Alternative splicing of the vitamin D receptor modulates target gene expression and promotes ligand-independent functions

Toxicology and Applied Pharmacology 364 (2019) 55–67

Contents lists available at ScienceDirect

Toxicology and Applied Pharmacology journal homepage: www.elsevier.com/locate/taap

Alternative splicing of the vitamin D receptor modulates target gene expression and promotes ligand-independent functions

T

Andrew J. Annaloraa, , Marija Jozica, Craig B. Marcusa, Patrick L. Iversena,b ⁎

a b

Department of Environmental and Molecular Toxicology, Oregon State University, 1007 Agriculture & Life Sciences Building, Corvallis, OR 97331; USA LS Pharma, 884 Park St., Lebanon, OR 97355; USA

ARTICLE INFO

ABSTRACT

Keywords: Alternative splicing Exon skipping Vitamin D receptor Antisense oligonucleotides Phosphorodiamidate morpholino oligomers Gene-directed therapy

Alternative splicing modulates gene function by creating splice variants with alternate functions or non-coding RNA activity. Naturally occurring variants of nuclear receptor (NR) genes with dominant negative or gain-offunction phenotypes have been documented, but their cellular roles, regulation, and responsiveness to environmental stress or disease remain unevaluated. Informed by observations that class I androgen and estrogen receptor variants display ligand-independent signaling in human cancer tissues, we questioned whether the function of class II NRs, like the vitamin D receptor (VDR), would also respond to alternative splicing regulation. Artificial VDR constructs lacking exon 3 (Dex3-VDR), encoding part of the DNA binding domain (DBD), and exon 8 (Dex8-VDR), encoding part of the ligand binding domain (LBD), were transiently transfected into DU-145 cells and stably-integrated into Caco-2 cells to study their effect on gene expression and cell viability. Changes in VDR promoter signaling were monitored by the expression of target genes (e.g. CYP24A1, CYP3A4 and CYP3A5). Ligand-independent VDR signaling was observed in variants lacking exon 8, and a significant loss of gene suppressor function was documented for variants lacking exon 3. The gain-of-function behavior of the Dex8-VDR variant was recapitulated in vitro using antisense oligonucleotides (ASO) that induce the skipping of exon 8 in wild-type VDR. ASO targeting the splice acceptor site of exon 8 significantly stimulated ligand-independent VDR reporter activity and the induction of CYP24A1 above controls. These results demonstrate how alternative splicing can re-program NR gene function, highlighting novel mechanisms of toxicity and new opportunities for the use of splice-switching oligonucleotides (SSO) in precision medicine.

1. Introduction The protein-coding sequences of eukaryotic genes (exons) are interrupted by non-coding elements (introns) that must be removed from pre-messenger RNA (pre-mRNA) by the spliceosome, prior to protein translation by the ribosome. Alternative splicing is a highly-complex and stochastic process subject to noise, interference and multiple kinetic variables including the rate of pre-mRNA transcription and spliceosome assembly (Gallego-Paez et al., 2017; Park et al., 2018; Wan and Larson, 2018). Additional mechanisms regulating alternative splicing include: (1) hierarchical splice-site recognition; (2) tissue-specific modulation of regulatory splicing factors; and (3) RNA secondary structure that modulates interactions among pre-mRNA transcripts, splicing factors and non-coding, regulatory RNAs (e.g. miRNAs) (Zaharieva et al., 2012; Wan and Larson, 2018). Emerging interest is reported in understanding the role that disease (e.g. cancer) and chemical exposures play in altering pre-mRNA splicing events (Cooper

⁎

et al., 2009; Tang et al., 2013; Wong et al., 2018; Song et al., 2018). Xenobiotics and chemotherapeutic agents (Zaharieva et al., 2012; Lambert et al., 2017), UV-B radiation (Sprung et al., 2011), oxidative stress (Cote et al., 2012; Melangath et al., 2017) and heavy metals (Jiang et al., 2017; Li et al., 2018; Wang et al., 2018a) are all recognized for their potential to alter pre-mRNA splicing patterns via multiple mechanisms, including the altered activity of splice-sensitive, transcription factors (Kornblihtt et al., 2013). Cellular factors regulating alternative pre-mRNA splicing are not fully elucidated but there is growing interest in developing pharmacotherapeutic strategies that target alternatively-spliced driver transcripts linked to cancer and related disorders (Martínez-Montiel et al., 2017; Liu et al., 2018; Urbanski et al., 2018; Hepburn et al., 2018; Read and Natrajan, 2018). The use of splice-switching oligonucleotides (SSO) represents a prominent approach to correcting splicing disorders (Bauman et al., 2009), and the clinical safety and efficacy of pre-mRNA transcript-directed, antisense oligonucleotides (ASO) continues to advance

Corresponding author. E-mail address: [email protected] (A.J. Annalora).

https://doi.org/10.1016/j.taap.2018.12.009 Received 20 September 2018; Received in revised form 4 December 2018; Accepted 10 December 2018 Available online 12 December 2018 0041-008X/ © 2018 Elsevier Inc. All rights reserved.

Toxicology and Applied Pharmacology 364 (2019) 55–67

A.J. Annalora et al.

Table 1 Phosphorodiamidate Morpholino Oligomers Targeting the Skipping of Exon 8 in the Human VDR Gene. Oligomer hVDR_Dex8_PMO hVDR_Dex8_PMO hVDR_Dex8_PMO hVDR_Dex8_PMO hVDR_Dex8_PMO

(−18,7) (−5,17) (+4,26) (+12,34) (+115,137)

Sequence

Target

5′ – TGTCCGGCTGTGAGAGACAATGGCC – 3′ 5′– GCTCCAGGCTGTGTCCGGCTGTG – 3′ 5′ – CTCAATCAGCTCCAGGCTGTGTC – 3’ 5′ – ATGAGGGGCTCAATCAGCTCCAG – 3’ 5′ – CCGATTCTGCAGCTGGAGCCACAC – 3’

Splice Splice Splice Splice Splice

(Reautschnig et al., 2017). ASO-induced alternative splicing can suppress the translation of a transcript or promote alternate exon inclusion in the processed transcript (Croft et al., 2000; Kole et al., 2012; van Roon-Mom and Aartsma-Rus, 2012). Exon skipping drugs are being developed for the treatment of several rare human diseases, including Duchenne's muscular dystrophy (DMD) (McClorey et al., 2006; Adams et al., 2007; Koo and Wood, 2013). In the fall of 2016, the FDA granted accelerated approval to Eteplirsen for the treatment of DMD (Syed, 2016), making it the first SSO drug approved in the United States (Aartsma-Rus and Krieg, 2017). Our group is interested in understanding the mechanisms by which environmental stress and xenobiotic exposure can alter pre-mRNA splicing patterns, and how SSO technology can be used to correct or modify the expression profile of splice-sensitive transcripts linked to disease (Iversen et al., 2012; Heald et al., 2014; Mourich et al., 2014; Heald et al., 2015). In the current study, we manipulated the exon structure of the vitamin D receptor (VDR) to clarify its sensitivity to alternative splicing events, and to elaborate the structural determinants of both ligand-dependent and ligand-independent functions associated with alternative exon inclusion. We hypothesized exon-skipped, truncated forms of the VDR, lacking either a functional DNA-binding domain (DBD) or a ligand-binding domain (LBD) would express either dominant-negative or ligand-independent functions. In the androgen receptor (AR) aberrant splicing promotes the expression of ligand-independent AR variants that drive human prostate cancer progression (Dehm et al., 2008; Daniel and Dehm, 2017; Guo and Qiu, 2011). This phenomenon exemplifies splice-site regulation contribution to the expansion of gene function during bouts of elevated stress or disease (Chen and Weiss, 2015). Because all 48 members of the NR superfamily share a common molecular structure (Germain et al., 2006; Rastinejad et al., 2013; Bennesch and Picard, 2015), we questioned whether alternative exon inclusion in the VDR could create gain- or loss-of-function phenotypes relevant to the treatment or diagnosis of disease. The VDR is an intracellular NR that selectively binds the vitamin D hormone to transduce both genomic and non-genomic signaling cascades (Norman, 2006). This class II NR typically heterodimerizes with the retinoid X receptor (RXR) to target vitamin D response elements (VDRE) in vitamin D hormone-responsive target genes (Pike et al., 2014). Extensive efforts have been made to characterize its structure/ function, with over 100 crystal structures of the DBD or LBD now available for study (Rochel et al., 2000; Shaffer and Gewirth, 2004; Orlov et al., 2012; Molnár, 2014). Polymorphisms of the VDR gene are associated with human disorders, including chronic kidney disease (CKD) (Zmuda et al., 2000; Zhou et al., 2009) and several forms of cancer (Köstner et al., 2009; Gandini et al., 2014). > 10 natural VDR splice variants that alter the structure/function of the DBD or LBD are known to exist (Hughes et al., 1988; Kristjansson et al., 1993; Whitfield et al., 2001), however the complexity of the VDR transcriptome in both normal and human cancer cells remains less well understood (Campbell, 2014; Long et al., 2015). The current studies were designed to investigate the functional implications of alternative VDR gene splicing, and to explore the potential of SSO therapeutics targeting to alter VDR signaling cascades, in vitro. VDR splice variants lacking exon-specific segments of the DBD or LBD have not been identified, however, there is strong evidence that other steroid receptors are subject to this type of splicing-based

Acceptor – Intron 7/Exon Acceptor – Intron 7/Exon Acceptor – Intron 7/Exon Acceptor – Intron 7/Exon Donor – Exon8/Intron 8

8 8 8 8

regulation that promotes ligand-independent modes of gene activation (Bennesch and Picard, 2015). Constitutively-active splice variants of the class I androgen receptor (Dehm et al., 2008; Guo and Qiu, 2011; Daniel and Dehm, 2017), and mineralcorticoid receptor (Zennaro et al., 2001), have been identified, and a constitutively-active aryl hydrocarbon receptor (AhR) variant lacking a discrete segment of the LBD has also been described (McGuire et al., 2001). The ligand-independent functions of the class I estrogen receptor (ER) are also increasingly recognized (Stellato et al., 2016), and improved knowledge of ER splice variant regulation has important implications for the treatment of breast cancer (Heldring et al., 2007; Al-Bader et al., 2011; Zhu et al., 2018). No gain-of-function or constitutively-active splice variants arising from the class II NR family are reported, which includes the thyroid hormone receptor (TR), retinoic acid receptor (RAR) and the VDR, among others. However, multiple mechanisms underlying the known, ligand-independent functions of class II NRs, including the VDR (Castillo et al., 1999; Skorija et al., 2005; Dowd and MacDonald, 2010; Malloy and Feldman, 2013; Bikle et al., 2015; Lee and Pike, 2015) and the thyroid hormone receptor (TR) (Moriyama et al., 2016; Cvoro et al., 2016; Takamizawa et al., 2018), have been proposed. 2. Methods 2.1. Antisense oligonucleotides Phosphorodiamidate morpholino oligomers (PMO) whose sequences have identity with nucleic acid sequences near the splice acceptor (SA) or splice donor (SD) site of exon 8 of the human VDR mRNA were designed based on the manufacturer's recommendations. The names of these sequences and their target site, with respect to the Intron7/Exon8 splice junction, are noted in Table 1. An unrelated, scrambled PMO (SC; 5’-AGTCTCGACTTGCTACCTCA-3′) was used as a control for all experiments. All PMOs were developed and synthesized by Gene Tools, LLC (Corvallis, OR). 2.1.1. Construct development Dex3 (Delta Exon 3) and Dex8 (Delta Exon 8) human VDR construct variants were designed for transient and stable integration into vitamin D hormone-responsive cell lines expressing wild-type VDR, using synthetic services from Blue Heron (Origene). Exon 3 of the VDR is not organized for clean skipping, therefore the Dex3-VDR construct was designed to incorporate a two nucleotide insertion (GT) between exons 2 and 4 of the human VDR, to maintain proper reading frame and prevent nonsense mediated decay (NMD). The Dex3-VDR construct does not mimic a known, VDR variant form, but the absence of a complete DBD provides a dominant negative control for genomic VDR signaling activity. The incorporation of the Dex3-VDR variant into TC7 cells was monitored using the Dex3 Primer set (Dex3_FP: TGACCCTG GAGACTTTGACC; and Dex3_RP: CTGGCAGAAGTCGGAGTAGG; 424 bp product for wild-type VDR; 295 bp product for Dex3 Variant). In contrast, exon 8 of the VDR is a cassette exon organized for clean, exon skipping in vivo, therefore the Dex8-VDR construct includes no insertions, but includes artificial DNA segments in Exon 7 (D253-V261; GATCTGACTAGCGAAGATCAGATAGTT) and Exon 9 ((L404–T415; CTCTCCTTCCAGCCTGAGTGCAGCATGAAGCTAACG), which were codon optimized, and silently-mutated from wild-type residues, to 56

Toxicology and Applied Pharmacology 364 (2019) 55–67

A.J. Annalora et al.

allow for unique monitoring of both endogenous and artificial Dex8VDR transcripts, using either the Dex8 Primer set (Dex8_FP: GACCTC ACCTCTGAGGACCA; and Dex8_RP: CACTCAGGCTGGAAGGAGAG; 473 bp product for Wild-type VDR; 356 bp product for the natural Dex8 variant) or the ART_8 Primer set (ART8_FP: CTGACTAGCGAAGATCA GAT; and ART8_RP: AACATTCGGGCTGAAATGAC; 355 bp product for artificial Dex8 VDR variant). A third expression construct containing wild-type human VDR (WT-VDR) was also developed for use as a positive control in transfection assays. All primers were designed using Primer3 software (Untergasser et al., 2012) and purchased from Integrated DNA Technologies (IDT; idtdna.com). Additional details regarding the design and sequences for the Dex3-and Dex8-VDR expression constructs are provided in Supplemental Figs. 1 and 2.

treated with DNaseI (New England Biolabs; 1 U/μg RNA; 30 min at 37 °C; 5 min at 75 °C) to remove genomic DNA prior to reverse transcription of mRNA to cDNA using the iScript™ cDNA synthesis (Bio Rad; #170–8890). Endpoint PCR was performed using the Platinum Taq High Fidelity DNA Polymerase kit (Invitrogen; 11,304–011) using the manufacturer's recommended protocol with minor modifications; optimal annealing temperatures for the Dex8, Art8 and Dex3 primer sets were determined empirically, between 50 and 55 °C for 30 s. PCR products were visualized on 1% UltraPure Agarose gels (Invitrogen; 15,510–027) prepared in 1× TBE buffer and stained with Ethidium Bromide Solution (Calbiochem; #4410). DNA levels were quantified using ImageJ software (imagej.nih.gov/ij/) (Schneider et al., 2012), as needed.

2.1.2. Stable cell line development and transfection Artificial Dex3- and Dex8-VDR transcripts were cloned into the pCMV6-AC vector (Blue Heron/Origene) and stably integrated into wild-type (TC7) Caco-2 colon cancer cells obtained from Dr. Monique Rousset (INSERM, Paris, France). DE3-TC7 and DE8-TC7 clonal cell lines were developed using manufacturer recommended protocols for Attractene Transfection Reagent (Qiagen; #301005) and Geneticin (G418; Life Technologies) antibiotic selection. Clones were screened from 100 to 1000 μg/ml G418 and individual clones were selected at 400 μg/ml G418, and maintained at 200 μg/ml G418. The stable incorporation of Dex3- and Dex8-VDR variants into TC7 cell line clones (DE3-TC7 and DE8-TC7) was validated using endpoint PCR (Taq Polymerase; Invitrogen) and DNA sequencing (using the Dex3 or Art8 primer sets) and services from the Center for Genomic Research and Bioinformatics (CGRB) at Oregon State University.

2.1.5. Quantitative real-time PCR qRT-PCR analysis was performed using the iQ SYBR Green Supermix (BioRad; 170–8880) in the ABI PRISM® 7500 FAST Sequence Detection System (Applied Biosystems; 2 h run protocol; 96-well plate) using the manufacturer's recommended settings for SYBR Green qPCR analysis. Assays were performed in technical quadruplicates using pre-validated, Primetime qPCR primer set assays from for human target genes: VDR (Hs.PT.58.3778628), CYP24A1 (Hs.PT.58.39761100), CYP3A4 (Hs.PT.58.27726673), and CYP3A5 (Hs.PT.58.41063109), 18 s RNA (Hs.PT.39a.22214856.g) and ACTB (Hs.PT.39a.22214847), all obtained. Template (10–25 ng) and primer concentrations (0.5 – 1× Primetime mix) were optimized for each primer set to eliminate primer dimer formation in final experimental conditions. Results of 4 replicate samples are reported, and are normalized to the relative expression of 18S RNA in each sample. ACTB was chosen as an alternative internal standard, but was not used in calculating final results, due to higher variability among technical replicates.

2.1.3. Cell culture Caco-2 (TC7-WT, DE3C1 and DE8C2) and DU-145. Standard cell culture techniques were used to grown these cell lines and total RNA was extracted for analysis (RNAeasy Mini Kit; Qiagen) by PCR. The expression of key VDR-related target genes in the TC7 clones (including CYP3A4, CYP3A5, CYP24A1 and the VDR) were monitored using endpoint and Primetime qPCR primer sets (IDT Technologies). Sanger DNA sequencing was used to validate the proper sequence of VDR transcript variants in both cell lines (CGRB services, OSU). Cells were treated with either normal media (DMEM +20% FBS) or normal media supplemented with calcitriol [10–100 nM] for 1–7 days, for different experiments. Fresh media was provided after 3 days for all extended experiments. Experimental and Scrambled Control PMOs used in cell culture experiments (0.1–3 μM) were administered using an established scrapeloading protocol (McClorey et al., 2006; Adams et al., 2007). The doseresponsive ability of Dex8-VDR PMOs to convert wild-type VDR premRNA to the delta exon 8 transcript variant is provided in Supplemental Fig. 3. Crystalline 1,25-hydroxyvitamin D3 (1α,25(OH)2D3 or calcitriol) was obtained from Sigma-Aldrich (St. Louis, Mo; #D1530) and used without further purification; concentration of stock solutions was evaluated by UV/Vis analysis using the molar extinction coefficient (ε = 18,200 M−1 cm−1 at 265 nm). The concentrations of 1α,25(OH) 2D3 used in these studies (10–100 nM) was based on the range required to inhibit prostate cancer cell proliferation in tissue culture; this range is ~1000× higher than the 20–150 pM concentrations normally found in the systemic circulation (Gandini et al., 2014). However, because the goal of our project was to compare the ability of dominant negative and ligand-independent VDR variants to re-capitulate classical vitamin D hormone-mediated signaling events and alter cell proliferation in vitro, we selected a high dose level (100 nM) of calcitriol for our comparisons, to better contextualize the potential impact of VDR-directed gene therapy using SSO technology.

2.1.6. Western blot analysis Total protein was extracted from TC7 clones (from 2 × 25 cm2 cell culture dishes at confluency) using the RIPA Buffer Lysis System (Santa Cruz Biotech; sc-24,948). Fresh RIPA buffer was prepared just prior to extraction and supplemented with protease inhibitors (Complete Mini; Roche; #11777500; 1 tablet/10 ml RIPA buffer). After removing cell culture media, cells were washed with 1× PBS (VWR), and removed from plates with a rubber policeman in 1 ml of cold 1× PBS. Cells were pelleted at 3000 rpm for 5 min. Pellets were re-suspended in 0.75 ml of fresh RIPA buffer and incubated on ice for 30 min with intermittent vortexing. Supernatant was then separated from cell debris via centrifugation at 14,000 × g for 15 min at 4 °C. Samples were then frozen at −80 °C, or prepared for Western Blot analysis immediately via suspension into 4× Laemmeli Sample Buffer (BioRad) supplemented with 400 mM β-mercaptoethanol (Sigma). Western blot analysis was completed using both the Protein Simple Wes™ System (Protein Simple) available in the Center for Genomic Research and Bioinformatics (CGRB) at Oregon State University, and the Bio-Rad Mini-PROTEAN II Electrophoresis Cell Protein System (Hercules, CA). Standard manufacturer settings were used with minor modifications, which involved alternate sample preparation procedures (samples were stored in fresh 1× Laemmeli Sample buffer at room temperature, overnight) to facilitate denaturation of hydrophobic target proteins. Monoclonal antibodies for human CYP24A1 (E-7; sc-365,700), GAPDH (G-9; sc365,062) and β-actin (C4; sc-47,778) were obtained from Santa Cruz Biotechnology (scbt.com) and used over a dilution range of 1:100 to 1:200. Monoclonal antibodies for human VDR (9A7; MA1–710) were obtained from ThermoFisher Scientific (Rockford, IL) and used at a dilution of 1–1.5 μg/ml. Blots generated using the Mini Protean II system were analyzed via chemiluminescence using the Pierce ECL Western Blotting Substrate kit (ThermoFisher Scientific; Rockford, IL) and the Azure c600 Imager (#AC6001; Azure Biosystems (Dublin, CA)). Total protein levels were quantified using ImageJ software analysis (Schneider et al., 2012).

2.1.4. RNA isolation and endpoint PCR Total RNA was isolated from TC7 clones using the QIAshredder (Qiagen; #79654) and RNEAsy Mini Kit (Qiagen; #74104). RNA was 57

Toxicology and Applied Pharmacology 364 (2019) 55–67

A.J. Annalora et al.

construct lacks exon 3 (residues R50-E92) and encodes a shortened 384 amino acid protein, while the Dex8-VDR construct lacks exon 8 (residues A303-P341) and encodes a 388 amino acid protein. A structural analysis of the VDR's DNA binding domain, shown in Supplemental Fig. 1A, reveals that exon 3 encodes a large portion of both the DNA recognition, α-helix 1 (C41-K53) and the phosphate binding, α-helix 2 (Q77-I87), and it's exclusion disrupts key N-terminal features, including the S-Box (R49 & K53), D-Box (C60-C66), Zinc Finger #2 (C60-R80) and T-Box (M90-L95) (Wan et al., 2015). This construct was designed to compromise the VDR's DNA binding ability, and to serve as a dominant negative control for our Dex8-VDR construct, which was designed to modulate the structure of the LBD. Structural analysis of the VDR's LBD, shown in Supplemental Fig. 1B, demonstrates that exclusion of exon 8 (A303 – P341) disrupts the organization of key structural elements, including the positioning of key helices H5, H7, H8 and the H6-H7 loop, while eliminating key ligand binding residues (A303, H305, L309, L313) from the distal pocket of the ligand binding site. This modification is predicted to destabilize both the genomic (VDR-GP) and alternative (VDR-AP) ligand binding pockets of the VDR by repositioning the A-ring binding domain formed among helices H3, H5, H6, and the H1H2 and β-sheet-H6 loops (Mizwicki et al., 2010; Menegaz et al., 2011). Our goal was to determine if this type of C-terminal modification would induce dominant negative phenotypes similar to the Dex3-VDR construct, or ligand-independent activity, through reconfiguration of the Cterminal AF-2 function. A schematic representation of the Dex3- and Dex8-VDR, and primary sequence alignments of the exon 3 and exon 8 regions of the human VDR gene are depicted in Supplemental Fig. 2.

2.2. Dual luciferase VDRE reporter assays Individual experiments were conducted in quadruplicate using manufacturer's recommendation for the Cignal Vitamin D Receptor (Luciferase) Kit (Qiagen; #336481). The Cignal VDR reporter construct utilizes a consensus, vitamin D receptor response element (VDRE) with the following tandem repeat sequence: gatccacaaGGTTCAcgaGGTTCAcgtccg. Approximately 15,000 cells (for TC7 clones) were seeded into each well of a 96-well white opaque flat bottom microtiter plate (VWR) 24 h prior to starting assay in standard media (DMEM (Lonza; #95042); 20% FBS (Corning; #35–016); 1× Pen-strep (ThermoFisher Scientific; #15140122); 1× NEAA (Corning; #25025CI)). Transfections were performed using either Attractene Transfection Reagent (Qiagen; #301005) or Lipofectamine 3000 (ThermoFisher; #L3000008) in Opti-Mem Reduced Serum Media (ThermoFisher; #31985070). 24 h after transfection, reduced serum media was exchanged for control media (DMEM, 20% FBS) or media supplemented with calcitriol (10–100 nM) or PMO (0.1–3 mM) for 2–7 days. 48 h post-transfection cells were washed with 1× PBS and lysed for use in the Dual Luciferase Reporter Assay System (Promega; #E1910). Assays were performed in the Synergy 2 Multi-Mode Plate Reader (Biotek) using manufacturer's recommendation for measurement. VDR activity was calculated by normalizing the relative Firefly (FL) Luciferase signal (RLU) with the relative renilla (RL) signal. Cell viability was assessed using the RL signal only. A similar protocol was used for transient transfection assays in DU-145 cells, where 20,000 cells were co-transfected with 100 ng of the 3 human VDR constructs (WT, DEX3 & DEX8; in pCMV6-AC vector) obtained from BlueHeron Biotech, LLC (Bothel, WA) and the CIGNAL VDR reporter construct (or negative CONTROL) found in the Cignal Vitamin D Receptor (Luc) Kit (Qiagen; #336481).

3.2. Transient transfections in DU-145 prostate cancer cells To explore the potential dominant negative or ligand-independent functions of Dex3- and Dex8-VDR constructs, we transiently transfected DU-145 human prostate cancer cells with human VDR expression constructs encoding either full-length (FL; or wild-type), Dex3- or Dex8VDR transcripts, in combination with a dual-luciferase, VDR reporter system (Cignal VDR; Qiagen), containing a consensus, vitamin D response element (VDRE)-firefly luciferase (FL) reporter and a renilla luciferase (RL) control reporter for monitoring transfection efficiency and cell viability (see methods). As shown in Fig. 2, DU-145 cells transfected with wild-type or Dex3-VDR constructs, in the absence of vitamin D hormone, did not significantly increase VDR reporter activity at 48 h post-transfection, as measured by the FL/RL signal. However, cells transiently transfected with the Dex8-VDR construct displayed a significant, over 2-fold, increase in ligand-independent, vitamin D reporter activity at 48 h (p < 0.05).

2.3. Statistical analysis Statistical evaluation of dual luciferase assays was made using a one-way ANOVA, paired with Tukey's multiple comparison test using GraphPad Prism (GraphPad Software; La Jolla, CA). Statistical significance was considered at p values < 0.05. Standard error (SEM) in qPCR experiments was measured using the equation: SEM = (Standard Deviation (delta CT))/(√N)). GraphPad Prism was used for statistical evaluation of qPCR data, and statistical comparisons were made using a one-way ANOVA, paired with Tukey's multiple comparison test using individual delta CT replicates. Statistical significance was considered at p values < 0.05. 3. Results

3.3. DE3 and DE8 TC7 clonal cell line validation

3.1. VDR variant construct development

Based on these observations, Dex3- and Dex8-VDR expression constructs were stably-integrated into a vitamin D hormone-responsive, Caco-2 colon cancer cell line (TC7 clone) and positively-transformed clones were selected for using Geneticin (400 μg/ml; see methods). Two colonies of transformed, TC7 cells expressing Dex3-VDR variant (DE3–1

To determine the biological impact of alternative exon inclusion on the human VDR gene, two DNA expression constructs lacking discrete coding regions in the DBD (Delta Exon 3; Dex3-VDR) and LBD (Delta Exon 8; Dex8-VDR) were developed. As shown in Fig. 1, the Dex3-VDR

Fig. 1. Structural Composition of Dex3- and Dex8VDR Splice Variants. A.) We developed two novel expression constructs for the VDR lacking either exon 3 (Dex3-VDR or Δexon3-VDR), which encodes portions of the DNA binding domain (DBD), or exon 8 (Dex8-VDR or Δexon8-VDR), which encodes a portion of the ligand-binding domain (LBD). While many nuclear receptors possess natural splice variants that remove large segments of the C-terminal domain, less is known about receptor variants that utilize cassette exons within the DNA- or ligandbinding domains. The VDR is organized to allow clean skipping of exon 8, which may represent a structural adaptation for modulating the receptor's liganddependent functionalities during stress, famine or disease. 58

Toxicology and Applied Pharmacology 364 (2019) 55–67

A.J. Annalora et al.

were validated using the Dex3 primer set (see methods), and were identified in DE3 clones only (Fig. 3B); the DE3C1 clone was selected for further analyses. VDR transcript variants lacking exon 8, were verified using the Art 8 primer set (see methods), and were only found in the DE8 clones (Fig. 3C). The DE8C2 clone was selected for subsequent studies. Next, we used the VDR-dual luciferase reporter system (Cignal VDR; Qiagen) to explore differences in ligand-dependent and ligand-independent genomic signaling among the reference TC7 cells and the DE3C1 and DE8C2 clones (Fig. 3D). A small, but significant level of ligand-independent VDR reporter signaling was observed in both untreated DE3C1 and DE8C2 clones. Co-treatment of cells with a single, high dose of calcitriol (100 nM; 72 h) changed these trends, as the DE3C1 clone showed diminished, liganddependent VDR signaling compared to wild-type cells, while the DE8C2 clone showed a synergistic genomic signaling response, almost 2-fold greater than control TC7 cells alone. DE8C2 cells also displayed a reduced doubling time compared to wild-type and DE3C1 cells (32.2 h vs. 28.2 h and 24.2 h, respectively; Supplemental Fig. 4). Basal VDR protein expression was also monitored in wild-type TC7 cells and in the DE3C1, and DE8C2 clones via Western Blot Analysis (Fig. 4). Monomeric, wild-type VDR was detected at 47 kDa in all 3 cell lines, with a minor splice variant band (VDRSV1) visible at ~45 kDa, and aggregate bands at ~250 kDa. The DE3C1 clone was found to express only wild-type VDR and the VDRSV1 band, and the predicted, truncation product was not visible, or could not be detected using our monoclonal antibody (see methods). In contrast, the DE8C2 clone showed normal expression of both wild-type VDR and VDRSV1 proteins, but also contained protein bands at ~40 kDa and ~90 kDa, which we presume correspond to the Dex8-variant and an insoluble, heterodimer of wild-type and Dex-8 variant proteins. Total VDR protein levels calculated by densitometry showed a modest 20% induction of total VDR protein in the DE8C2 clone, and an approximate 20% reduction in total VDR protein in the DE3C1 clone.

Fig. 2. Dual Luciferase VDR Reporter Assay of Transiently-transfected Wildtype-, Dex3- and Dex8-VDR Constructs in DU-145 Prostate Cancer Cells. DU145 cells were transiently co-transfected with expression constructs for wildtype- (WT; or full-length), Dex3- and Dex8-VDR, and a VDRE-dual luciferase reporter construct (Cignal VDR reporter assay; Qiagen). Transfection efficiency was monitored using the renilla firefly (RL) signal and VDR-mediated gene transactivation was monitored using the firefly luciferase signal (FL) normalized to RL. Transient transfection of full-length human VDR (hVDR-FL) and Dex3-VDR expression constructs failed to increase genomic VDR signaling significantly in DU-145 cells. In contrast, transient transfection of the Dex8VDR construct significantly increased vitamin D reporter activity over 2-fold. (* = p < 0.05).

3.4. qRT-PCR analysis of VDR and target gene mRNA expression in DE3 and DE8 Caco-2 clones

and DE3–2) and three individual colonies expressing the Dex8-VDR variant (DE3–1-3) were isolated for validation. Endpoint-PCR analysis revealed the presence of wild-type VDR transcripts in control TC7 cells, and all of the DE3 and DE8 clones (Fig. 3A). VDR variants lacking exon 3

Next, we explored the influence of Dex3- and Dex8-VDR variants on ligand-dependent and ligand-independent target gene expression (for Fig. 3. Validation of Caco-2 Clonal Cell Lines Expressing Dex3- and Dex8-VDR Constructs and Measurement of Ligand-Independent VDR Reporter Activity. (A) Endpoint PCR using the Dex8 primer set revealed the presence of wild-type VDR in all cell lines studied, including, wild type Caco-2 (TC7) control cells, two DE3 clones (C1 and C2) and three DE8 clones (C1–C3). (B) Endpoint PCR using the Dex3 primer set revealed exon 3 exclusion in DE3 clones only. (C) Endpoint PCR using the Art8 primer set revealed exon 8 exclusion in the DE8 clones only. (D) VDR-mediated gene transactivation was monitored using the Cignal VDR reporter system (Qiagen). Both DE3C1 and DE8C2 clones displayed enhance ligand-independent activity compared to wild-type TC7 cells under normal conditions. When media was supplemented with the vitamin D hormone (i.e. calcitriol [100 nM]; 72 h), genomic signaling in the DE3C1 clone was slightly suppressed compared to wild-type TC7 cells. In contrast, the DE8C2 clone showed nearly 2-fold enhancement in VDR signaling compared to control cells at 48 h, which was similar to the gain-of-function observed in DU-145 cells transfected with the Dex8-VDR variant.

59

Toxicology and Applied Pharmacology 364 (2019) 55–67

A.J. Annalora et al.

the DE3C1 (4-fold) and DE8C2 (6-fold) clones compared to wild-type (Fig. 5D). CYP 3A4 and 3A5 target gene expression was also monitored using the same qPCR protocol. Basal CYP3A4 expression was diminished 4-fold in both untreated DE3C1 and DE8C2 clones compared to control TC7 cells (Fig. 6A), and vitamin D hormone-inducible CYP3A4 expression was also suppressed 30- and 40-fold, respectively in the DE3C1 and DE8C2 clones at 72 h (Figs. 6B). In contrast, CYP3A5 transcript levels were elevated in untreated DE3C1 (3-fold) cells, but not the untreated DE8C2 clone (Fig. 6C). CYP3A5 expression in wildtype TC7 cells was relatively unresponsive to calcitriol (100 nM; 72 h) compared to CYP3A4 expression, and both DE3C1 (4-fold) and DE8C2 (8-fold) clones expressed even lower CYP3A5 mRNA levels than control TC7 cells, after vitamin D hormone supplementation (Fig. 6D). 3.5. Delta exon 8 VDR antisense oligonucleotide screen Based on observations that Dex8-VDR variants could alter both ligand-dependent and ligand-independent signaling cascades in DU-145 and Caco-2 (TC7) cancer cells, we designed a panel of 23-mer spliceswitching oligonucleotides targeting the skipping of VDR exon 8 (Dex8VDR oligomers), to explore their ability to alter VDR signaling events, on-demand, in vitro. In Fig. 7A, comparative qPCR results for wild-type TC7 cells scrape-loaded with either a scrambled control (SC) oligomer, or a Dex8-VDR PMO oligomer (at 0.3 μM, 100 nM calcitriol; 72 h; see Table 1) are shown. Expression levels for each target transcript were normalized to 18S mRNA levels and presented as the mean +/− SEM of 4 biological replicates. Two of the Dex8-VDR PMOs tested significantly reduced wild-type VDR levels (SA: −18; SD: +115) at 72 h. Four PMOs targeting the slice-acceptor site between intron 7 and exon 8 (SA: −18, −5, +4, +12) also significantly altered CYP24A1 transcript expression compared to the scrambled oligomer control (SC). The Dex8VDR oligomer SA (+12) showed the highest activity in TC7 cells, increasing CYP24A1 expression 3-fold. A fifth oligomer targeting the splice donor site (SD +115) failed to induce CYP24A1 transcript levels significantly. None of the Dex8-VDR PMOs had a significant effect on CYP3A4 expression after 3 days exposure. Based on this initial screen, the SA +12 oligomer was subjected to an additional dose-response experiments (0.3–1 μM; 100 nM calcitriol; 72 h). As shown in Supplemental Fig. 5, the SA +12 Dex8-VDR oligomer induced the maximum levels of VDR, CYP24A1, and CYP3A4 expression at the lowest PMO dose (0.3 uM), although the level of CYP24A1 induction was relatively consistent at all doses tested. To further evaluate the ability of Dex8-VDR PMOs to sustain altered genomic VDR signaling in vitro, we screened all 5 Dex8-VDR PMOs (SA: −18, −5, +4, +12; and SD: +115) in a 7 day, TC7 cell assay using the Dual Luciferase VDR Reporter system (Cignal VDR; Qiagen) as described previously (Fig. 7B). TC7 cells were scrape-loaded with 1 μM of each Dex8-VDR oligomer or a scrambled control, and allowed to incubate for 7 days in the presence of 100 nM calcitriol; fresh media was supplied at day 4. At 1 week, a significant, 160-fold enhancement of VDR activity was noted in TC7 cells treated with the Dex8-VDR (SA +12) oligomer (0.49 vs. 0.003 RLU). The (SA −5) and (SA +4) oligomers also showed a ~6-fold induction of VDR signaling, but these results were not statistically significant (p > 0.05). While cell viability was not measured directly in this assay, a significant reduction in renilla luciferase (RL) signal was observed at day 7 in TC7 cells treated with SA −18, −5, +4, +12 PMOs for 7 days, but not cells treated with the scrambled control or SD +115 PMO (Supplemental Fig. 6). Finally, a Protein Simple Wes™ western blot analysis was used to validate the ability of the Dex8-VDR SA +12 oligomer to induce CYP24A1 target protein expression, in addition to mRNA transcripts, in vitro. As shown in Fig. 8, CYP24A1 protein was not detectable in untreated wild-type TC7 cells treated with a scrambled control (SCR) morpholino (1 μM; 72 h), however a strong induction of protein was observed when TC7 cells were treated with calcitriol (100 nM; 72 h), with a primary band at 57 kilodaltons (Fig. 8, lanes 1 and 2). Wild-type

Fig. 4. Western Blot analysis of VDR expression in Wild-type TC7, DE3C1 and DE8C2 clones. Total protein extracts were used to validate the expression of the VDR across each of the Caco-2 cell clones used in this study. Wild-type VDR was evident in control TC7 cells at 47 kDa, and a secondary band that may represent a tissue-specific splice variant (VDRSV1) was also visible at ~45 kDa, along with an aggregate band at ~250 kDa that was insensitive to denaturation methods. VDR expression was similar in the DE3C1 clone, with wild-type VDR, VDRSV1 and high molecular weight aggregate bands visible; no protein bands specific for the shortened Dex3 variant were detected in our DE3C1 clone. The DE8C2 clone showed normal expression of all 3 wild-type VDR proteins, however a shortened variant protein band was also noted at 40 kDa, along with an additional band at ~90 kDa, which we presume represents an irreversible, dimer formed between the wild-type- and Dex8-VDR. Total VDR signal was normalized using β-actin (ACTB) levels as a loading control, and the bar graph highlights the normalized, total protein level observed for all molecular weight bands, as scored by densitometric ImageJ analysis (Schneider et al., 2012).

the VDR and CYPs 3A4, 3A5 and 24A1) in TC7 cells using qPCR. Total RNA extracts were obtained from untreated, wild-type, DE3C1 and DE8C2 cells, and cells exposed to calcitriol (100 nM; 72 h). As shown in Fig. 5A, significant differences in VDR gene expression, relative to an 18S RNA internal control, were noted for both DE3C1 and DE8C2 clones. In normal media, both DE3C1 (30-fold) and DE8C2 (190-fold) clones were found to express higher levels of VDR transcript than wildtype, TC7 cells. Interestingly, after 3 days of calcitriol exposure (100 nM) wild-type, VDR transcript levels did not change significantly (1.3 to 1, respectively) in wild type TC7 cells. In contrast, the elevated VDR levels seen in untreated DE3C1 and DE8C2 clones were suppressed (2-fold and 30-fold, respectively) in the presence of calcitriol (100 nM; 72 h), but remained elevated (13-fold and 6-fold, respectively) overall compared to wild-type control levels (Fig. 5B). Next, we probed the impact of Dex3- and Dex8-VDR expression on CYP target gene expression, both in the presence and absence of calcitriol. Notable enhancement of CYP24A1 mRNA expression was noted for both untreated DE3C1 (4000-fold) and DE8C2 (40-fold) cell line compared to wild-type (Fig. 5C). After 72 h of exposure to calcitriol (100 nM), the CYP24A1 gene was found highly-overexpressed in all 3 cell lines, with significant reductions in transcript induction observed in 60

Toxicology and Applied Pharmacology 364 (2019) 55–67

A.J. Annalora et al.

Fig. 5. Comparative qPCR Analysis of VDR and CYP24A1 Levels in TC7 Clones. (A) VDR expression in wild-type TC7 cells is relatively low, and stable integration of Dex3- and Dex8-variant VDR constructs increased detectable VDR transcript levels ~ 30-fold and 190-fold, respectively. (B) In the presence of vitamin D hormone (calcitriol; 100 nM; 72 h), Dex3 clones expressed VDR at levels ~ 13-fold higher than wild-type cells, while DE8 clones showed only a 6-fold increase. (C) CYP24A1 expression levels were also dramatically altered in the DE3C1 clone, as transcript levels 4000-fold higher than wild-type TC7 cells were observed. DE8C2 clones also displayed elevated basal levels of CYP24A1 compared to wildtype, but to a lesser extent (~ 40-fold). (D) In the presence of calcitriol (100 nM; 72 h), wild-type cells displayed a potent, 1.5 × 106-fold induction of CYP24A1 transcript. Interestingly, both the DE3C1 and DE8C2 clones were significantly less responsive to the vitamin D hormone (3–6 fold) than wild-type TC7 cells, displaying 4.4 × 105-fold and 2.6 × 105fold levels of comparative induction, respectively.

Fig. 6. Comparative qPCR Analysis of CYP3A4 and CYP3A5 Levels in TC7 Clones. (A) Stable transfection of Dex3- and Dex8-VDR variants into TC7 cells resulted in suppressed basal expression of CYP3A4 compared to wild-type cells. (B) Neither the DE3C1 nor the DE8C2 clones were as responsive to vitamin D hormone treatment (calcitriol [100 nM]; 72 h) as wild-type cells, showing a significant, 20–30-fold reduction in CYP3A4 inducibility compared to wildtype cells. These results imply that the VDR plays an important role in regulating both basal and inducible levels of CYP3A4, and that proper organization of the LBD and DBD are required. (C) Stable transfection of the Dex3-VDR construct into TC7 cells increased the basal level of CYP3A5 expression roughly 2.5-fold, whereas introduction of the Dex8-VDR construct led to a modest (40%) suppression of basal CYP3A5 induction compared to wild-type. (D) CYP3A5 gene expression was found to be largely unresponsive to vitamin D hormone signaling in TC7 cells (calcitriol; 100 nM; 72 h; 1.05-fold increase; not shown), however, calcitriol was more effective at suppressing CYP3A5 induction in both the DE3C1 clone (4-fold) and the DE8C2 clone (8-fold) compared to wild-type cells. These results imply that homo- and heterodimeric interactions among VDR splice variants, wild-type VDR and/or other transcription factors (i.e. RXR), are heavily influenced by DNA- and ligand-binding events, and that alternative splicing of a single transcription factor can reprogram both core repressor and transcriptional activation complexes in highly unpredictable ways.

TC7 cells treated with the Dex8-VDR PMO (SA +12; 1 μM; 72 h) only displayed a modest induction of CYP24A1 band at 57 kDa (Fig. 8, lane 3), which exceeded CYP24A1 levels observed in TC7 cells treated with a scrambled control PMO only (Fig. 8, lane 1) and untreated DE8C2 clone

cells (Fig. 8, lane 5) stably expressing the Dex8-VDR variant construct, alone. Based on a densitometric analysis of the blot, we conclude that ligand-independent induction of CYP24A1 using the SA +12 PMO produced roughly 6% (1/16th) of the total CYP24A1 protein induced by 61

Toxicology and Applied Pharmacology 364 (2019) 55–67

A.J. Annalora et al.

Fig. 8. Western Blot Analysis of CYP24A1 Expression in Wild-type and DEC2 Cells Treated with the Lead Delta Exon 8 VDR Oligomer. The ability of the lead Dex8-VDR PMO (SA +12) to alter CYP24A1 protein expression in wild-type TC7 cells was monitored with the Protein Simple Wes™ Western Blot System (see methods). Total CYP24A1 expression was analyzed using ImageJ (Schneider et al., 2012) and normalized across samples using GAPDH as a loading control (bottom panel). CYP24A1 induction was potentiated in wildtype TC7 cells by the addition of 100 nM calcitriol (lane 2), but not a scrambled control PMO oligomer alone (lane 1; 1 μM; 72 h). Most notably, the SA + 12 oligomer induced 6% of the total CYP24A1 (at 54 kDa) produced by calcitrioltreated wild-type cells (lane 2), in the absence of the endogenous hormone (lane 3), and this response was enhanced to normal levels in the presence of 100 nM calcitriol (lane 2 vs. lane 4). CYP24A1 expression induced by the SA + 12 PMO was also compared to basal and inducible CYP24A1 levels in the DE8C2 clone (lanes 5 and 6). CYP24A1 expression was largely undetectable in the DE8C2 clone, but remained partially-inducible in the presence of the vitamin D hormone (100 nM; 72 h).

Fig. 7. Delta Exon 8 VDR Oligomer Screen in Wild-Type TC7 Cells – qPCR analysis and VDR Reporter Activity – (A) A panel of PMOs targeting the skipping of exon 8 in the VDR were screened in wild-type TC7 cells for their ability to alter the expression of the VDR and VDR-target genes CYP24A1 and CYP3A4, in vitro. Oligomers are named based on the proximity to their target sequence to the splice junction between intron 7 and exon 8, at either splice acceptor (SA) or splice donor (SD) sites. Results from qPCR analysis are shown for wild-type TC7 cells scrape-loaded with either a scrambled control (SC) or a VDR-targeted PMO oligomer (0.3 μM, 72 h, in the presence of 100 nM calcitriol). Expression levels for gene transcripts were normalized to 18S RNA levels and presented as the mean +/− SEM of 4 biological replicates; * denotes p < 0.005. Only one oligomer (SA +18) significantly altered VDR transcript levels across replicate experiments. Four PMOs (SA −18, SA −5, SA +4, and SA +12) showed a significant ability to induce CYP24A1 expression above wild-type control levels. No PMO significantly altered the inducibility of CYP3A4 above control levels. (B) Wild-type TC7 cells treated with either scrambled control (SC) or VDRtargeted oligomers (SA (−18, −5, +4 & +12) and SD (+115) (0.3 μM; 7 days; in the presence of 100 nM calcitriol) were transiently-transfected with the DualLuciferase VDR reporter system (Cignal VDR; Qiagen) as described above. Enhanced VDR-mediated gene activation was noted for four Dex8-VDR oligomers, including (SA −5, SA +4, SA +12, and SD +115). However, only the SA +12 oligomer induced a significant increase in VDR reporter activity across 4 biological replicates. Results represent the mean +/− standard deviation for 4 biological replicates. * denotes p < 0.05.

members of the nuclear receptor (NR) superfamily (Gallego-Paez et al., 2017; Dehm et al., 2008; Chen and Weiss, 2015; Annalora et al., 2017). Here we demonstrate for the first time that alternative splicing of the class II VDR can also generate ligand-independent isoforms of the receptor capable of modulating target gene expression. We also determined that RNAse-H inactive, splice-switching, oligonucleotides (e.g. morpholinos or PMOs) can be used to manipulate splicing, in vitro, thus creating new opportunities for SSO therapeutics targeting the vitamin D endocrine system. While extensive efforts have been made to develop non-calcemic vitamin D analogs with improved efficacy and safety profiles (Guyton et al., 2003; Deeb et al., 2007; Choi and Makishima, 2009; Maestro et al., 2016), and selective inhibitors of CYP24A1 that can expand their therapeutic window (Annalora et al., 2004; Annalora et al., 2010; Posner et al., 2010; Rhieu et al., 2011; Chiellini et al., 2012; Kósa et al., 2013; Luo et al., 2013), no progress towards an FDA-approved treatment for cancer has emerged (Luo et al., 2016). We modulated VDR function directly, in the absence of hormone supplementation, highlighting the potential application of SSO therapeutics in this class. However, it is important to note that each NR family gene contains unique structural features and different numbers of introns and exons that dictate their sensitivity to exon-skipping events. These differences likely create a continuum of NR gene sensitivity to both SSO drugs and various environmental inputs and stressors

calcitriol alone, over 3 days (Fig. 8, lane 3 vs. lane 2), but substantially more CYP24A1 protein than untreated DE8C2 clones (Fig. 8, lane 3 vs. lane 6). When the SA +12 oligomer was co-administered with 100 nM calcitriol in wild-type TC7 cells, no significant enhancement of CYP24A1 inducibility was observed compared to cells treated with a scramble control only (Fig. 8, lane 4 vs. lane 2), however, this level exceeded the ligand-dependent responsiveness observed in the DE8C2 clone (Fig. 8, lane 4 vs. lane 6) by over 4-fold. 4. Discussion Alternative splicing is associated with diseases like cancer (Cooper et al., 2009; Tang et al., 2013; Wong et al., 2018; Song et al., 2018) and can expand the functional repertoire of genes, including class I 62

Toxicology and Applied Pharmacology 364 (2019) 55–67

A.J. Annalora et al.

that can disrupt common cellular mechanisms regulating both gene expression and gene splicing events. The intronic organization of the VDR exon 8 allows it to be skipped in-frame, a cassette exon, making it a favorable target for SSO technology. If the Dex8-VDR variant can occur in normal and/or diseased tissues, we wanted to establish whether it would function as a constitutively-active variant similar to the AR3 splice variant in prostate cancer. The dominant-negative Dex3-VDR variant we developed does not represent a naturally occurring VDR splice variant, but its modified function will overlap with VDR variant forms expressed with a truncated N-terminus, particularly those that utilize alternative translation start sites beyond exon 3, or variants skipping exons 3–6, which could also remain in frame, according to the RefSeq analysis of the human VDR gene (NG_008731.1) (O'Leary et al., 2016). By contrasting the effect of Dex3- and Dex8-VDR variants on the constitutive expression of the VDR and VDRE-containing target CYP genes (e.g. 3A4, 3A5 and 24A1) we uncovered fundamental differences between how these variants modulate ligand-independent repressor and gene activation functions of the VDR. As shown in Fig. 9, we have developed a schematic diagram to highlight the utility of the Dex3- and Dex8-VDR variants for exploring novel aspects of ligand-independent VDR structure/function, and the possible mechanisms underlying this cryptic NR signaling paradigm. The functional relevance of Dex3-and Dex8-VDR variants were first explored in DU-145 cells, which are relatively unresponsive to vitamin D hormone treatments, due to the overexpression of CYP24A1 (Skowronski et al., 1993; Ly et al., 1999). We did not attempt to knockdown the wild-type VDR in the background of these cells because related studies in the androgen receptor have suggested that pseudohomodimeric interactions with a wild-type variant of the nuclear receptor may be required to transduce the ligand-independent signaling of the splice variant (Cao et al., 2014; Xu et al., 2015). In our experiments, devoid of vitamin D hormone supplementation, we observed a modest, but highly-reproducible increase in VDR reporter activity in DU-145 cells transfected with the Dex8-VDR variant, but not wild-type VDR or the Dex3-VDR variant (Fig. 2). Based on these observations, we stably-integrated both the Dex3- and Dex8-VDR constructs into a Caco2 colon cancer cell line (TC7 clone) that expresses wild-type VDR, and has a well-defined gene expression profile for VDR-responsive target genes, CYP24A1, CYP3A4 and CYP3A5 (Carriere et al., 1994). In TC7 cells we detected a modest increase in VDR reporter activity for both DE3C1 and DE8C2 clones, in the absence of vitamin D hormone,

compared to control cells (Fig. 3D). However, when clones were treated with a high dose of calcitriol (100 nM; 72 h), the dominant negative function of the Dex3-VDR construct became evident, as DE3C1 cells showed a significantly reduced ability to transduce ligand-dependent VDR signaling, whereas the DE8C2 clone showed a significant, two-fold enhancement in VDR signaling compared to wild-type (Fig. 3D). This observation highlights the potential for the Dex8-VDR variant to guide ligand-independent aspects of genomic signaling without disrupting ligand-dependent signaling, occurring through the wild-type receptor. Both DE3C1 and DE8C2 clones expressed reference VDR protein (~47 kDa) similar to wild-type TC7 cells, and a truncated Dex8-VDR variant protein (~40 kDa) was observed in the DE8C2 clone only (Fig. 4). Both clones also displayed abnormal autoregulation of the VDR mRNA transcript, with the DE8C2 clone expressing nearly 200-fold higher levels of VDR mRNA than untreated control cells (Fig. 5A). When cells were treated with the vitamin D hormone, autoregulation of the VDR was enhanced over 10-fold in the DE3C1 clones and over 4fold in the DE8C2 clone, indicating the vitamin D hormone plays an important role in mediating both the VDR-mediated repression and activation of the VDR gene (Fig. 5B). Transcriptional changes in CYP24A1 expression were also revealing, as the DE3C1 clone displayed a diminished ability to suppress basal CYP24A1 mRNA expression, as indicated by a nearly 4000-fold increase in CYP24A1 transcript levels compared to untreated, wild-type TC7 cells (Fig. 5C). DE8C2 clones also showed loss of basal CYP24A1 regulation; however, they expressed only 40-fold more mRNA than wild-type TC7 cells (Fig. 5C). In the presence of calcitriol, CYP24A1 inducibility was reduced 3.5-fold in DE3C1 clones and 6-fold in DE8C2 clones, but the gene remained highly-inducible in all 3 cell lines, compared to untreated wild-type cells, which remained the most responsive to ligand-dependent activation (Fig. 5D). Variations in CYP24A1 transcriptional regulation observed by qPCR analysis of the DE8C2 clone were later recapitulated with respect to protein expression using wild-type TC7 cells treated with the Dex8-VDR (SA +12) oligomer (1 μM; 72 h), however CYP24A1 protein was not detectable in untreated DE8C2 clones, despite a 40-fold induction of mRNA (Fig. 8). The toxic overexpression of VDR-target genes like CYP24A1, therefore, could arise from alternative splicing events that alter the ligand-independent functions of the VDR, adding aberrant splicing to the list of possible mechanisms driving chronic vitamin D deficiency in humans, which include CYP24A1 gene duplication events, epigenetic modifications and endocrine disruption (Höbaus et al., 2013a; Höbaus et al., 2013b; Luo et al., 2013; Luo et al., 2016).

Fig. 9. Schematic Overview of Alternative Gene Functions Associated with the Expression of Dex3and Dex8-VDR Splice Variants – The classical functions of the vitamin D receptor involve both genomic and non-genomic activity that is modulated through interactions with the vitamin D hormone (calcitriol; or 1,25D3). By inducing VDR variants lacking portions of the DBD (exon 3) or LBD (exon 8) we can explore several poorly understood aspects of VDR structure/function, including: (1) The role of the intact LBD in coordinating the apo-VDR's ligand-independent functions; (2) The role of the intact DBD in mediating the apo-VDR's role in targeted gene repression at vitamin D-responsive promoter elements (VDREs) of target genes (e.g. CYP3A4 and CYP24A1); (3) The structural plasticity of the LBD, as both Dex3- and Dex8-VDR variants can reconfigure the protein's tertiary structure to promote alternative interactions with ligands involved in both gene expression and splicing events; and (4) The structural determinants of genomic VDR signaling, which may require coordinated interactions with dimerization partners (e.g. the retinoid X receptor (RXR)) that are sensitive to structural changes in the DBD or LBD. In this regard, Dex3- and Dex8-VDR variants allow us to uncouple DNA recognition from ligand binding events, and vice versa, providing new insights into the determinants of non-genomic VDR signaling as well, and the discrete roles that co-regulators and dimerization partners may play in transducing both liganddependent and ligand-independent NR functions. 63

Toxicology and Applied Pharmacology 364 (2019) 55–67

A.J. Annalora et al.

Unlike the CYP24A1 promoter, which remained responsive to both VDR splice variant phenotypes, the CYP3A4 promoter appeared to be suppressed ~4-fold in both the DE3C1 and DE8C2 clones (Fig. 6A). Suppression persisted even after calcitriol treatment (100 nM; 72 h), as DE3C1 and DE8C2 clones showed a large, 20–30-fold reduction in their ability to induce CYP3A4 (Fig. 6B). These results imply that while the CYP3A4 gene remains responsive to VDR signaling, its basal expression is not repressed by the same apo-VDR complex regulating the VDR or CYP24A1, as novel promoter interactions dictated by the presence of Dex3- or Dex8-VDR variants had qualitatively different effects on gene expression profiles. In this case, the Dex3 and Dex8 variants appeared to strengthen the suppressive nature of CYP3A4's transcriptional activation complex independent of vitamin D hormone status. qPCR results comparing CYP3A4 and CYP3A5 levels confirmed that CYP3A5 is expressed at a constitutive level nearly 40-fold higher than CYP3A4 in untreated Caco-2 (TC7) cells, and that CYP3A5 transcription is not as responsive to vitamin D hormone treatments as compared to CYP3A4 (100 nM; 72 h; data not shown). This result corroborates well with the reported vitamin D hormone responsiveness of the TC7 cells (Carriere et al., 1994), and we utilized the cell line's established vitamin D-responsive CYP3A4/CYP3A5 toggle mechanism to help clarify the impact of Dex3- and Dex8-VDR variants on cancer cell signaling. Interestingly, the DE3C1 clone expressed 2.5-fold higher levels of CYP3A5 under basal conditions (Fig. 6C), but nearly 5-fold lower levels of CYP3A5 (compared to wild-type) in the presence of the vitamin D hormone (Fig. 6D). These results imply that the apo-VDR can modulate the basal CYP3A5 transcriptional complex directly, and the effects may be finetuned based on the level of interaction between the DBD and the CYP3A5 promoter. When the DBD was disrupted, the repressive effect on the CYP3A5 promoter was reduced, but not lost. Because of this, we cannot rule out the possibility that reconfiguration of the DBD may alter protein:protein interactions with other homo- or hetero-dimerization partners, and promote an indirect effect. The ligand-bound VDR is expected to enhance the suppression of the CYP3A5 gene and promote CYP3A4 induction, however the CYP3A5 repressor-complex does not seem to require any direct interactions between the VDR DBD and the CYP3A5 promoter to function. Conversely, the DE8C2 clone showed a modest, but significant reduction in CYP3A5 expression in the absence of hormone, and an even stronger 10-fold suppression of the transcript in the presence of hormone (Fig. 6D). These results confirm the VDR's ligand-dependent role in strengthening the CYP3A5 repressor complex, and imply that the bound configuration of the LBD can have a powerful impact on the assembly and function of both transcription initiation and repressor complexes. We also found that antisense oligonucleotides that target the skipping of VDR exon 8 at the splice-acceptor site (SA +12), consistently induced CYP24A1 transcripts and protein in the absence of exogenous vitamin D hormone, mimicking the target-gene-responsiveness observed in the DE8C2 clone (Figs. 7 and Fig. 8). Dose-response experiments revealed this response was saturated at our lowest oligomer dose (0.3 μM; Supplemental Fig. 5), but endpoint PCR analysis shown in Supplemental Fig. 3, demonstrated that only a fraction (~65%) of wildtype VDR pre-mRNA transcript was converted to the Dex8 variant, at the highest calcitriol dose tested (1 μM; 48 h). Despite this limitation, all Dex8-VDR PMOs developed to target the splice acceptor site of exon 8, significantly induced VDR reporter activity at 7 days (Fig. 7B), while suppressing TC7 viability at levels up to 50-fold higher than calcitriol alone (100 nM) (Supplemental Fig. 6). Our viability estimates are based on the renilla luciferase (RL) level, a transfection control for the VDR reporter assay, limiting the conclusions for Dex8-VDR on TC7 cell viability or cancer cell growth. However, DE8C2 cells display reduced doubling times compared to wild- type and DE3C1 cells when grown in normal media (Supplemental Fig. 4), providing support for the interpretation that the Dex8-VDR variants may transduce anti-proliferative cues in both a normal and vitamin D-hormone depleted microenvironment. We are currently developing follow up studies to address

these outstanding questions related to cell viability, and to explore other cytotoxic or pro-apoptotic mechanisms that may be induced via the expression of Dex8-VDR variants. There are currently no literature reports of VDR variants precisely skipping exon 3 or exon 8. The NIH's Aceview database lists 7 splice variants for the VDR, ranging from 106 to 427 amino acids in length, and 2 cassette exons (Thierry-Mieg and Thierry-Mieg, 2006). These variants contain alternate start sites, exon 2 exclusion, and premature termination after exons 3 and 5 which may mimic loss of exon 3. No discrete Dex8 variants are described, although alternative exon 8 usage is noted for 47 unique accession numbers. Current RNAseq and proteomic methodologies are limited in their ability to accurately quantify and identify transcript variants (Liu et al., 2014; Rhoads and Au, 2015; Sood et al., 2016; Kaisers et al., 2017; Wang et al., 2018b; Park et al., 2018; Wan and Larson, 2018) so physiologically-relevant VDR splice variants, including Dex8 forms, may not have been identified, yet, particularly if they covertly promote a healthy phenotype during vitamin D insufficiency. Improved bioinformatic methodologies are needed to strengthen our understanding of the global VDR transcriptome (Campbell, 2014; Long et al., 2015), and to clarify the linkages between alternative splicing in the vitamin D endocrine system, and genetic polymorphisms, environmental stress and disease onset and progression (Zhou et al., 2015). Recent work by Trivedi et al. highlights the potential for cytosol-bound variants of the VDR to transduce progrowth signaling cascades in MCF-7 breast cancer cells, in the absence of the vitamin D hormone (Trivedi et al., 2017). The artificial VDR variant used in the study retained the DBD and LBD, but was mutated at the N-terminus to prevent nuclear translocation. These results highlight the potential for protein variants to discretely alter gene function, in this case by altering cellular trafficking events to promote a disease phenotype. We are currently studying how the loss of exon 3 or exon 8 alters the subcellular targeting of the VDR and interactions with its primary dimerization partner, RXR. More cryptic, biological effects stemming from the release of non-coding, circular RNAs containing exon 8 of the VDR, which may alter both RNA splicing and protein translation rates of target genes, are also under investigation (Qu et al., 2015). The primary goal of this project was to address whether alternative exon inclusion could alter the ligand-independent activity of a class II NR like the VDR. However, splicing defects that might also alter the structure of the DNA-binding domain were also studied, and they confirmed the VDR's important role in target gene repression, as Dex3VDR variants de-repressed the CYP24A1 promoter, which is normally occupied by an apo-VDR complex (Lee and Pike, 2015). Variants lacking exon 2, and N-terminal variants induced by VDR polymorphisms (i.e. FokI) could reconfigure the VDR's N-terminus (including the AF-1 function and DBD) in ways that mimic our dominant negative Dex3-VDR variant. The dominant negative effect of N-terminal variants may be promoter specific, and difficult to predict, as evidenced by the truncated (VDR Δ1–111) receptor variant that retains trans-repressive gene function, even in the absence of a functional N-terminus (JiménezLara and Aranda, 1999). The mechanisms underlying global VDR expression, and its tissue-specific autoregulation also remain unclear (Lee et al., 2015). Dex3-VDR variants appeared to de-repress the VDR promoter, but not to the same level as the Dex8-VDR variant. The 140-fold elevation in wild-type VDR transcript levels observed in our DE8C2 clone, which was largely muted in the presence of calcitriol, implies a discrete role for the apo-VDR in repressing the VDR promoter, one that requires a highly-organized presentation of both the DBD and LBD, to limit auto-induction of VDR gene transcription. Finally, reports that dexamethasone, a known disruptor of alternative splicing (Park et al., 2009; Zaharieva et al., 2012), significantly reduces vitamin D hormonemediated hypercalcemia, while enhancing antitumor activity, VDR-ligand binding and protein expression (Luo et al., 2016), provides additional support to the concept that the entire vitamin D endocrine system is highly-synchronized by, and responsive to, alternative64

Toxicology and Applied Pharmacology 364 (2019) 55–67

A.J. Annalora et al.

splicing events (Zhou et al., 2015). Overall, this study confirmed our hypothesis that some class II nuclear receptors are properly organized for post-transcriptional regulation by alternative splicing. Furthermore, variations in NR splicing patterns can potentially be diagnostic of genetic defects, chemical exposures, stress or disease, and they may be manipulated for therapeutic purposes. VDR polymorphisms, chemical exposures and epigenetic factors that alter the splicing efficiency of the VDR's DBD, in particular, may promote cancer and tumor progression via non-traditional mechanisms capable of de-regulating both basal and inducible levels of the VDR and CYP24A1. Conversely, mutations or splice disruption events that alter the organization of the LBD may confer a novel array of ligand-independent functions to the VDR, via ablation of inhibitory motifs that naturally suppress activation of C-terminal AF-2 function. Future studies in this area will work to de-convolute the genomic and non-genomic mechanisms by which VDR splice variants enhance vitamin D-hormone signaling and promote antiproliferative effects in vitro, and to identify variations in the protein-protein interactions mediated by Dex8-VDR variants and various coactivators that contribute to both the transcriptional and splicing machinery of the cell (Fig. 9).

Bikle, D.D., Oda, Y., Tu, C.L., Jiang, Y., 2015. Novel mechanisms for the vitamin D receptor (VDR) in the skin and in skin cancer. J. Steroid Biochem. Mol. Biol. 148, 47–51. Campbell, M.J., 2014. Vitamin D and the RNA transcriptome: more than mRNA regulation. Front. Physiol. 5, 181 (Review). Cao, B., Qi, Y., Zhang, G., Xu, D., Zhan, Y., Alvarez, X., Guo, Z., Fu, X., Plymate, S.R., Sartor, O., Zhang, H., Dong, Y., 2014. Androgen receptor splice variants activating the full-length receptor in mediating resistance to androgen-directed therapy. Oncotarget 5 (6), 1646–1656. Carriere, V., Lesuffleur, T., Barabat, A., Rousset, M., Dussaulx, E., Costet, P., deWaziers, I., Beaune, P., Zweibaum, A., 1994. Expression of cytochrome P-450 3a in HT29-MTX cells and Caco-2 clone TC7. FEBS Lett. 355, 247–250. Castillo, A.I., Jimenez-Lara, A.M., Tolon, R.M., Aranda, A., 1999. Synergistic activation of the prolactin promoter by vitamin D receptor and GHF-1: role of the coactivators, CREB-binding protein and steroid hormone receptor coactivator-1 (SRC-1). Mol. Endocrinol. 13 (7), 1141–1154. Chen, J., Weiss, W.A., 2015. Alternative splicing in cancer: implications for biology and therapy. Oncogene 34 (1), 1–14. https://doi.org/10.1038/onc.2013.570. (Review). Chiellini, G., Rapposelli, S., Zhu, J., Massarelli, I., Saraceno, M., Bianucci, A.M., Plum, L.A., Clagett-Dame, M., DeLuca, H.F., 2012. Synthesis and biological activities of vitamin D-like inhibitors of CYP24 hydroxylase. Steroids 77 (3), 212–223. Choi, M., Makishima, M., 2009. Therapeutic applications for novel non-hypercalcemic vitamin D receptor ligands. Expert. Opin. Ther. Pat. 19 (5), 593–606. https://doi.org/ 10.1517/13543770902877717. (Review). Cooper, T.A., Wan, L., Dreyfuss, G., 2009. RNA and disease. Cell 136 (4), 777–793. https://doi.org/10.1016/j.cell.2009.02.011. Review. Cote, G.J., Zhu, W., Thomas, A., Martin, E., Murad, F., Sharina, I.G., 2012. Hydrogen peroxide alters splicing of soluble guanylyl cyclase and selectively modulates expression of splicing regulators in human cancer cells. PLoS One 7 (7), e41099. https://doi.org/10.1371/journal.pone.0041099. Croft, L., Schandorff, S., Clark, F., Burragge, K., Arctander, P., Mattick, J.S., 2000. ISIS, the intron information system, reveals the high frequency of alternative splicing in the human genome. Nat. Genet. 24, 340–341. Cvoro, A., Bajic, A., Zhang, A., Simon, M., Golic, I., Sieglaff, D.H., Maletic-Savatic, M., Korac, A., Webb, P., 2016. Ligand independent and subtype-selective actions of thyroid hormone receptors in human adipose derived stem cells. PLoS One 11 (10), e0164407. https://doi.org/10.1371/journal.pone.0164407. Daniel, M., Dehm, S.M., 2017. Lessons from tissue compartment-specific analysis of androgen receptor alterations in prostate cancer. J. Steroid Biochem. Mol. Biol. 166, 28–37. https://doi.org/10.1016/j.jsbmb.2016.04.016. Deeb, K.K., Trump, D.L., Johnson, C.S., 2007. Vitamin D signalling pathways in cancer: potential for anticancer therapeutics. Nat. Rev. Cancer 7 (9), 684–700 (Review). Dehm, S.M., Schmidt, L.J., Heemers, H.V., Vessella, R.L., Tindall, D.J., 2008. Splicing of a novel androgen receptor exon generates a constitutively active androgen receptor that mediates prostate cancer therapy resistance. Cancer Res. 68 (13), 5469–5477. Dowd, D.R., MacDonald, P.N., 2010. The 1,25-dihydroxyvitamin D3-independent actions of the vitamin D receptor in skin. J. Steroid Biochem. Mol. Biol. 121 (1–2), 317–321 (Review). Gallego-Paez, L.M., Bordone, M.C., Leote, A.C., Saraiva-Agostinho, N., Ascensão-Ferreira, M., Barbosa-Morais, N.L., 2017. Alternative splicing: the pledge, the turn, and the prestige: the key role of alternative splicing in human biological systems. Hum. Genet. 136 (9), 1015–1042. https://doi.org/10.1007/s00439-017-1790-y. Gandini, S., Gnagnarella, P., Serrano, D., Pasquali, E., Raimondi, S., 2014. Vitamin D receptor polymorphisms and cancer. Adv. Exp. Med. Biol. 810, 69–105 (Review). Germain, P., Staels, B., Dacquet, C., Spedding, M., Laudet, V., 2006. Overview of nomenclature of nuclear receptors. Pharmacol. Rev. 58 (4), 685–704 (Review). Guo, Z., Qiu, Y., 2011. A new trick of an old molecule: androgen receptor splice variants taking the stage? Int. J. Biol. Sci. 7 (6), 815–822 (Review). Guyton, K.Z., Kensler, T.W., Posner, G.H., 2003. Vitamin D and vitamin D analogs as cancer chemopreventive agents. Nutr. Rev. 61 (7), 227–238 (Review). Heald, A.E., Iversen, P.L., Saoud, J.B., Sazani, P., Charleston, J.S., Axtelle, T., Wong, M., Smith, W.B., Vutikullird, A., Kaye, E., 2014. Safety and pharmacokinetic profiles of phosphorodiamidate morpholino oligomers with activity against ebola virus and Marburg virus: results of two single-ascending-dose studies. Antimicrob. Agents Chemother. 58 (11), 6639–6647. https://doi.org/10.1128/AAC.03442-14. Heald, A.E., Charleston, J.S., Iversen, P.L., Warren, T.K., Saoud, J.B., Al-Ibrahim, M., Wells, J., Warfield, K.L., Swenson, D.L., Welch, L.S., Sazani, P., Wong, M., Berry, D., Kaye, E.M., Bavari, S., 2015. AVI-7288 for Marburg virus in nonhuman primates and humans. N. Engl. J. Med. 373 (4), 339–348. https://doi.org/10.1056/ NEJMoa1410345. Heldring, N., Pike, A., Andersson, S., Matthews, J., Cheng, G., Hartman, J., Tujague, M., Ström, A., Treuter, E., Warner, M., Gustafsson, J.A., 2007. Estrogen receptors: how do they signal and what are their targets. Physiol. Rev. 87 (3), 905–931 (Review). Hepburn, L.A., McHugh, A., Fernandes, K., Boag, G., Proby, C.M., Leigh, I.M., Saville, M.K., 2018. Targeting the spliceosome for cutaneous squamous cell carcinoma therapy: a role for c-MYC and wild-type p53 in determining the degree of tumour selectivity. Oncotarget 9 (33), 23029–23046. https://doi.org/10.18632/oncotarget. 25196. Höbaus, J., Hummel, D.M., Thiem, U., Fetahu, I.S., Aggarwal, A., Müllauer, L., Heller, G., Egger, G., Mesteri, I., Baumgartner-Parzer, S., Kallay, E., 2013a. Increased copynumber and not DNA hypomethylation causes overexpression of the candidate protooncogene CYP24A1 in colorectal cancer. Int. J. Cancer 133 (6), 1380–1388. Höbaus, J., ISh, Fetahu, Khorchide, M., Manhardt, T., Kallay, E., 2013b. Epigenetic regulation of the 1,25-dihydroxyvitamin D3 24-hydroxylase (CYP24A1) in colon cancer cells. J. Steroid Biochem. Mol. Biol. 136, 296–299. Hughes, M.R., Malloy, P.J., Kieback, D.G., Kesterson, R.A., Pike, J.W., Feldman, D.,

Acknowledgments The authors would like to thank the Office of Research and the College of Agricultural Sciences at Oregon State University (Corvallis, OR) for start-up funding that supported this research. Conflict of interest disclosure statement Dr. Annalora, Ms. Jozic and Dr. Marcus have nothing to disclose. Dr. Iversen reports personal fees from Sarepta Therapeutics, and personal fees from LS Pharma, outside the submitted work. Data statement All relevant data is presented in the Results Section or Supplemental Materials. Any additional information or access to raw or unpublished data is available upon request through the Corresponding Author. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.taap.2018.12.009. References Aartsma-Rus, A., Krieg, A.M., 2017. FDA approves Eteplirsen for Duchenne muscular dystrophy: the next chapter in the Eteplirsen saga. Nucleic Acid Ther. 27 (1), 1–3. https://doi.org/10.1089/nat.2016.0657. Adams, A.M., Harding, P.L., Iversen, P.L., Coleman, C., Fletcher, S., Wilton, S.D., 2007. Antisense oligonucleotide induced exon skipping and the dystrophin gene transcript: cocktails and chemistries. BMC Mol. Biol. 8, 57. Al-Bader, M., Ford, C., Al-Ayadhy, B., Francis, I., 2011. Analysis of estrogen receptor isoforms and variants in breast cancer cell lines. Exp. Ther. Med. 2 (3), 537–544. Annalora, A., Bobrovnikova-Marjon, E., Serda, R., Lansing, L., Chiu, M.L., Pastuszyn, A., Iyer, S., Marcus, C.B., Omdahl, J.L., 2004. Rat cytochrome P450C24 (CYP24A1) and the role of F249 in substrate binding and catalytic activity. Arch. Biochem. Biophys. 425 (2), 133–146. Annalora, A.J., Goodin, D.B., Hong, W.X., Zhang, Q., Johnson, E.F., Stout, C.D., 2010. Crystal structure of CYP24A1, a mitochondrial cytochrome P450 involved in vitamin D metabolism. J. Mol. Biol. 396 (2), 441–451. Annalora, A.J., Marcus, C.B., Iversen, P.L., 2017. Alternative splicing in the cytochrome P450 superfamily expands protein diversity to augment gene function and redirect human drug metabolism (2017). Drug Metab. Dispos. 45 (4), 375–389. https://doi. org/10.1124/dmd.116.073254. (Review). Bauman, J., Jearawiriyapaisarn, N., Kole, R., 2009. Therapeutic potential of spliceswitching oligonucleotides. Oligonucleotides 19 (1), 1–13. https://doi.org/10.1089/ oli.2008.0161. (Review). Bennesch, M.A., Picard, D., 2015. Minireview: tipping the balance: ligand-independent activation of steroid receptors. Mol. Endocrinol. 29 (3), 349–363 (Review).

65

Toxicology and Applied Pharmacology 364 (2019) 55–67

A.J. Annalora et al. O'Malley, B.W., 1988. Point mutations in the human vitamin D receptor gene associated with hypocalcemic rickets. Science 242 (4886), 1702–1705. Iversen, P.L., Warren, T.K., Wells, J.B., Garza, N.L., Mourich, D.V., Welch, L.S., Panchal, R.G., Bavari, S., 2012. Discovery and early development of AVI-7537 and AVI-7288 for the treatment of Ebola virus and Marburg virus infections. Viruses 4 (11), 2806–2830. https://doi.org/10.3390/v4112806. Jiang, P., Hou, Z., Bolin, J.M., Thomson, J.A., Stewart, R., 2017. RNA-Seq of human neural progenitor cells exposed to lead (Pb) reveals transcriptome dynamics, splicing alterations and disease risk associations. Toxicol. Sci. 159 (1), 251–265. https://doi. org/10.1093/toxsci/kfx129. Jiménez-Lara, A.M., Aranda, A., 1999. Vitamin D represses retinoic acid-dependent transactivation of the retinoic acid receptor-beta2 promoter: the AF-2 domain of the vitamin D receptor is required for transrepression. Endocrinology 140 (6), 2898–2907. Kaisers, W., Schwender, H., Schaal, H., 2017. Sample size estimation for detection of splicing events in transcriptome sequencing data. Int. J. Mol. Sci. 18 (9), pii. E1900. https://doi.org/10.3390/ijms18091900. Kole, R., Krainer, A.R., Altman, S., 2012. RNA therapeutics: beyond RNA interference and antisense oligonucleotides. Nat. Rev. Drug Discov. 11 (2), 125–140. Koo, T., Wood, M.J., 2013. Clinical trials using antisense oligonucleotides in duchenne muscular dystrophy. Hum. Gene Ther. 24 (5), 479–488. Kornblihtt AR, Schor IE, Alló M, Dujardin G, Petrillo E, Muñoz MJ. (2013) Alternative splicing: a pivotal step between eukaryotic transcription and translation. Nat. Rev. Mol. Cell Biol. 14(3):153–65. doi: https://doi.org/10.1038/nrm3525. (Review). Erratum in: Nat. Rev. Mol. Cell. Biol. 2013. 14(3). doi: https://doi.org/10.1038/ nrm3560. Kósa, J.P., Horváth, P., Wölfling, J., Kovács, D., Balla, B., Mátyus, P., Horváth, E., Speer, G., Takács, I., Nagy, Z., Horváth, H., Lakatos, P., 2013. CYP24A1 inhibition facilitates the anti-tumor effect of vitamin D3 on colorectal cancer cells. World J. Gastroenterol. 19 (17), 2621–2628 (ex). Köstner, K., Denzer, N., Müller, C.S., Klein, R., Tilgen, W., Reichrath, J., 2009. The relevance of vitamin D receptor (VDR) gene polymorphisms for cancer: a review of the literature. Anticancer Res. 29 (9), 3511–3536 (Review). Kristjansson, K., Rut, A.R., Hewison, M., O'Riordan, J.L., Hughes, M.R., 1993. Two mutations in the hormone binding domain of the vitamin D receptor cause tissue resistance to 1,25 dihydroxyvitamin D3. J. Clin. Invest. 92 (1), 12–16. Lambert, C.A., Garbacki, N., Colige, A.C., 2017. Chemotherapy induces alternative transcription and splicing: facts and hopes for cancer treatment. Int. J. Biochem. Cell Biol. 91 (Pt B), 84–97. https://doi.org/10.1016/j.biocel.2017.04.006. Lee, S.M., Pike, J.W., 2015. The vitamin D receptor functions as a transcription regulator in the absence of 1,25-dihydroxyvitamin D(3). J. Steroid Biochem. Mol. Biol. (15), 30050–30059 pii:S0960–0760. (Review). Lee, S.M., Meyer, M.B., Benkusky, N.A., O'Brien, C.A., Pike, J.W., 2015. Mechanisms of enhancer-mediated hormonal control of vitamin D receptor gene expression in target cells. J. Biol. Chem. 290 (51), 30573–30586. https://doi.org/10.1074/jbc.M115. 693614. Li, Y., He, B., Gao, J., Liu, Q.S., Liu, R., Qu, G., Shi, J., Hu, L., Jiang, G., 2018. Methylmercury exposure alters RNA splicing in human neuroblastoma SK-N-SH cells: implications from proteomic and post-transcriptional responses. Environ. Pollut. 238, 213–221. https://doi.org/10.1016/j.envpol.2018.03.019. Liu, R., Loraine, A.E., Dickerson, J.A., 2014. Comparisons of computational methods for differential alternative splicing detection using RNA-seq in plant systems. BMC Bioinformatics 15, 364. Liu, J., Li, H., Shen, S., Sun, L., Yuan, Y., Xing, C., 2018. Alternative splicing events implicated in carcinogenesis and prognosis of colorectal cancer. J. Cancer 9 (10), 1754–1764. https://doi.org/10.7150/jca.24569. Long, M.D., Sucheston-Campbell, L.E., Campbell, M.J., 2015. Vitamin D receptor and RXR in the post-genomic era. J. Cell. Physiol. 230 (4), 758–766. Luo, W., Hershberger, P.A., Trump, D.L., Johnson, C.S., 2013. 24-Hydroxylase in cancer: impact on vitamin D based anticancer therapeutics. J. Steroid Biochem. Mol. Biol. 136, 252–257. Luo, W., Johnson, C.S., Trump, D.L., 2016. Vitamin D signaling modulators in cancer therapy. Vitam. Horm. 100, 433–472. Ly, L.H., Zhao, X.Y., Holloway, L., Feldman, D., 1999. Liarozole acts synergistically with 1alpha,25-dihydroxyvitamin D3 to inhibit growth of DU 145 human prostate cancer cells by blocking 24-hydroxylase activity. Endocrinology 140 (5), 2071–2076. Maestro, M.A., Molnár, F., Mouriño, A., Carlberg, C., 2016. Vitamin D receptor 2016: novel ligands and structural insights. Expert. Opin. Ther. Pat. 26 (11), 1291–1306 (Review). Malloy, P.J., Feldman, B.J., 2013. Cell-autonomous regulation of brown fat identity gene UCP1 by unliganded vitamin D receptor. Mol. Endocrinol. 27 (10), 1632–1642. Martínez-Montiel, N., Anaya-Ruiz, M., Pérez-Santos, M., Martínez-Contreras, R.D., 2017. Alternative splicing in breast cancer and the potential development of therapeutic tools. Genes (Basel) 8 (10), pii. 2017 Oct 5. E217. https://doi.org/10.3390/ genes8100217 (Review). McClorey, G., Moulton, H.M., Iversen, P.L., Fletcher, S., Wilton, S.D., 2006. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther. 13 (19), 1373. McGuire, J., Okamoto, K., Whitelaw, M.L., Tanaka, H., Poellinger, L., 2001. Definition of a dioxin receptor mutant that is a constitutive activator of transcription: delineation of overlapping repression and ligand binding functions within the PAS domain. J. Biol. Chem. 276 (45), 41841–41849. Melangath, G., Sen, T., Kumar, R., Bawa, P., Srinivasan, S., Vijayraghavan, U., 2017. Functions for fission yeast splicing factors SpSlu7 and SpPrp18 in alternative splicesite choice and stress-specific regulated splicing. PLoS One 12 (12), e0188159. https://doi.org/10.1371/journal.pone.0188159.

Menegaz, D., Mizwicki, M.T., Barrientos-Duran, A., Chen, N., Henry, H.L., Norman, A.W., 2011. Vitamin D receptor (VDR) regulation of voltage-gated chloride channels by ligands preferring a VDR-alternative pocket (VDR-AP). Mol. Endocrinol. 25 (8), 1289–1300. Mizwicki, M.T., Menegaz, D., Yaghmaei, S., Henry, H.L., Norman, A.W., 2010. A molecular description of ligand binding to the two overlapping binding pockets of the nuclear vitamin D receptor (VDR): structure-function implications. J. Steroid Biochem. Mol. Biol. 121 (1–2), 98–105. Molnár, F., 2014. Structural considerations of vitamin D signaling. Front. Physiol. 5, 191. Moriyama, K., Yamamoto, H., Futawaka, K., Atake, A., Kasahara, M., Tagami, T., 2016. Molecular characterization of human thyroid hormone receptor β isoform 4. Endocr. Res. 41 (1), 34–42. Mourich, D.V., Oda, S.K., Schnell, F.J., Crumley, S.L., Hauck, L.L., Moentenich, C.A., Marshall, N.B., Hinrichs, D.J., Iversen, P.L., 2014. Alternative splice forms of CTLA-4 induced by antisense mediated splice-switching influences autoimmune diabetes susceptibility in NOD mice. Nucleic Acid Ther. 24 (2), 114–126. Norman, A.W., 2006. Minireview: vitamin D receptor: new assignments for an already busy receptor. Endocrinology 147, 5542–5548. O'Leary, N.A., et al., 2016. Reference sequence (RefSeq) database at NCBI: current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 44 (D1), D733–D745. https://doi.org/10.1093/nar/gkv1189. Orlov, I., Rochel, N., Moras, D., Klaholz, B.P., 2012. Structure of the full human RXR/VDR nuclear receptor heterodimer complex with its DR3 target DNA. EMBO J. 31 (2), 291–300. Park, E., Lee, M.L., Baik, S.M., Cho, E.B., Son, G.H., Seong, J.Y., Lee, K.H., Kim, K., 2009. NOVA-1 mediates glucocorticoid-induced inhibition of pre-mRNA splicing of gonadotropin-releasing hormone transcripts. J. Biol. Chem. 284, 12792–12800. Park, E., Pan, Z., Zhang, Z., Lin, L., Xing, Y., 2018. The expanding landscape of alternative splicing variation in human populations. Am. J. Hum. Genet. 102 (1), 11–26. https:// doi.org/10.1016/j.ajhg.2017.11.002. (Review). Pike, J.W., Lee, S.M., Meyer, M.B., 2014. Regulation of Gene Expression by 1,25Dihydroxyvitamin D3 in Bone Cells: Exploiting New Approaches and Defining New Mechanisms. (Bonekey Rep. 3:482. Review). Posner, G.H., Helvig, C., Cuerrier, D., Collop, D., Kharebov, A., Ryder, K., Epps, T., Petkovich, M., 2010. Vitamin D analogues targeting CYP24 in chronic kidney disease. J. Steroid Biochem. Mol. Biol. 121 (1–2), 13–19. Qu, S., Yang, X., Li, X., Wang, J., Gao, Y., Shang, R., Sun, W., Dou, K., Li, H., 2015. Circular RNA: a new star of noncoding RNAs. Cancer Lett. 365 (2), 141–148. Rastinejad, F., Huang, P., Chandra, V., Khorasanizadeh, S., 2013. Understanding nuclear receptor form and function using structural biology. J. Mol. Endocrinol. 51 (3), T1–T21 (Review). Read, A., Natrajan, R., 2018. Splicing dysregulation as a driver of breast cancer. Endocr. Relat. Cancer 25 (9), R467–R478. https://doi.org/10.1530/ERC-18-0068. (Review). Reautschnig, P., Vogel, P., Stafforst, T., 2017. The notorious R.N.A. in the spotlight – drug or target for the treatment of disease. RNA Biol. 14 (5), 651–668. https://doi.org/10. 1080/15476286.2016.1208323. Rhieu, S.Y., Annalora, A.J., Gathungu, R.M., Vouros, P., Uskokovic, M.R., Schuster, I., Palmore, G.T., Reddy, G.S., 2011. A new insight into the role of rat cytochrome P450 24A1 in metabolism of selective analogs of 1α,25dihydroxyvitamin D₃. Arch. Biochem. Biophys. 509 (1), 33–43. Rhoads, A., Au, K.F., 2015. PacBio sequencing and its applications. Genomics Proteomics Bioinformatics 13 (5), 278–289. https://doi.org/10.1016/j.gpb.2015.08.002. (Review). Rochel, N., Wurtz, J.M., Mitschler, A., Klaholz, B., Moras, D., 2000. The crystal structure of the nuclear receptor for vitamin D bound to its natural ligand. Mol. Cell 5 (1), 173–179. Schneider, C.A., Rasband, W.S., Eliceiri, K.W., 2012. NIH image to ImageJ: 25 years of image analysis. Nat. Methods 9 (7), 671–675. Shaffer, P.L., Gewirth, D.T., 2004. Structural analysis of RXR-VDR interactions on DR3 DNA. J. Steroid Biochem. Mol. Biol. 89–90 (1–5), 215–219. Skorija, K., Cox, M., Sisk, J.M., Dowd, D.R., MacDonald, P.N., Thompson, C.C., Demay, M.B., 2005. Ligand-independent actions of the vitamin D receptor maintain hair follicle homeostasis. Mol. Endocrinol. 19 (4), 855–862. Skowronski, R.J., Peehl, D.M., Feldman, D., 1993. Vitamin D and prostate cancer: 1,25 dihydroxyvitamin D3 receptors and actions in human prostate cancer cell lines. Endocrinology 132 (5), 1952–1960. Song, X., Zeng, Z., Wei, H., Wang, Z., 2018. Alternative splicing in cancers: from aberrant regulation to new therapeutics. Semin. Cell Dev. Biol. 75, 13–22. https://doi.org/10. 1016/j.semcdb.2017.09.018. Sood, S., Szkop, K.J., Nakhuda, A., Gallagher, I.J., Murie, C., Brogan, R.J., Kaprio, J., Kainulainen, H., Atherton, P.J., Kujala, U.M., Gustafsson, T., Larsson, O., Timmons, J.A., 2016. iGEMS: an integrated model for identification of alternative exon usage events. Nucleic Acids Res. 44 (11), e109. https://doi.org/10.1093/nar/gkw263. Sprung, C.N., Li, J., Hovan, D., McKay, M.J., Forrester, H.B., 2011. Alternative transcript initiation and splicing as a response to DNA damage. PLoS One 6 (10), e25758. https://doi.org/10.1371/journal.pone.0025758. Stellato, C., Porreca, I., Cuomo, D., Tarallo, R., Nassa, G., Ambrosino, C., 2016. The "busy life" of unliganded estrogen receptors. Proteomics 16 (2), 288–300. Syed, Y.Y., 2016. Eteplirsen: first global approval. Drugs 76 (17), 1699–1704 (Review). Takamizawa, T., Satoh, T., Miyamoto, T., Nakajima, Y., Ishizuka, T., Tomaru, T., Yoshino, S., Katano-Toki, A., Nishikido, A., Sapkota, S., Watanabe, T., Okamura, T., Ishida, E., Horiguchi, K., Matsumoto, S., Ishii, S., Ozawa, A., Shibusawa, N., Okada, S., Yamada, M., 2018. Transducin β-like 1, X-linked and nuclear receptor co-repressor cooperatively augment the ligand-independent stimulation of TRH and TSHβ gene promoters by thyroid hormone receptors. Endocr. J. 65 (8), 805–813. https://doi. org/10.1507/endocrj.EJ17-0384.

66

Toxicology and Applied Pharmacology 364 (2019) 55–67

A.J. Annalora et al. Tang, J.Y., Lee, J.C., Hou, M.F., Wang, C.L., Chen, C.C., Huang, H.W., Chang, H.W., 2013. Alternative splicing for diseases, cancers, drugs, and databases. ScientificWorldJournal 2013, 703568. https://doi.org/10.1155/2013/703568. (Print 2013. Review). Thierry-Mieg, D., Thierry-Mieg, J., 2006. AceView: a comprehensive cDNA-supported gene and transcripts annotation. Genome Biol. 7 (Suppl 1:S12), 1–14. Trivedi, T., Zheng, Y., Fournier, P.G.J., Murthy, S., John, S., Schillo, S., Dunstan, C.R., Mohammad, K.S., Zhou, H., Seibel, M.J., Guise, T.A., 2017. The vitamin D receptor is involved in the regulation of human breast cancer cell growth via a ligand-independent function in cytoplasm. Oncotarget 8 (16), 26687–26701. https://doi.org/ 10.18632/oncotarget.15803. Untergasser, A., Cutcutache, I., Koressaar, T., Ye, J., Faircloth, B.C., Remm, M., Rozen, S.G., 2012. Primer3–new capabilities and interfaces. Nucleic Acids Res. 40 (15), e115. Urbanski, L.M., Leclair, N., Anczuków, O., 2018. Alternative-splicing defects in cancer: splicing regulators and their downstream targets, guiding the way to novel cancer therapeutics. Wiley Interdiscip. Rev. RNA 9 (4), e1476. https://doi.org/10.1002/ wrna.1476. (Review). van Roon-Mom, W.M., Aartsma-Rus, A., 2012. Overview on applications of antisensemediated exon skipping. Methods Mol. Biol. 867, 79–96. Wan, Y., Larson, D.R., 2018. Splicing heterogeneity: separating signal from noise. Genome Biol. 19 (1), 86. https://doi.org/10.1186/s13059-018-1467-4. Wan, L.Y., Zhang, Y.Q., Chen, M.D., Liu, C.B., Wu, J.F., 2015. Relationship of structure and function of DNA binding domain in vitamin D receptor. Molecules 20 (7), 12389–12399 (Review). Wang, W., Chen, J., Luo, L., Li, Y., Liu, J., Zhang, W., 2018a. Effect of cadmium on kitl pre-mRNA alternative splicing in murine ovarian granulosa cells and its associated regulation by miRNAs. J. Appl. Toxicol. 38 (2), 227–239. https://doi.org/10.1002/ jat.3516. Wang, X., Codreanu, S.G., Wen, B., Li, K., Chambers, M.C., Liebler, D.C., Zhang, B.,

2018b. Detection of proteome diversity resulted from alternative splicing is limited by trypsin cleavage specificity. Mol. Cell. Proteomics 17 (3), 422–430. https://doi. org/10.1074/mcp.RA117.000155. Whitfield, G.K., Remus, L.S., Jurutka, P.W., Zitzer, H., Oza, A.K., Dang, H.T., Haussler, C.A., Galligan, M.A., Thatcher, M.L., Encinas Dominguez, C., Haussler, M.R., 2001. Functionally relevant polymorphisms in the human nuclear vitamin D receptor gene. Mol. Cell. Endocrinol. 177, 145–159. Wong, C.M., Xu, L., Yau, M.Y., 2018. Alternative mRNA Splicing in the Pathogenesis of Obesity. Int. J. Mol. Sci. 19 (2), pii. E632. https://doi.org/10.3390/ijms19020632 (Review). Xu, D., Zhan, Y., Qi, Y., Cao, B., Bai, S., Xu, W., Gambhir, S.S., Lee, P., Sartor, O., Flemington, E.K., Zhang, H., Hu, C.D., Dong, Y., 2015. Androgen receptor splice variants dimerize to transactivate target genes. Cancer Res. 75 (17), 3663–3671. Zaharieva, E., Chipman, J.K., Soller, M., 2012. Alternative splicing interference by xenobiotics. Toxicology 296 (1–3), 1–12. https://doi.org/10.1016/j.tox.2012.01.014. (Review). Zennaro, M.C., Souque, A., Viengchareun, S., Poisson, E., Lombès, M., 2001. A new human MR splice variant is a ligand-independent transactivator modulating corticosteroid action. Mol. Endocrinol. 15 (9), 1586–1598. Zhou, H., Xu, C., Gu, M., 2009. Vitamin D receptor (VDR) gene poly- morphisms and Graves' disease: a metaanalysis. Clin. Endocrinol. 70, 938–945. Zhou, R., Chun, R.F., Lisse, T.S., Garcia, A.J., Xu, J., Adams, J.S., Hewison, M., 2015. Vitamin D and alternative splicing of RNA. J. Steroid Biochem. Mol. Biol. 148, 310–317. Zhu, H., Huang, Y., Su, H., Ma, Y., Tao, Y., Liao, D.J., Liu, Y., Feng, Z., 2018. Identification of a novel human estrogen receptor-α splice variant able to enhance malignant biological behaviors of breast cancer cells. Oncol. Lett. 15 (4), 5339–5344. https:// doi.org/10.3892/ol.2018.7970. Zmuda, J.M., Cauley, J.A., Ferrell, R.E., 2000. Molecular epidemiology of vitamin D receptor gene variants. Epidemiol. Rev. 22, 203–217.

67