Molecular characterization and expression analysis of B cell activating factor from rock bream (Oplegnathus fasciatus)

Developmental and Comparative Immunology 55 (2016) 1e11

Contents lists available at ScienceDirect

Developmental and Comparative Immunology journal homepage: www.elsevier.com/locate/dci

Molecular characterization and expression analysis of B cell activating factor from rock bream (Oplegnathus fasciatus) G.I. Godahewa a, b, 1, N.C.N. Perera a, b, 1, Navaneethaiyer Umasuthan a, b, Qiang Wan a, b, **, Ilson Whang b, Jehee Lee a, b, * a

Department of Marine Life Sciences, School of Marine Biomedical Sciences, Jeju National University, Jeju Self-Governing Province, 690-756, Republic of Korea Fish Vaccine Research Center, Jeju National University, Jeju Self-Governing Province, 690-756, Republic of Korea

b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 18 June 2015 Received in revised form 5 October 2015 Accepted 5 October 2015 Available online 9 October 2015

B cell activating factor (BAFF) is a member of the tumor necrosis factor (TNF) ligand family. BAFF has been shown to induce survival and proliferation of lymphocytes. We characterized the gene encoding BAFF (RbBAFF) in rock bream (Oplegnathus fasciatus), and attempted to determine its biological functions upon immune responses. In silico analysis of RbBAFF demonstrated the presence of common TNF ligand family features, including a TNF domain, a D-E loop, and three cysteine residues that are crucial for trimer formation. Amino acid sequence alignment confirmed that RbBAFF and its homologs were conserved at secondary and tertiary levels. Transcriptional analysis indicated that RbBAFF mRNAs were ubiquitously expressed in wide array of tissues. The higher levels of constitutive expression were observed in the kidney, head kidney and spleen, suggesting an important physiological relationship with lymphocytes. Under pathological conditions, RbBAFF mRNA levels were significantly elevated. The role of RbBAFF in lymphocyte survival and proliferation was confirmed by MTT assays and flow cytometry. Recombinant RbBAFF protein (10 mg/mL) was able to prolong the survival and/or enhance the proliferation of rock bream lymphocytes by approximately 30%. Transcription of IL-10 and NFkB-1 was significantly stimulated by RbBAFF. Our findings provide further information regarding fish BAFF gene and its role in adaptive immunity. © 2015 Elsevier Ltd. All rights reserved.

Keywords: TNF ligands B cell activating factor (BAFF) Immune responses Recombinant protein Lymphocyte viability

1. Introduction The tumor necrosis factor (TNF) family of ligands plays a vital role in regulating inflammation and tissue homeostasis. They can stimulate the downstream caspase signaling pathway, and activate the mitogen-activated protein kinases or extracellular regulatory kinases (Shu et al., 1999). Furthermore, several TNF ligands can boost cell proliferation, differentiation, and survival in contrast of apoptosis (Tribouley et al., 1999). The cytokine B cell activating factor (BAFF; also known as BlyS,

* Corresponding author. Marine Molecular Genetics Lab, Department of Marine Life Sciences, Jeju National University, 66 Jejudaehakno, Ara-Dong, Jeju 690-756, Republic of Korea. ** Corresponding author. Marine Molecular Genetics Lab, Department of Marine Life Sciences, Jeju National University, 66 Jejudaehakno, Ara-Dong, Jeju 690-756, Republic of Korea. E-mail addresses: [email protected] (Q. Wan), [email protected] (J. Lee). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.dci.2015.10.004 0145-305X/© 2015 Elsevier Ltd. All rights reserved.

THANK, TNFSF13b and TALL-1) belongs to the TNF ligand superfamily 13B (Ai et al., 2011; Liang et al., 2010; Mukhopadhyay et al., 1999). It is thought to be responsible for the survival, proliferation, and maturation of B cells (Bossen and Schneider, 2006; Schneider et al., 1999). It has been shown that BAFF-deficient mice are almost completely devoid of B cells (Schiemann et al., 2001). In addition, BAFF plays crucial roles in immunoglobulin secretion (Ai et al., 2011; Liang et al., 2010), T cell activation, and B cell mediated autoimmune pathogenesis (Cheema et al., 2001; Mariette et al., 2003). In vertebrates, BAFF is expressed as a homotrimeric transmembrane protein, and is anchored on the surface of various cell types including macrophages, dendritic cells, monocytes, T lymphocytes, and non-lymphoid cells (Mackay and Browning, 2002; Vogt et al., 2005). The trans-membrane form of BAFF can result in another functionally important soluble protein fragment upon proteolytic processing by furin-like proteases (Moore et al., 1999; Schneider et al., 1999). The soluble region of BAFF is designated

2

G.I. Godahewa et al. / Developmental and Comparative Immunology 55 (2016) 1e11

the D-E loop, or “Flap”, and contains conserved cysteine (Cys) residues and N-glycosylation sites. Three types of B cell receptors are involved in mediating the in vivo activity of BAFF: B cell maturation antigen (BCMA), trans-membrane activator and CAML interactor (TACI), and BAFF receptor (BAFFR) (Gross et al., 2000; Schneider et al., 1999; Tribouley et al., 1999). Of these, BAFFR is the principal receptor for BAFF (Liang et al., 2010), while BCMA and TACI possess higher potential for binding to other TNF family ligand members (Bossen and Schneider, 2006). The BAFF-B cell receptor system provides positive and negative feedback signals to influence B cell developments (Nguyen and Morris, 2014). The BAFF and its receptors are one of the important members in ‘apoptosis and survival-APRIL and BAFF signaling pathway’ and play a role in the B cell and T cell arms of immune system (Bossen and Schneider, 2006; Mackay and Leung, 2006). The signals from the BAFF receptors activate the NF-kB signaling cascades, and stimulate different regulatory proteins including IL-10, MIP-1b, Bcl-2, Bcl-XL, CD23 and COX-2, and in turn mediate the inflammation, and division, survival, differentiation and maturation of B-cells (Bossen and Schneider, 2006; Claudio et al., 2002; Xu et al., 2002). The BAFF gene has been identified in mammals (Guan et al., 2008; Shen et al., 2012), avians (Chen et al., 2009), amphibians (Yang et al., 2013), and several fish species including zebrafish (Liang et al., 2010), spiny dogfish (Li et al., 2012), mefugu (Ai et al., 2011), miiuy croaker (Meng et al., 2015) and yellow grouper (Xiao et al., 2014). A growing body of evidence suggests that BAFF is an important gene with respect to understanding the evolution of the innate and adaptive immune systems in teleosts. Rock bream is one of the most economically valuable fish species in Korea. However, the rock bream aquaculture industry has been adversely affected by frequent outbreaks of bacterial and viral diseases in recent years (Li et al., 2011; Lipton and Kim, 2010). In this present study, we aimed to elucidate the function(s) of BAFF in rock bream and clarify its role during immune responses to bacterial and viral pathogens through characterization of the structural features, spatial and temporal transcriptional expression profiling in different tissues and after immune challenges, and the biological activity assay of recombinant protein. Our work may contribute to reducing the economic losses currently experienced by the rock bream aquaculture industry in Korea.

shared similarity with known BAFF homologs were mined using the Basic Local Alignment Search Tool (BLAST) on NCBI (http://blast. ncbi.nlm.nih.gov/Blast.cgi).

2. Materials and methods

2.5. Stimulation of immune responses

2.1. Experimental animals, pathogens and chemicals

To study the immune response of RbBAFF in selected tissues, fish were divided into five groups and challenged with various substances: phosphate-buffered saline (PBS); Streptococcus iniae; RBIV; lipopolysaccharide (LPS); and polyinosinic:polycytidylic acid (poly I:C). Briefly, fish in the various groups were administered 100 mL of challenge substance (Table 1) via intra-peritoneal and/or intra-muscular routes. Three individuals were randomly collected at 0, 3, 6, 12, 24, and 48 h post infection (p.i.). Then, spleen tissues were recovered, snap frozen in liquid nitrogen, and stored at 80
C.

Rock breams were obtained from the Ocean and Fisheries Research Institute of Jeju Special Self-Governing Province (Jeju, Republic of Korea). Rock bream iridovirus (RBIV) was isolated from infected rock bream kidney samples as previously described (Godahewa et al., 2014). A strain of Streptococcus iniae was obtained from the Department of Aqualife Medicine at Chonnam National University (Korea). Oligonucleotide primers used in this study were synthesized by Integrated DNA Technologies, Inc, USA. All chemicals used in this study were molecular biology grade, and purchased from Sigma, USA. Kits for PCR purification, gel purification, and plasmid extraction were obtained from Bioneer, Korea. Taq polymerase, SYBR Ex Taq, molecular markers, and restriction enzymes were purchased from Takara, Japan. 2.2. Rock bream transcriptome library construction and RbBAFF sequence identification A rock bream cDNA sequence database was constructed using Roche's GS-FLX automated sequencing technology, as described previously (Umasuthan et al., 2011). The cDNA sequences that

2.3. Bioinformatic analysis of RbBAFF The DNAssist version 2.2 was employed to obtain the putative coding sequence (CDS) of RbBAFF cDNA, and to derive the corresponding protein sequence. Functional domains and motifs were identified using the SMART proteomics database (Letunic et al., 2009), Motif Scan tools, PROSITE profile database (De Castro et al., 2006), and the Conserved Domain Database (CDD) (http://www. ncbi.nlm.nih.gov/cdd). Amino acid identity and similarity percentages with known BAFF homologues from different species were calculated by using EMBOSS Needle Pairwise sequence alignment. ClustalW2 (Thompson et al., 1994) was used to perform multiple sequence alignments. The three-dimensional structure of RbBAFF was predicted using the SWISS-MODEL protein modeling server (http://swissmodel.expasy.org/) and examined using PyMOL v1.5 software. Evolutionary relationship was assessed by applying the Neighbor-Joining (NJ) method in MEGA 5.0 (Tamura et al., 2011). A phylogenetic tree was constructed using the protein sequences from selected BAFF members from different taxonomic classes, with 5000 bootstrap replicates. 2.4. Experimental animal rearing and tissue sampling Healthy rock breams (mean body weight ~50 g) were reared in 400 L tanks filled with sand-filtered aerated seawater (salinity 34 ± 1 psu; pH 7.6 ± 0.5; 24 ± 1
C). Fish were acclimated to laboratory conditions for 1 week prior to experiments. Static laboratory environmental conditions were maintained throughout the experiment. Blood samples (1 mL fish1) were collected from the caudal vein using a 22 G sterile syringe, and hematic cells harvested by centrifugation (3000  g, 4
C, 10 min). Other tissues, including the kidney, head kidney, brain, gills, liver, spleen, skin, intestine, muscle, and heart were collected from three healthy fish. All tissue samples were snap frozen in liquid nitrogen and stored at 80
C until RNA extraction.

Table 1 Summary of the immune challenges used in the current study. Pathogen

Source

Mode

Dose/Fish

Volume

LPS S. iniae RBIV Poly I:C PBS (control)

E. coli 055:B5, sigma CNUb, Korea Infected kidney Sigma e

Intra-peritoneal Intra-peritoneal Intra-muscular Intra-peritoneal Intra-peritoneal

125 mg 1  107 CFU 102 TCID50a 150 mg e

100 100 100 100 100

a

mL mL mL mL mL

TCID50, 50% tissue culture infectious dose. Obtained from the Department of Aqualife Medicine at Chonnam National University (Republic of Korea). b

G.I. Godahewa et al. / Developmental and Comparative Immunology 55 (2016) 1e11

3

Pooled tissues from three fish (approximately 50 mg/fish) and blood cell samples were used for the isolation of total RNA by Tri Reagent™ (SigmaeAldrich). The purity of RNA was determined with a UV-spectrophotometer (BioRad, USA), at 260 and 280 nm. First strand cDNA was synthesized with 2.5 mg of total RNA using a PrimeScript™ First Strand cDNA Synthesis Kit (Takara). The synthesized cDNA samples were diluted 40-fold and stored at 20
C until their use in quantitative real-time polymerase chain reaction (qPCR) assays.

thiogalactopyranoside (IPTG) at 20
C for 10 h. Cells were harvested by centrifugation (3500 rpm, 20 min, 4
C) and re-suspended in column buffer (20 mM Tris-HCl pH 7.4, 200 mM NaCl) and frozen at 20
C. The following day, cells were thawed and sonicated on ice, and the cell lysate was centrifuged (13,000 rpm, 30 min, 4
C). Supernatant was collected and the rRbBAFF-MBP fusion protein was purified using amylose resin (New England Biolabs). The Bradford assay was used to determine the concentration of purified protein (Bradford, 1976). A 12% SDS-PAGE with standard protein size marker (Takara Bio Inc.) was employed to assess the protein purification and purity.

2.7. Spatial and temporal expression analysis of RbBAFF transcripts

2.10. Lymphocyte isolation

To determine RbBAFF mRNA expression levels in healthy tissues and spleen tissue from challenged animals, qPCR assays utilizing the generated cDNA and gene-specific primers were employed (Table 2). The O. fasciatus b-actin gene was used as a reference. Triplicate cycle threshold (Ct) values were transformed into relative mRNA expression levels using the Livak method (Livak and Schmittgen, 2001). Data were calculated as the quantity of RbBAFF mRNA relative to b-actin mRNA, and expressed as the mean ± SD. Tissue-specific relative RbBAFF mRNA levels were calculated by comparing the expression levels in muscle as the calibrator. Post-challenge temporal expression analysis of RbBAFF was compared with corresponding PBS-injected controls, with expression in untreated (0 h) controls set as the baseline.

Blood was collected from three healthy rock breams in the presence of heparin. The collected blood samples were pooled together and layered on top of a discontinuous iodixanol density gradient (1.05 and 1.07 kg/m3; OptiPrep™, USA), followed by centrifugation at 800 g for 30 min. Lymphocytes at the density barrier were harvested for further experiments.

2.6. Total RNA extraction and cDNA synthesis

2.8. Construction of the pMAL-c2X/RbBAFF recombinant expression vector The pMAL™ protein fusion and purification system (New England Biolabs, USA) was used to produced recombinant RbBAFF protein. The CDS of RbBAFF was amplified using gene-specific primers (Table 2), with corresponding restriction enzyme sites for EcoRI and HindIII incorporated at the 50 and 30 ends, respectively. The amplicon (around 795 bp) was examined on a 1% (w/v) agarose gel, and purified using a Gel Purification Kit (Bioneer, Korea). The pMAL-c2X vector (150 ng) and the amplicon were digested with EcoRI and HindIII and ligated using Mighty Mix (Takara Bio Inc.). The resulting plasmid, pMAL-c2X/RbBAFF, was transformed into Escherichia coli DH5a cells and sequenced. Upon sequence verification, pMAL-c2X/RbBAFF was transformed into competent E. coli BL21 (DE3) cells (Novagen, Germany). 2.9. Overexpression and purification of recombinant RbBAFF Recombinant RbBAFF protein was expressed as a fusion protein with a maltose-binding protein tag (rRbBAFF-MBP) in E. coli BL21 (DE3) cells following induction with isopropyl-b-

2.11. Lymphocyte viability and proliferation assays Freshly isolated rock bream lymphocytes (1  105) were incubated with MBP (rMBP) and rRbBAFF-MBP, at varying concentrations, for 48 h at 25
C. The viability and degree of lymphocyte proliferation were examined using MTT cell viability assay (Spinner, 2001). All of the assays were performed in triplicate. 2.12. Flow cytometry The rock bream lymphocytes in 6-well plates (2  107 cells/well) were either untreated as a control, or treated with 10 mg/mL rMBP or 10 mg/mL rRbBAFF-MBP. After 48 h, cells were harvested and washed with PBS. Cells were then stained with annexin-V (ApopNexin Annexin-V FITC Apoptosis Kit) for 30 min, according to the manufacturer's protocol (EMD Millipore, USA). Stained cells were then analyzed on a BD FACScalibur flow cytometer (BD Biosciences, USA). This experiment was conducted in triplicates and the data was analyzed using CellQuest™ Pro software (BD Biosciences). 2.13. Rock bream interleukin-10 (RbIL-10) and nuclear factor kappa-light-chain-enhancer of activated B cells-1 (RbNFkB-1) mRNA expression analysis To investigate the effects of BAFF on the expression of downstream genes, 1  105 rock bream lymphocytes were treated with 10 mg/mL rRbBAFF-MBP over a time-course, with 10 mg/mL rMBP used as a control treatment. Cells were incubated at 25
C and harvested at 0, 3, 6, 12, 24, and 48 h. Total RNA was extracted using a

Table 2 Description of primers used in this study. Name

Purpose

Primer sequence (5' e 30 )

RbBAFF-F RbBAFF-R RbBAFF-F RbBAFF-R Rbb-actin-F Rbb-actin-R RbIL-10-F RbIL-10-R RbNFkB-1-F RbNFkB-1-R

qPCR amplification qPCR amplification CDS amplification CDS amplification qPCR amplification qPCR amplification qPCR amplification qPCR amplification qPCR amplification qPCR amplification

TATCGCAGGAGAGAAGAGGGACAAGA CTGCAGGCAAGGCTGAGAAATTGATG GAGAGAgaattcATGGGCCCCGCGATG GAGAGAaagcttTTAAACCAGTTTGACAGCACCCATGAA TCATCACCATCGGCAATGAGAGGT TGATGCTGTTGTAGGTGGTCTCGT TTCGCAGATCCGAGACTTCTATGAAGC AAGTATGCTGTTCATGGCGTGGCA ACCTACAGCCCAAAGACTCCAACA TGCAGACTCCACAGTTGTATCCCATC

F, forward and R, reverse.

4

G.I. Godahewa et al. / Developmental and Comparative Immunology 55 (2016) 1e11

SpinClean™ RNA Mini Purification Kit (Mbiotech, Korea). Firststrand cDNA was synthesized as described in Section 2.6 above and used in qPCR assays to determine the transcription levels of RbIL-10 and RbNFkB-1 with gene-specific primers (Table 2). Expression levels of mRNAs were calculated as described in Section 2.7. The expression levels of RbIL-10 and RbNFkB-1 following treatment with rRbBAFF-MBP were compared with those in lymphocytes treated with rMBP controls, with expression levels in untreated (0 h) controls used as the baseline.

nucleotide sequence of RbBAFF has been deposited in GenBank, with the accession number KM593904. The cDNA sequence of RbBAFF possesses a 795 bp putative CDS which encodes a putative protein of 264 amino acids, with a predicted molecular mass of 29 kDa, and a theoretical pI of 8.7 (Fig. 1). The length of RbBAFF amino acid sequence is shorter than those of other teleostean BAFF homologs, which are between 268 and 288 amino acid residues (Ai et al., 2011; Li et al., 2012; Liang et al., 2010; Xiao et al., 2014).

2.14. Statistical analysis

3.1.2. Homology analysis of RbBAFF Multiple sequence comparison with ClustalW revealed that RbBAFF shared several conserved features of the TNF family of BAFF orthologs (Fig. 2). A soluble TNF homology domain, which binds to the BAFF receptor, was identified and is known to be conserved among selected vertebrate orthologs. This domain region is composed of six receptor binding sites (148Q, 149A, 150G, 188G, 195K, and 204Q) that are likely involved in the stimulation of downstream signaling pathways via interactions with BAFF receptors. It also contains seven putative trimer interfaces (123Q, 173F, 175Y, 225Y, 230V, 257 F, and 261V) that might be involved in trimer formation (Shu et al., 1999). In addition, an extended loop (195KRNVVGDEPG204) known as the DeE loop, or “Flap”, was identified. The DeE loop is specifically involved in forming a 60-mer complex to achieve its biological activity via binding to appropriate receptors on B cells (Bossen and Schneider, 2006; Liu et al., 2002). Three conserved cysteine residues (121Cys, 211Cys, and 224Cys) were identified at the C-terminus of RbBAFF. These Cys residues can form links between BAFF receptors and each monomeric ligand within BAFF trimers

Generated data from qPCR assays, MTT assays, and flow cytometry are presented as the mean ± SD from triplicate experiments. Statistical analyses were performed with GraphPad Prism (GraphPad Software, Inc., USA), using the unpaired, two-tailed ttest to calculate P-values. A P-value less than 0.05 was considered statistically significant. 3. Results and discussion 3.1. Molecular structure and phylogenetic characterization of RbBAFF 3.1.1. Features of RbBAFF cDNA and amino acid sequence A cDNA sequence demonstrating high homology with other BAFF orthologs was identified in the rock bream transcriptome database. BLAST results confirmed that this BAFF gene was a true homolog of rock bream, and was designated RbBAFF. The

Fig. 1. The nucleotide sequence of RbBAFF (top) and its deduced amino acid sequence (bottom). The start (ATG) and stop (TAA) codons are presented in boldface type. For the amino acid sequence, the tumor necrosis factor domain is shaded in gray, the trans-membrane domain is presented in boldface italicized type and underlined, the furin cleavage site is underlined, receptor binding sites are circled in red, trimer interfaces are contained within the black boxes, and N-glycosylation sites are indicated by the green stars. The nucleotide sequence was deposited in GenBank, with accession number KM593904. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

G.I. Godahewa et al. / Developmental and Comparative Immunology 55 (2016) 1e11

5

Fig. 2. Multiple sequence alignment of rock bream BAFF (RbBAFF) and its vertebrate counterparts. Strongly conserved and similar residues are denoted by black and gray shading, respectively. Dashes represent missing amino acids. The “Flap” region is indicated by the blue box, while the furin cleavage site is denoted by the green box. The predicted transmembrane domain is marked with a red dashed line. Cysteine residues are denoted by a star. Conserved trimer interfaces are shaded in red, and receptor binding sites are in purple. GenBank accession numbers for Oplegnathus fasciatus, Epinephelus awoara, Lateolabrax japonicus, Oryzias latipes, Xenopus laevis, Bos taurus and Homo sapiens are KM593904, AFN70720, AEH22106, XP_004082024, AGN49363, NP_001107978 and NP_006564, respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

(Kim et al., 2003; Liu et al., 2003). Two potential N-glycosylation sites (127NSS129 and 248NVS250) were identified, indicating that RbBAFF might need post-translational glycosylation modification. We also identified a potential trans-membrane domain and a putative furin cleavage site (RXR/KR) in RbBAFF amino acid sequence, which are present in other BAFF homologs as well. The presence of a predicted trans-membrane domain suggests that RbBAFF might

be a type II membrane-bound protein as other BAFFs (Bodmer et al., 2002). On the other hand, the furin protease cleavage site in RbBAFF could allow the release of a soluble BAFF ligand from membranebound BAFF through the actions of a proprotein convertase (Schneider et al., 1999). Pairwise homology comparison of the RbBAFF amino acid sequence with other orthologs revealed a relatively high

Table 3 Pairwise homology comparison of the RbBAFF amino acid sequence with BAFF in other animal species. Scientific name

Common name

Accession No

Identity%

Similarity%

Gap%

Epinephelus awoara Lateolabrax japonicus Xiphophorus maculatus Salmo salar Takifugu obscurus Oncorhynchus mykiss Takifugu rubripes Oryzias latipes Pundamilia nyererei Maylandia zebra Ctenopharyngodon idella Danio rerio Gallus gallus Columba livia Bos taurus Homo sapiens Sus scrofa Xenopus laevis

Yellow grouper Japanese seabass Southern platyfish Atlantic salmon Mefugu Rainbow trout Fugu rubripes Japanese medaka Cichlid Zebra mbuna Grass carp Zebra fish Chicken Rock pigeon Cattle Human Pig African clawed frog

AFN70720 AEH22106 XP_005798137 NP_001135232 AEB69781 NP_001118036 XP_003961760 XP_004082024 XP_005747242 XP_004551418 AGG11791 NP_001107062 NP_989658 XP_005507869 NP_001107978 NP_006564 NP_001090967 AGN49363

83.0 78.8 69.4 69.2 69.1 68.8 68.7 67.9 63.3 63.0 51.2 49.5 37.8 37.5 35.7 35.7 34.5 32.9

86.7 85.2 80.0 80.1 80.0 79.7 80.0 76.6 72.6 72.2 67.3 66.0 51.6 53.2 51.9 52.7 44.4 51.2

1.9 1.5 1.9 1.1 1.5 0.8 1.5 4.2 5.6 5.6 11.0 13.3 18.4 15.4 13.1 13.3 25.0 20.3

6

G.I. Godahewa et al. / Developmental and Comparative Immunology 55 (2016) 1e11

Fig. 3. The tertiary structure of RbBAFF and the active tumor necrosis factor domain. (A) Human BAFF. The two extra b-sheets are presented in red. (B) Predicted structure of RbBAFF based on human BAFF. The Flap region is in purple, and N-glycosylation sites are shown as light blue spheres. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

conservation level between RbBAFF and its fish homologues, compared with higher vertebrates (Table 3). The highest sequence homology was found with Epinephelus awoara BAFF (83.0%), while that with higher vertebrate homologs was only <40%. Overall sequence identities ranged from 49.5% to 83.0% among teleosts, suggesting that RbBAFF is a relatively new member of the teleost BAFF family. 3.1.3. Tertiary structure modeling The - crystal structure of human BAFF (TALL 1) has been

previously documented (Karpusas et al., 2002; Liu et al., 2002). The three-dimensional structure of the RbBAFF monomer was constructed using human BAFF (PDB ID, 1osg.1.A) as the template by SWISS-MODEL (Fig. 3). Despite of some differences at the amino acid level, the predicted RbBAFF structure shares high similarities with the human BAFF template, suggesting that RbBAFF might share similar in vivo biological functions as human BAFF. The trimeric tertiary structure of the BAFF molecule might lead to the trimerization of BAFF receptors, and trigger the activation of downstream signal transduction pathways (Liu et al., 2002). The Flap region,

Fig. 4. Phylogenetic analysis of RbBAFF. Sequences (n ¼ 20) of varying origin were aligned using the MEGA software package, with evolutionary analysis conducted and bootstrapped 5000 times. The numbers at the branches denote the bootstrap values. The 0.1 scale indicates genetic distance. GenBank accession numbers are shown in parentheses next to each species.

G.I. Godahewa et al. / Developmental and Comparative Immunology 55 (2016) 1e11

7

Fig. 5. Expression levels of RbBAFF mRNA in rock bream tissues. Relative RbBAFF mRNA expression levels in each tissue were calculated, with b-actin used as the reference gene. The fold change in expression levels were determined, with those in muscle used as the baseline. Error bars represent the standard deviation from triplicate samples.

which is unique to BAFF homologs, was identified and is implicated in trimer formation and 60-mer formation in biological bodies (Liu et al., 2002). Although the 60-mer was reported to be comparatively more active than the trimeric form (Bossen and Schneider, 2006), the physiological interactions between BAFF receptor and the 60-mer still remain unclear. The overall predicted structure of RbBAFF was comparable to that of other BAFF tertiary structures, suggesting that it will have similar functions as those in different organisms.

3.1.4. Phylogenetic evolutionary assessment To determine the evolutionary position of RbBAFF, a phylogenetic tree was generated and analyzed based on the amino acid alignment of BAFF orthologs from different organisms. The tree comprised two clearly distinct branches, for fish and higher vertebrates. RbBAFF was placed within the perciforme subgroup, in close proximity to E. awoara BAFF (Fig. 4). The clustering pattern demonstrated that the RbBAFF homolog diverged from a common ancestor of other fish BAFFs.

Fig. 6. Temporal RbBAFF mRNA expression analysis in spleen tissue by qPCR following stimulation of the immune response. Animals were challenged with Streptococcus iniae, lipopolysaccharide (LPS), rock bream iridovirus (RBIV), polyinosinic:polycytidylic acid (poly I:C), or phosphate-buffered saline (PBS) as a control. RbBAFF expression levels were normalized to b-actin. Results are presented as the mean ± SD (n ¼ 3). Data with asterisks are significantly different at P < 0.05.

8

G.I. Godahewa et al. / Developmental and Comparative Immunology 55 (2016) 1e11

Fig. 7. SDS-PAGE analysis of rRbBAFF-MBP protein in E. coli expression system. Lanes: M; unstained protein marker (Takara Bio Inc.), UI; total cellular extract prior to IPTG induction, I; total cellular extract after IPTG induction, S; recombinant protein in supernatant (crude protein), P; pellet and E; purified protein elution.

3.2. Transcriptional expression 3.2.1. RbBAFF mRNA distribution in rock bream tissues The distribution pattern of RbBAFF mRNA in healthy rock bream tissues was examined by qPCR using b-actin as the reference gene (Fig. 5). We found that RbBAFF was constitutively expressed in all the tissues examined, although tissue-wise variation in mRNA abundance was shown. A single peak in the dissociation curve, and

a single band following agarose gel electrophoresis confirmed that the qPCR assay was specific for RbBAFF and b-actin. RbBAFF mRNA levels were normalized to those of b-actin in each tissue. RbBAFF mRNA was barely detected in muscle (1-fold), while it was expressed to a greater extent in the kidney (374.97-fold), head kidney (215.20-fold), spleen (162.05-fold), heart (104.04-fold), liver (82.23-fold) and blood cells (68.16-fold). The kidney is surrounded by lymphatic tissues containing lymph nodes that are rich in lymphocytes. In addition, the head kidney and spleen are lymphoid organs, and are the main sites for the differentiation of granulocytes, B cells, T cells, monocytes, and natural killer cells. These organs initiate adaptive immune responses by activating lymphocytes (Romano et al., 2000). Blood is also rich in lymphocytes, assisting in the development of defense mechanisms against blood-borne antigens. The RbBAFF transcript was highly expressed in kidney, head kidney, spleen, heart, and blood cells, most likely because of the presence of lymphocytes. It has been previously reported that human autoimmune patients €gren's syndrome (Groom et al., 2002; Lavie et al., diagnosed with Sjo 2004) and inflammatory arthritis (Tan et al., 2003) showed elevated levels of BAFF molecules in infected tissues. Furthermore, consistent BAFF mRNA expression in the spleen has been reported in a number of fish species, including yellow grouper (Xiao et al., 2014), mefugu (Ai et al., 2011), and spiny dogfish (Li et al., 2012). In general, most of our findings correspond with those observed by northern blotting analysis in human (Moore et al., 1999; Schneider et al., 1999) and qPCR analysis in bovine (Guan et al., 2008), goat (Shen et al., 2012), South African clawed frog (Yang et al., 2013) and goose (Dan et al., 2007) BAFF counterparts. The systemic expression of RbBAFF transcripts in different lymphatic tissues suggests that RbBAFF might contribute to immune responses and overall immunity.

Fig. 8. Survival and proliferation effect of the recombinant RbBAFF on rock bream lymphocytes. Cells were exposed to various concentrations of a recombinant RbBAFF protein or maltose-binding protein (MBP). Cells treated with an elution buffer were used as controls. Cell survival and proliferation were determined by MTT assays in triplicate. Results are presented as the mean optical density at 570 nm (OD570) ± SD (n ¼ 3). Data with asterisks are significantly different to its control and rMBP at P < 0.05.

G.I. Godahewa et al. / Developmental and Comparative Immunology 55 (2016) 1e11

3.2.2. RbBAFF mRNA detection in immune-challenged rock bream Transcriptional analysis of RbBAFF in rock bream spleen tissues demonstrated that time-dependent mRNA expression level induction upon different immune challenges (Fig. 6). In response to the infection with S. iniae, RbBAFF mRNA expression was significantly upregulated (P < 0.05) from 6 to 24 h p.i., peaking at 12 h p.i. (2.2-fold increase). Following the RBIV infection, RbBAFF mRNA expression elevated to 2.68-fold at 6 h and gradually reduced to the level similar to control. Administration of LPS and poly I:C significantly upregulated (P < 0.05) RbBAFF expression, with the peak of 1.76- and 3.26-fold increases in expression levels peaking at 24 h, respectively. In spiny dogfish, BAFF mRNA expression levels were examined in vitro following treatment with various immune stimulants and showed that LPS, a weak immune stimulant, and pokeweed mitogen, a potent immune stimulant, are significant inducers of BAFF mRNA expression (Li et al., 2012). In miiuy croaker, the infection with Vibrio anguillarum has been reported to upregulate the BAFF expression in liver, spleen and kidney (Meng et al., 2015). Together with the observations in the current study, fish BAFF is likely associated with the defense against pathogenic threats, possibly by serving to increase the numbers of B cells activated during an immune response (Mackay and Mackay, 2002). The induction of BAFF in response to pathogens might result in either the elimination of pathogens or repression of their growth via the adaptive immune response.

9

3.3. Functional characterization 3.3.1. Recombinant RbBAFF protein purification The samples collected during rRbBAFF-MBP protein purification were subjected to SDS-PAGE analysis. The presence of bands corresponding to the rRbBAFF-MBP protein with the expected size (RbBAFF; 29 kDa þ MBP; 42.5 kDa ¼ rRbBAFF-MBP; 71.5 kDa) in the induced and purified fractions revealed the successful protein expression and purification of rRbBAFF-MBP fusion protein (Fig. 7). 3.3.2. Lymphocyte proliferation We observed proliferation of rock bream lymphocytes, and an increase in cell survival rates under the treatment of purified rRbBAFF-MBP, in a dose-dependent manner (Fig. 8). MTT assay results showed that the in vitro lymphocyte proliferation activity of RbBAFF gradually increased with the concentration increase of rRbBAFF-MBP within the examined ranges from 2.5 to 10 mg/mL and then gradually reduced when the concentration of rRbBAFFMBP exceeded 10 mg/mL. In contrast, rMBP did not affect lymphocyte proliferation activity, confirming that rMBP is effectively inert and does not influence cell proliferation. The adverse effects of high concentrations of rRbBAFF-MBP might be due to the activation of cell death mechanisms in B cells (Vincent et al., 2014). The results in our study could well correspond with those reported in zebrafish (Liang et al., 2010), yellow grouper (Xiao et al., 2014), and mefugu (Ai et al., 2011) BAFFs. Our findings clearly highlight the importance of the RbBAFF molecule for lymphocyte proliferation in rock bream.

Fig. 9. Flow cytometry analysis of the effects of recombinant RbBAFF on lymphocyte survival. Control (untreated), rMBP (10 mg/mL), and recombinant RbBAFF fused to MBP (rRbBAFF-MBP; 10 mg/mL) were used as treatments. (A) Histogram expression of average live cell percentage from each treatment. (B) Statistical analysis of triplicate experiments with ±SD (n ¼ 3). Live and dead cells were differentiated using annexin-V. The live cell count is presented as the gated cell percentage.

10

G.I. Godahewa et al. / Developmental and Comparative Immunology 55 (2016) 1e11

Fig. 10. Temporal mRNA expression analysis of RbIL-10 and RbNFkB-1 in freshly isolated rock bream lymphocytes treated with rRbBAFF-MBP. Expression levels of RbIL-10 and RbNFkB-1 were normalized to those in MBP-treated lymphocytes. Results are presented as the mean ± SD (n ¼ 3). Data with asterisks are significantly different at P < 0.05.

3.3.3. Flow cytometry analysis of lymphocyte viability Cell death of lymphocytes occurs rapidly under in vitro condition after collection due to apoptosis. To further verify the effects of rRbBAFF-MBP on B cell survival survival of rock bream lymphocytes, flow cytometry was conducted with the rock bream lymphocytes after different treatments. The viability of rock bream lymphocytes was 40.7 ± 1.65% for untreated control cells. The value was increased to 71.5 ± 1.28% when 10 mg/mL rRbBAFF-MBP was added, while no significant change from control (40.8 ± 1.12%) was observed with the 10 mg/mL rMBP (Fig. 9). Our results demonstrated that rRbBAFF-MBP could extend the survival and proliferation of rock bream lymphocytes by approximately 31%. Similarly in a previous study in mefugu, it was also reported that recombinant BAFF prolonged the survival of mouse splenic B cells (Ai et al., 2011). Taken together, these results suggest that teleost BAFF homologs are functionally active, and play an analogous role as illustrated in mammals.

3.3.4. Transcriptional expression analysis of associated genes To evaluate the roles of rRbBAFF-MBP in cytokine production and transcription regulation of immune genes, relative mRNA expression levels of RbIL-10 and RbNFkB-1 were examined in rock bream lymphocytes incubated with rRbBAFF-MBP (Fig. 10). We observed a significant elevation in RbIL-10 transcript levels after 6 h, and a significantly induced RbNFkB-1 mRNA levels after 3 h, peaking at 6 h, compared with those for untreated controls. It was reported that the numbers of IL-10-producing B cells were significantly increased in BAFF-treated B cell cultures (Yang et al., 2010). As an anti-inflammatory cytokine, IL-10 can suppress the harmful immune responses after stimulation. IL-10 can affect the behaviors of both IL-10 producing cells and surrounding cells and is critically important in B cell survival, proliferation, and antibody production (Mizoguchi and Bhan, 2006). Likewise, exogenous BAFF might activate the NFkB signaling pathway, to regulate adaptive immune functions, via the transcription of anti-apoptotic Bcl-2, which is also involved in B cell differentiation (Yang et al., 2010). Furthermore,

BAFF has been shown to activate the classical NFkB pathway, leading to BAFF-enhanced B cell survival in vitro (Enzler et al., 2006). In our current study, the RbBAFF molecule prolonged the survival of rock bream lymphocytes (Figs. 8 and 9), which might be partially resulted from the induced expression of RbIL-10 and/or RbNFkB-1. Herein, we have presented the evidence of a correlation in expression levels for BAFF, IL-10 and NFkB-1 genes in teleost lymphocytes. 4. Conclusion In summary, we analyzed the molecular structure, transcriptional expression patterns, and functional aspects of rock bream BAFF. Bioinformatic analysis of RbBAFF reaffirmed the conserved nature of BAFF in vertebrate evolution. We detected RbBAFF mRNAs in various tissues of rock bream, and found that RbBAFF was clearly induced following infection with pathogens or treatment with certain immune stimulants. The recombinant protein of RbBAFF may upregulated the transcription of RbIL-10 and RbNFkB-1, which might explain its roles in the survival and proliferation of rock bream lymphocytes. Taken together, our findings suggest that RbBAFF is critical in regulating rock bream lymphocyte gene expression and survival, thereby act as an adaptive immune response in rock bream. However, further studies are required to fully elucidate the various molecular functions of teleost BAFF. Acknowledgments This research was a part of the project titled ‘Fish Vaccine Research Center’, funded by the Ministry of Oceans and Fisheries, Korea and by Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education (2013R1A1A2064735). References Ai, H., Shen, Y., Min, C., Pang, S., Zhang, J., Zhang, S., Zhao, Z., 2011. Molecular

G.I. Godahewa et al. / Developmental and Comparative Immunology 55 (2016) 1e11 structure, expression and bioactivity characterization of TNF13B (BAFF) gene in mefugu, Takifugu obscurus. Fish Shellfish Immunol. 30, 1265e1274. Bodmer, J.L., Schneider, P., Tschopp, J., 2002. The molecular architecture of the TNF superfamily. Trends. Biochem. Sci. 27, 19e26. Bossen, C., Schneider, P., 2006. BAFF, APRIL and their receptors: structure, function and signaling. Semin. Immunol. 18, 263e275. Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248e254. Cheema, G.S., Roschke, V., Hilbert, D.M., Stohl, W., 2001. Elevated serum B lymphocyte stimulator levels in patients with systemic immune-based rheumatic diseases. Arthritis Rheum. 44, 1313e1319. Chen, C.M., Ren, W.H., Yang, G., Zhang, C.S., Zhang, S.Q., 2009. Molecular cloning, in vitro expression and bioactivity of quail BAFF. Vet. Immunol. Immunopathol. 130, 125e130. Claudio, E., Brown, K., Park, S., Wang, H., Siebenlist, U., 2002. BAFF-induced NEMOindependent processing of NF-kappa B2 in maturing B cells. Nat. Immunol. 3, 958e965. Dan, W.B., Guan, Z.B., Zhang, C., Li, B.C., Zhang, J., Zhang, S.Q., 2007. Molecular cloning, in vitro expression and bioactivity of goose B-cell activating factor. Vet. Immunol. Immunopathol. 118, 113e120. De Castro, E., Sigrist, C.J., Gattiker, A., Bulliard, V., Langendijk-Genevaux, P.S., Gasteiger, E., Bairoch, A., Hulo, N., 2006. ScanProsite: detection of PROSITE signature matches and ProRule-associated functional and structural residues in proteins. Nucleic Acids Res. 34, W362eW365. Enzler, T., Bonizzi, G., Silverman, G.J., Otero, D.C., Widhopf, G.F., Anzelon-Mills, A., Rickert, R.C., Karin, M., 2006. Alternative and classical NF-kappa B signaling retain autoreactive B cells in the splenic marginal zone and result in lupus-like disease. Immunity 25, 403e415. Godahewa, G.I., Wickramaarachchi, W.D., Whang, I., Bathige, S.D., Lim, B.S., Choi, C.Y., De Zoysa, M., Noh, J.K., Lee, J., 2014. Two carboxypeptidase counterparts from rock bream (Oplegnathus fasciatus): molecular characterization, genomic arrangement and immune responses upon pathogenic stresses. Vet. Immunol. Immunopathol. 162, 180e191. Groom, J., Kalled, S.L., Cutler, A.H., Olson, C., Woodcock, S.A., Schneider, P., Tschopp, J., Cachero, T.G., Batten, M., Wheway, J., Mauri, D., Cavill, D., Gordon, T.P., Mackay, C.R., Mackay, F., 2002. Association of BAFF/BLyS overexpression and altered B cell differentiation with Sjogren's syndrome. J. Clin. Invest 109, 59e68. Gross, J.A., Johnston, J., Mudri, S., Enselman, R., Dillon, S.R., Madden, K., Xu, W., Parrish-Novak, J., Foster, D., Lofton-Day, C., Moore, M., Littau, A., Grossman, A., Haugen, H., Foley, K., Blumberg, H., Harrison, K., Kindsvogel, W., Clegg, C.H., 2000. TACI and BCMA are receptors for a TNF homologue implicated in B-cell autoimmune disease. Nature 404, 995e999. Guan, Z.B., Shui, Y., Zhang, J.X., Zhang, S.Q., 2008. Molecular cloning, genomic organization and expression analysis of the gene encoding bovine (Bos taurus) Bcell activating factor belonging to the TNF family (BAFF). Gene 425, 17e22. Karpusas, M., Cachero, T.G., Qian, F., Boriack-Sjodin, A., Mullen, C., Strauch, K., Hsu, Y.M., Kalled, S.L., 2002. Crystal structure of extracellular human BAFF, a TNF family member that stimulates B lymphocytes. J. Mol. Biol. 315, 1145e1154. Kim, H.M., Yu, K.S., Lee, M.E., Shin, D.R., Kim, Y.S., Paik, S.G., Yoo, O.J., Lee, H., Lee, J.O., 2003. Crystal structure of the BAFF-BAFF-R complex and its implications for receptor activation. Nat. Struct. Biol. 10, 342e348. Lavie, F., Miceli-Richard, C., Quillard, J., Roux, S., Leclerc, P., Mariette, X., 2004. Expression of BAFF (BLyS) in T cells infiltrating labial salivary glands from patients with Sjogren's syndrome. J. Pathol. 202, 496e502. Letunic, I., Doerks, T., Bork, P., 2009. SMART 6: recent updates and new developments. Nucleic Acids Res. 37, D229eD232. Li, H., Sun, Z.P., Li, Q., Jiang, Y.L., 2011. Characterization of an iridovirus detected in rock bream (Oplegnathus fasciatus; Temminck and Schlegel). Chin. J. Virol. 27, 158e164. Li, R., Dooley, H., Wang, T., Secombes, C.J., Bird, S., 2012. Characterisation and expression analysis of B-cell activating factor (BAFF) in spiny dogfish (Squalus acanthias): cartilaginous fish BAFF has a unique extra exon that may impact receptor binding. Dev. Comp. Immunol. 36, 707e717. Liang, Z., Kong, Y., Luo, C., Shen, Y., Zhang, S., 2010. Molecular cloning, functional characterization and phylogenetic analysis of B-cell activating factor in zebrafish (Danio rerio). Fish Shellfish Immunol. 29, 233e240. Lipton, D.W., Kim, D.H., 2010. Accounting for economic risk and uncertainty in offshore aquaculture: a case study of Korean rock bream production. Bull. Fish Res. Agency 29, 93e102. Liu, Y., Hong, X., Kappler, J., Jiang, L., Zhang, R., Xu, L., Pan, C.H., Martin, W.E., Murphy, R.C., Shu, H.B., Dai, S., Zhang, G., 2003. Ligand-receptor binding revealed by the TNF family member TALL-1. Nature 423, 49e56. Liu, Y., Xu, L., Opalka, N., Kappler, J., Shu, H.B., Zhang, G., 2002. Crystal structure of sTALL-1 reveals a virus-like assembly of TNF family ligands. Cell 108, 383e394. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402e408. Mackay, F., Browning, J.L., 2002. BAFF: a fundamental survival factor for B cells. Nat. Rev. Immunol. 2, 465e475. Mackay, F., Leung, H., 2006. The role of the BAFF/APRIL system on T cell function. Semin. Immunol. 18, 284e289. Mackay, F., Mackay, C.R., 2002. The role of BAFF in B-cell maturation, T-cell

11

activation and autoimmunity. Trends. Immunol. 23, 113e115. Mariette, X., Roux, S., Zhang, J., Bengoufa, D., Lavie, F., Zhou, T., Kimberly, R., 2003. The level of BLyS (BAFF) correlates with the titre of autoantibodies in human Sjogren's syndrome. Ann. Rheum. Dis. 62, 168e171. Meng, F., Sun, Y., Xu, T., 2015. Comparative genomic of the BAFF and BAFF-like genes and immune response to bacteria of miiuy croaker (Miichthys miiuy). Fish Shellfish Immunol. 43, 191e199. Mizoguchi, A., Bhan, A.K., 2006. A case for regulatory B cells. J. Immunol. 176, 705e710. Moore, P.A., Belvedere, O., Orr, A., Pieri, K., LaFleur, D.W., Feng, P., Soppet, D., Charters, M., Gentz, R., Parmelee, D., Li, Y., Galperina, O., Giri, J., Roschke, V., Nardelli, B., Carrell, J., Sosnovtseva, S., Greenfield, W., Ruben, S.M., Olsen, H.S., Fikes, J., Hilbert, D.M., 1999. BLyS: member of the tumor necrosis factor family and B lymphocyte stimulator. Science 285, 260e263. Mukhopadhyay, A., Ni, J., Zhai, Y., Yu, G.L., Aggarwal, B.B., 1999. Identification and characterization of a novel cytokine, THANK, a TNF homologue that activates apoptosis, nuclear factor-kappaB, and c-Jun NH2-terminal kinase. J. Biol. Chem. 274, 15978e15981. Nguyen, T.G., Morris, J.M., 2014. Signals from activation of B-cell receptor with antiIgD can override the stimulatory effects of excess BAFF on mature B cells in vivo. Immunol. Lett. 161, 157e164. Romano, N., Ceccariglia, S., Abelli, L., Mazzini, M., Mastrolia, L., 2000. Lymphomyeloid organs of the Antarctic fish Trematomus nicolai and Chionodraco hamatus (Teleostei: Notothenioidea): a comparative histological study. Polar Biol. 23, 321e328. Schiemann, B., Gommerman, J.L., Vora, K., Cachero, T.G., Shulga-Morskaya, S., Dobles, M., Frew, E., Scott, M.L., 2001. An essential role for BAFF in the normal development of B cells through a BCMA-independent pathway. Science 293, 2111e2114. Schneider, P., MacKay, F., Steiner, V., Hofmann, K., Bodmer, J.L., Holler, N., Ambrose, C., Lawton, P., Bixler, S., Acha-Orbea, H., Valmori, D., Romero, P., Werner-Favre, C., Zubler, R.H., Browning, J.L., Tschopp, J., 1999. BAFF, a novel ligand of the tumor necrosis factor family, stimulates B cell growth. J. Exp. Med. 189, 1747e1756. Shen, Y., You, F., Li, C., He, Z., Liang, Z., Ai, H., Wang, S., Zhang, S., 2012. Molecular cloning, bioinformatics analysis and functional characterization of B-cell activating factor in goat (Capra hircus). Dev. Comp. Immunol. 36, 191e198. Shu, H.B., Hu, W.H., Johnson, H., 1999. TALL-1 is a novel member of the TNF family that is down-regulated by mitogens. J. Leukoc. Biol. 65, 680e683. Spinner, D.M., 2001. MTT growth assays in ovarian cancer. Methods Mol. Med. 39, 175e177. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731e2739. Tan, S.M., Xu, D., Roschke, V., Perry, J.W., Arkfeld, D.G., Ehresmann, G.R., Migone, T.S., Hilbert, D.M., Stohl, W., 2003. Local production of B lymphocyte stimulator protein and APRIL in arthritic joints of patients with inflammatory arthritis. Arthritis. Rheum. 48, 982e992. Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 22, 4673e4680. Tribouley, C., Wallroth, M., Chan, V., Paliard, X., Fang, E., Lamson, G., Pot, D., Escobedo, J., Williams, L.T., 1999. Characterization of a new member of the TNF family expressed on antigen presenting cells. Biol. Chem. 380, 1443e1447. Umasuthan, N., Whang, I., Lee, Y., Lee, S., Kim, Y., Kim, H., Jung, S.J., Oh, M.J., Choi, C.Y., Yeo, S.Y., Lee, S.J., Lee, J., 2011. Heparin cofactor II (RbHCII) from rock bream (Oplegnathus fasciatus): molecular characterization, cloning and expression analysis. Fish Shellfish Immunol. 30, 194e208. Vincent, F.B., Morand, E.F., Schneider, P., Mackay, F., 2014. The BAFF/APRIL system in SLE pathogenesis. Nat. Rev. Rheumatol. 10, 365e373. Vogt, G., Chapgier, A., Yang, K., Chuzhanova, N., Feinberg, J., Fieschi, C., BoissonDupuis, S., Alcais, A., Filipe-Santos, O., Bustamante, J., De Beaucoudrey, L., AlMohsen, I., Al-Hajjar, S., Al-Ghonaium, A., Adimi, P., Mirsaeidi, M., Khalilzadeh, S., Rosenzweig, S., De la Calle Martin, O., Bauer, T.R., Puck, J.M., Ochs, H.D., Furthner, D., Engelhorn, C., Belohradsky, B., Mansouri, D., Holland, S.M., Schreiber, R.D., Abel, L., Cooper, D.N., Soudais, C., Casanova, J.L., 2005. Gains of glycosylation comprise an unexpectedly large group of pathogenic mutations. Nat. Genet. 37, 692e700. Xiao, W., Long, W., Liu, G.Y., Sui, C.L., Guo, X.R., Tian, A., Ji, C.B., Cui, X.W., Zhang, S.Q., 2014. Molecular cloning, expression and functional analysis of B-cell activating factor (BAFF) in yellow grouper, Epinephelus awoara. Mol. Immunol. 59, 64e70. Xu, L.G., Wu, M., Hu, J., Zhai, Z., Shu, H.B., 2002. Identification of downstream genes up-regulated by the tumor necrosis factor family member TALL-1. J. Leukoc. Biol. 72, 410e416. Yang, L., Zhou, L., Zong, X., Cao, X., Ji, X., Gu, W., Zhang, S., 2013. Characterization of the molecular structure, expression and bioactivity of the TNFSF13B (BAFF) gene of the South African clawed frog, Xenopus laevis. Int. Immunopharmacol. 15, 478e487. Yang, M., Sun, L., Wang, S., Ko, K.H., Xu, H., Zheng, B.J., Cao, X., Lu, L., 2010. Novel function of B cell-activating factor in the induction of IL-10-producing regulatory B cells. J. Immunol. 184, 3321e3325.