2(1) may elicit its function in the cytoplasm. In order to elucidate the evolutionary conservation, multiple polypeptide sequence alignment was performed with akirin2 homologues from different species. Overall, a high degree of conservation was observed in the N- and C-terminal regions with a little conservation in the middle region (Supplementary Fig. 2). The addition of amino acid residues in the mammals may have certain evolutionary significance whose function is yet to be proven. Pairwise alignment revealed higher identity and similarity of OfAk2(1) with that of Salmo salar (89% and 93%, respectively), while OfAk2(2) showed higher identity and similarity with Danio rerio (80% and 91%, respectively) (Supplementary Table 1). Phylogenetic analysis of OfAk2(1) and OfAk2(2), with an invertebrate akirin placed separated from the vertebrate clade, indicated the emergence of akirin1 and akirin2 from a common ancestor. Also, OfAk2(1) and OfAk2(2) were placed in the akirin2 cluster along with other fish species, with high bootstrap values, confirming the evolutionary conservation, yet maintaining a distinct identity in rock bream (Supplementary Fig. 3). In the akirin1 and akirin2 clades, two different clusters belonging to fish and other vertebrates could be observed. In the fish cluster, akirin could be found as two isoforms as akirin1(1a), (1b) and akirin2 (2a), (2b). OfAk2(1) and OfAk2(2) were placed closer to S. salar and D. rerio respectively, in accordance with their identity determined by pairwise alignment. High degree of conservation and identity from invertebrates to vertebrates signifies the role of akirin in all organisms. In particular, OfAk2(1) and OfAk2(2) share 64 and 71% identities respectively, with human akirin2 at the amino acid level signifying structural and functional similarity. OfAk2(1) and OfAk2(2) reveal a reasonable level of identity with akirin1 homologues, distinguishing themselves

S.R. Kasthuri et al. / Fish & Shellfish Immunology 35 (2013) 740e747

743

Fig. 1. Alignment of OfAk2(1) and OfAk2(2). Alignment of Ofak2 isoforms to represent the identity among them. The variation in the amino acids are shaded.

from akirin1 yet confirming their origin from a single ancestor. Evolutionary emergence is a significant phenomenon in estimating biodiversity and species coexistence. Akirin genes have been found to be present in the earliest eukaryotes Guillardia theta (protista taxa Alveolata) and Naegleria gruberi (taxa Heterolobosea), which are believed to have originated 2 billion years ago, before the split of animal/plant/fungal species. Surprisingly, akirin homologues have

406

2 178

not been discovered from plants and fungi. Also, akirin1 gene was not found in some bird species like chicken, turkey and zebra finch, irrespective of the presence of akirin2 gene, reflecting the occurrence of gene loss [16]. Functional difference has been defined for the two akirin paralogues [10]. The harboring of akirin2 gene inspite of akirin1 deletion in aves suggests the significance of akirin2 paralogues, playing a vital role in immune responses.

150

144

72

11 650

OfAk(1): 2851 bp 337

196

561

172

325

172

418

128 150

135

159

72

11

630

OfAk(2): 4458 bp 101

536

561 135

1529

150

72

11 567

Stickleback: 2693 bp 392

561 172

132

152 72

150

156

FISH

11

Tetradon: 2462 bp 252

387 332

172

95

95 150

135

72

11

Medaka: 2612 bp 1132 178

447

355

76

177

150

132

11

72

673

Zebrafish: 9837 bp 3374 107 27

18

2836 150

166

1943 72

150

11

671

11

676

Chicken: 16210 bp 4510 105

10

3683

502

6002

307

135

144

72

BIRDS

Zebrafinch: 15104 bp 8627 108

714

615

229

307

3688 150

144

72

11

653

Mouse: 15942 bp 11038 209

229

2672

656 150

144

209 11

72

678

Norway Rat: 14800 bp 10773 533

235

525

235

701

1649 144

183

MAMMALS 72

150

11

810

Cow: 22842 bp 16547

1794 144

2287

259

150

72

11

525

Human: 27140 bp 19686 365

178

339

211

Honey Bee: 3837 bp

163

200 569

3652

96

11

252

2074

181 357

366

1886

11

427

INSECTS

Fruitfly: 2680 kb 1156

90

61

Fig. 2. Genomic structure comparison of OfAk2 isoforms with that of other akirin2 homologues. The exoneintron structures of Stickleback (ENSORLT00000014346), Tetraodon (ENSTNIT00000019735), medaka (ENSORLT00000014346), and zebrafish (ENSDART000000816 43) were derived from the exon view of Ensembl gene database. The genomic structure of other sequences like chicken (mRNA: NM_001193595; Ch, 3: NC_006090.3 (75766862.75783071)), zebra finch (mRNA: NM_001245323; Ch, 3: NC_011466.1), house mouse (mRNA: NM_001007589; Ch, 4: NC_000070.5 (34497864.34514157)), Norway rat (mRNA: NM_001039914; Ch, 5: NC_005104.2 (51152935.51167720)), cow (mRNA: NM_001110087; Ch, 9: AC_000166.1 (63127339.63150182)), human (mRNA: NM_018064; Ch, 6: NC_000006.11 (88384578.88411985)), honey bee (mRNA: XM_395252; Ch, LG10: NC_007079.3 (10513814.10517650)), and fruitfly (mRNA: NM_139856; Ch, 3L: NT_037436.3 (7362900.7366958)) were obtained by collecting the genomic and cDNA sequences from GenBank and aligning using Spidey.

744

S.R. Kasthuri et al. / Fish & Shellfish Immunology 35 (2013) 740e747

S.R. Kasthuri et al. / Fish & Shellfish Immunology 35 (2013) 740e747

3.2. Genomic characterization of OfAk2 genes The exoneintron structure of OfAk2(1) determined from the genomic sequence revealed the presence of 6 exons interrupted by 5 introns, similar to chicken but contrasting to the akirin homologues from other fish species like stickleback, Medaka and zebrafish (Fig. 2). Exon 1 was completely composed of untranslated nucleotides while exon 2 possessed the ATG translation initiation site. The exoneintron structure of OfAk2(2) was similar to the other fish homologues like stickleback, Medaka and zebrafish with 5 exons interrupted by 4 introns. All introns display splice signals consistent with the GT/AG rule. OfAk2(1) and OfAk2(2) possessed 4 amino acid residues (M-A-CG) similar to that present in invertebrates (M-A-C-A), with the last alanine residue in invertebrate metazoans replaced by glycine. A NLS present in close proximity to the above said motif is also conserved throughout evolution, suggesting the origin of coding sequence of akirin 1/2 homologues from the second and third exons of a single gene [16]. The first exon in OfAk2(1) was composed of non-coding nucleotides and the start codon was found in the second exon. But alternatively, OfAk2(2) possessed the start codon in the first exon itself, similar to the mammalian and fish homologues. The presence of 6 exons in OfAk2(1), in contrast to other fish, while 5 exons in OfAk2(2) consistent with the genomic structure in other fish species suggests it may be a species specific event. Since exons 3, 4, 5 and 6 of OfAk2(1) were relatively consistent with other mammalian species and the untranslated 50 region formed a separate exon in OfAk2(1), it could be speculated that an intron acquisition would have occurred between exons 1 and 2, making it distinct from other fish and mammalian species and stands as a novel evidence for the variation of akirin structure in the individual organism itself. 3.3. Promoter region analysis of OfAk2 genes The 50 flanking region analysis of OfAk2(1) (2410 bp) and OfAk2(2) (2406 bp) revealed potential cis regulatory elements, suggesting the activation of akirin expression under conditions of cellular stress and pathogen invasion. Putative promoter analysis revealed a TATA box at 26 and 24 bp upstream of the TIS in OfAk2(1) (Supplementary Fig. 4A) and OfAk2(2) (Supplementary Fig. 4B), respectively. The TFB prediction servers revealed the presence of several PAMPs-activated TFBs, including activator protein-1 and 4 (AP-1 and AP-4), CCAAT-enhancer binding protein (C/EBP), C/EBP-a and -b, hepatic nuclear factor (HNF)-3b, interferon regulatory factor 1 and 2 (IRF-1 and -2), cAMP response element-binding protein (CRE-BP), signal transducer and activator of transcription-x (STATx), and nuclear factor-kappa (NF-kappa), suggesting that these immune-related factors may play a vital role in the regulation of OfAk2(1) and OfAk2(2) expression and function. In addition, other TFBs such as those for Lyf-1, Sp1, Oct-1 GATA-1, -2, c-Rel, AML-1a, and heat shock factor (HSF)-2 were identified. Promoter region analysis helps to elucidate the mechanisms of spatial and temporal expression of a gene and facilitates annotation of its transcriptional regulatory elements (cis regulatory elements). In silico promoter analysis revealed the prevalence of significant TFBs like NF-kB, C/EBP-a and -b, CRE-BP, IRF-1 and 2, HNF-3b and AML-1a in the promoter region of OfAk2(1) and OfAk2(2), which are

745

demonstrated in the regulation of genes involved in immune and inflammatory responses like acute phase proteins and proinflammatory cytokines [25,26] and other NF-kB regulators like IKKa [27]. It is demonstrated that in mammals, akirin is a downstream effector of TLR, TNF and IL-1 beta signaling pathways leading to the production of IL-6 [10]. Acute phase protein production is known to be stimulated by various pro-inflammatory cytokines, including IL-1, IL-6, and TNFa [28,29] and transcriptional activation of acute phase protein expression is mediated by NF-kB [30]. The presence of common TFBs in the proximal promoter region and presence of TFBs like Lyf-1, HSF2, Oct-1, STAT, GATA-2 and c-Rel in the 50 flanking region suggests that akirin as a downstream nuclear factor required for NF-kB activation or as a cofactor along with NF-kB, may also be involved in the various physiological processes during a stress signal. The presence of multiple regulatory elements within the promoter region endows combinatorial control of regulation, which exponentially increases the potential number of unique expression patterns. 3.4. Expression profile of OfAk2 genes in unchallenged tissues Tissue expression profiling of OfAk2(1) and OfAk2(2) by qRT-PCR revealed that OfAk2 transcripts were ubiquitously expressed in all the examined tissues, with the highest expression in blood and liver. Moderate levels of expression were detected in gill and brain (Fig. 3A). Earlier evidence suggests the ubiquitous presence of an akirin homologue in S. maximus, with highest expression in heart and kidney [18]. Differential expression pattern was observed in tick tissues post Anaplasma-infection [31,32]. Differential pattern of expression could be attributed to the different physiological and immunological functions in various types of tissues. Blood possesses various functions like immune, oxygen and nutrient transport. The higher expression in blood suggests that OfAk2 may be involved in various functions, which are yet to be delineated. Their relatively reasonable expression in tissues like liver and metabolically active tissues like brain and heart signifies their involvement in other physiological functions. 3.5. OfAk2 genes’ expression post-LPS, -bacterial and -poly I:C challenge Lipopolysaccharide (LPS), a major component of Gram-negative bacteria is known to activate many transcription factors and is used to study the activation of immune related genes. In liver, head kidney and spleen, OfAk2(1) showed a steady increase in the expression from 3 h which then reached the basal values at 48 h (Fig. 3B). OfAk2(2) revealed a different pattern of expression with an early induction in expression from 3 h to 12 h. The time points at which highest level of expression could be observed are shown in Table 2. E. tarda, a Gram-negative motile, short, rod shaped bacterium is a major pathogen in rock bream aquaculture leading to great mortality and morbidity resulting in huge economic loss [33]. After E. tarda challenge, both OfAk2(1) and OfAk2(2) showed upregulation from 3 h to 48 h in liver. In head kidney, while OfAk2(1) showed upregulation at all-time points, OfAk2(2)showed induction from 6 h to 24 h. In

Fig. 3. Spatial distribution and temporal expression analysis of OfAk2 genes. The expression analysis was performed using qRT-PCR. Relative mRNA expression was calculated using the Livak method, with b-actin as the invariant control gene. (A) OfAk2 tissue-specific expression in muscle (Ms), intestine (In), skin (Sk), kidney (Kd), head kidney (Hk), spleen (Sp), gill (Gl), heart (Ht), brain (Br), liver (Lr) tissues, and blood (Bl), collected from unchallenged rock bream. In order to determine the tissue-specific expression, the relative mRNA level was compared with muscle expression. Data are presented as mean values (n ¼ 3) with error bars representing SD. OfAk2 expression was analyzed in liver, spleen, and head kidney post-LPS (B), -E. tarda (C), and -poly I:C (D), challenges. OfAk2(1) and OfAk2(2) are denoted as Ak1 and Ak2, respectively to avoid clustering in the figure. OfAk2 expression was represented after normalizing to PBS injected controls. Data shown with “*” indicates significant expression levels at P < 0.01 in liver, head kidney and spleen samples. In (C), the inner graph represents the OfAk2 expression in spleen and head kidney after E. tarda challenge to clearly indicate the fold values.

746

S.R. Kasthuri et al. / Fish & Shellfish Immunology 35 (2013) 740e747

Table 2 Highest mRNA expression values of OfAk2(1) and OfAk2(2) post immune challenges.

mRNA expression

Gene

Tissue

LPS

E. tarda

Poly I:C

OfAk2(1)

Head kidney Liver Spleen Head kidney Liver Spleen

12 h: 2.8-fold 12 h: 3.26-fold 6 h: 2.73-fold 3 h: 2-fold 6 h: 3.3-fold 3 h: 1.8-fold

6 h: 2.43-fold 48 h: 32-fold and 12 h 30-fold 3 h: 2.3-fold 24 h: 2.7-fold 12 h: 30-fold and 48 h 30-fold 6 h: 2.5-fold

12 h: 2.7-fold 6 h: 3.26-fold 6 h : 1.9-fold 3 h: 1.7-fold 6 h: 2.9-fold 6 h: 2.7-fold

OfAk2(2)

spleen, OfAk2(1) portrayed induction from 3 h to 6 h, while OfAk2(2) showed modifications from 6 h to 12 h (Fig. 3C) (Table 2). Poly I:C is a synthetically-derived mimic of the dsRNA which forms the genetic material in some viruses. Poly I:C injection in rock bream led to the induction of OfAk2(1) in liver, spleen and head kidney with variable patterns. In liver, increase in expression could be observed from 3 h to 12 h and again at 48 h. In head kidney and spleen, increase in expression could be observed from 3 h to 24 h. In liver, OfAk2(2) portrayed similar expression to that of OfAk2(1) while in head kidney, induction was found from 3 h to 6 h. In spleen, induction was observed from 3 h to 6 h and again from 24 h to 48 h (Fig. 3D) (Table 2). Akirins are known to play diverse and exquisite roles from embryogenesis to innate immune responses [11,14,34e37]. The time course study of expression of OfAk2 transcripts revealed a promising evidence of our expectation of akirin involvement in defense response of rock bream against various pathogens. TLRs, TNF receptors (TNF-R) and IL-1 receptors (IL-1R) converge at the point of NF-kB activation through the phosphorylation of inhibitor of NF-kB (IkB) by the IKK complex resulting in subsequent activation of cytokines and chemokines [38e40]. Akirin2 was immunologically significant than akirin1, because it was determined to be responsible for the production of IL-6 in response to TLR or IL-1R activation, expression of certain LPS and IL-1b inducible genes [10]. Their retention irrespective of akirin1 deletion in Aves class also stands as an evidence for the same phenomenon. Our studies of akirin2 expression post immune challenges with stimulants like LPS, poly I:C, and E. tarda, which act as ligands for various TLRs, and also lead to activation of TNF and IL-1 pathways, clearly depicted the involvement of akirin2 in rock bream immune defense. It could be speculated that LPS in purified form as well as found in E. tarda, forming a complex with lipopolysaccharide binding protein (LBP) may activate the TNF receptor pathway. All the immune stimulants and live pathogens showed a higher elevation of akirin2 expression, although little variation could be observed between the akirin homologues. The higher elevation of OfAk2 transcripts observed post immune challenges in liver, spleen and head kidney suggested a possible role of OfAk2 as a cofactor of NF-kB or act downstream of NF-kB to induce synthesis of various cytokines and chemokines. E. tarda is a major threat to Korean rock bream aquaculture with liver being the major disease target organ and development of vaccines against these pathogens are a promising solution for the prevention of rock bream mortality in aquaculture [41e43]. Increased expression levels of OfAk2 transcripts in liver, spleen and head kidney post bacterial challenge, suggests their involvement in defense mechanism. Akirin1 homolog from S. maximus has been shown to respond against viral infection [18]. In our study, OfAk2 isoforms were upregulated upon poly I:C challenge in all the tissues examined at different time points. Since poly I:C recognition culminate in NF-kB activation, akirin may play a role in viral signal transduction pathways as well. However, the exact mechanism of action has to be verified with further studies. Probable role of akirin2 genes in teleosts needs to be demonstrated at the experimental level with

the above said basic hypothesis. Stimulus specific NF-kB activation plays a key role in identifying the stimulus specificity of gene expression [44]. Differential pattern of OfAk2 gene expression post different immune stimulants, suggests a similar phenomenon in rock bream. 4. Conclusion Extensive knowledge on innate immune components, their expression, function and regulatory mechanisms are needed to accomplish novel therapeutics, to implement in aquaculture for prevention of mass mortality and reduce economic loss. In this study of characterization of two akirin genes from rock bream, genomic analysis and in silico promoter characterization revealing the presence of immune relevant transcription factor binding sites, together with the constitutive expression of akirin2 transcripts in all the tissues examined and their higher levels of expression in liver, spleen and head kidney post immunostimulants and pathogenic challenges suggest the significant roles of akirin2 in immune defense system of rock bream. Acknowledgment This work was supported by the research grant of the Jeju National University in 2012. Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.fsi.2013.06.006. References [1] Medzhitov R, Janeway C. Innate immunity. N Engl J Med 2000;343:338e44. [2] Kawai T, Akira S. The role of pattern-recognition receptors in innate immunity: update on toll-like receptors. Nat Immunol 2010;11:373e84. [3] Beutler BA. TLRs and innate immunity. Blood 2009;113:1399e407. [4] Lee MS, Kim YJ. Signaling pathways downstream of pattern-recognition receptors and their cross talk. Annu Rev Biochem 2007;76:447e80. [5] Oeckinghaus A, Hayden MS, Ghosh S. Crosstalk in NF-kappaB signaling pathways. Nat Immunol 2011;12:695e708. [6] Li Q, Verma IM. NF-kappaB regulation in the immune system. Nat Rev Immunol 2002;2:725e34. [7] Sun SC, Ley SC. New insights into NF-kappaB regulation and function. Trends Immunol 2008;29:469e78. [8] Hayden MS, Ghosh S. Shared principles in NF-kappaB signaling. Cell 2008;132: 344e62. [9] Ghosh S, Karin M. Missing pieces in the NF-kappaB puzzle. Cell 2002;109(Suppl.): S81e96. [10] Goto A, Matsushita K, Gesellchen V, El Chamy L, Kuttenkeuler D, Takeuchi O, et al. Akirins are highly conserved nuclear proteins required for NF-kappaBdependent gene expression in drosophila and mice. Nat Immunol 2008;9: 97e104. [11] de la Fuente J, Almazan C, Blas-Machado U, Naranjo V, Mangold AJ, Blouin EF, et al. The tick protective antigen, 4D8, is a conserved protein involved in modulation of tick blood ingestion and reproduction. Vaccine 2006;24:4082e95. [12] Almazan C, Blas-Machado U, Kocan KM, Yoshioka JH, Blouin EF, Mangold AJ, et al. Characterization of three Ixodes scapularis cDNAs protective against tick infestations. Vaccine 2005;23:4403e16.

S.R. Kasthuri et al. / Fish & Shellfish Immunology 35 (2013) 740e747 [13] Manzano-Roman R, Diaz-Martin V, Oleaga A, Siles-Lucas M, Perez-Sanchez R. Subolesin/akirin orthologs from Ornithodoros spp. soft ticks: cloning, RNAi gene silencing and protective effect of the recombinant proteins. Vet Parasitol 2012;185:248e59. [14] Nowak SJ, Aihara H, Gonzalez K, Nibu Y, Baylies MK. Akirin links twistregulated transcription with the Brahma chromatin remodeling complex during embryogenesis. PLoS Genet 2012;8:e1002547. [15] Moreno-Cid JA, Jimenez M, Cornelie S, Molina R, Alarcon P, Lacroix MN, et al. Characterization of Aedes albopictus akirin for the control of mosquito and sand fly infestations. Vaccine 2010;29:77e82. [16] Macqueen DJ, Johnston IA. Evolution of the multifaceted eukaryotic akirin gene family. BMC Evol Biol 2009;9:34. [17] Macqueen DJ, Kristjansson BK, Johnston IA. Salmonid genomes have a remarkably expanded akirin family, coexpressed with genes from conserved pathways governing skeletal muscle growth and catabolism. Physiol Genomics 2010;42:134e48. [18] Yang CG, Wang XL, Wang L, Zhang B, Chen SL. A new Akirin1 gene in turbot (Scophthalmus maximus): molecular cloning, characterization and expression analysis in response to bacterial and viral immunological challenge. Fish Shellfish Immunol 2011;30:1031e41. [19] Revathy KS, Umasuthan N, Whang I, Lee Y, Lee S, Oh MJ, et al. A novel acute phase reactant, serum amyloid A-like 1, from Oplegnathus fasciatus: genomic and molecular characterization and transcriptional expression analysis. Dev Comp Immunol 2012;37(2):294e305. [20] Thompson JD, Higgins DG, Gibson TJ. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 1994;22:4673e80. [21] Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 2011;28:2731e9. [22] Campanella JJ, Bitincka L, Smalley J. MatGAT: an application that generates similarity/identity matrices using protein or DNA sequences. BMC Bioinformatics 2003;4:29. [23] Wheelan SJ, Church DM, Ostell JM. Spidey: a tool for mRNA-to-genomic alignments. Genome Res 2001;11:1952e7. [24] Marshall A, Salerno MS, Thomas M, Davies T, Berry C, Dyer K, et al. Mighty is a novel promyogenic factor in skeletal myogenesis. Exp Cell Res 2008;314:1013e29. [25] Young DP, Kushner I, Samols D. Binding of C/EBPbeta to the C-reactive protein (CRP) promoter in Hep3B cells is associated with transcription of CRP mRNA. J Immunol 2008;181:2420e7. [26] Robb BW, Hershko DD, Paxton JH, Luo GJ, Hasselgren PO. Interleukin-10 activates the transcription factor C/EBP and the interleukin-6 gene promoter in human intestinal epithelial cells. Surgery 2002;132:226e31. [27] Gu L, Zhu N, Findley HW, Woods WG, Zhou M. Identification and characterization of the IKKalpha promoter: positive and negative regulation by ETS-1 and p53, respectively. J Biol Chem 2004;279:52141e9.

747

[28] Cray C, Zaias J, Altman NH. Acute phase response in animals: a review. Comp Med 2009;59:517e26. [29] Bayne CJ, Gerwick L. The acute phase response and innate immunity of fish. Dev Comp Immunol 2001;25:725e43. [30] Betts JC, Cheshire JK, Akira S, Kishimoto T, Woo P. The role of NF-kappa B and NF-IL6 transactivating factors in the synergistic activation of human serum amyloid A gene expression by interleukin-1 and interleukin-6. J Biol Chem 1993;268:25624e31. [31] de la Fuente J, Blouin EF, Manzano-Roman R, Naranjo V, Almazan C, Perez de la Lastra JM, et al. Differential expression of the tick protective antigen subolesin in anaplasma marginale- and A. phagocytophilum-infected host cells. Ann N Y Acad Sci 2008;1149:27e35. [32] Zivkovic Z, Torina A, Mitra R, Alongi A, Scimeca S, Kocan KM, et al. Subolesin expression in response to pathogen infection in ticks. BMC Immunol 2010;11:7. [33] Park SI. Disease control in Korean aquaculture. Fish Pathol 2009;44:19e23. [34] Harrington D, Canales M, de la Fuente J, de Luna C, Robinson K, Guy J, et al. Immunisation with recombinant proteins subolesin and Bm86 for the control of Dermanyssus gallinae in poultry. Vaccine 2009;27:4056e63. [35] de la Fuente J, Almazan C, Blouin EF, Naranjo V, Kocan KM. Reduction of tick infections with Anaplasma marginale and A. phagocytophilum by targeting the tick protective antigen subolesin. Parasitol Res 2006;100:85e91. [36] Macqueen DJ, Bower NI, Johnston IA. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis. Biochem Biophys Res Commun 2010;400:599e605. [37] Komiya Y, Kurabe N, Katagiri K, Ogawa M, Sugiyama A, Kawasaki Y, et al. A novel binding factor of 14-3-3beta functions as a transcriptional repressor and promotes anchorage-independent growth, tumorigenicity, and metastasis. J Biol Chem 2008;283:18753e64. [38] Kawai T, Akira S. Signaling to NF-kappaB by Toll-like receptors. Trends Mol Med 2007;13:460e9. [39] Doyle SL, O’Neill LA. Toll-like receptors: from the discovery of NFkappaB to new insights into transcriptional regulations in innate immunity. Biochem Pharmacol 2006;72:1102e13. [40] Verstrepen L, Bekaert T, Chau TL, Tavernier J, Chariot A, Beyaert R. TLR-4, IL-1R and TNF-R signaling to NF-kappaB: variations on a common theme. Cell Mol Life Sci 2008;65:2964e78. [41] Choi SH, Kim KH. Generation of two auxotrophic genes knock-out Edwardsiella tarda and assessment of its potential as a combined vaccine in olive flounder (Paralichthys olivaceus). Fish Shellfish Immunol 2011;31:58e65. [42] Choi SH, Kim MS, Kim KH. Protection of olive flounder (Paralichthys olivaceus) against Edwardsiella tarda infection by oral administration of auxotrophic mutant E. tarda (Dalr Dasd E. tarda). Aquaculture 2011;317:48e52. [43] Mohanty BR, Sahoo PK. Edwardsiellosis in fish: a brief review. J Biosci 2007;32:1331e44. [44] Barken D, Wang CJ, Kearns J, Cheong R, Hoffmann A, Levchenko A. Comment on “oscillations in NF-kappaB signaling control the dynamics of gene expression”. Science 2005;308:52 [author reply].