- Email: [email protected]
An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide
Analytica Chimica Acta xxx (xxxx) xxx
Contents lists available at ScienceDirect
Analytica Chimica Acta journal homepage: www.elsevier.com/locate/aca
An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide Anu Bharti a, Shilpa Rana a, Divya Dahiya b, Navneet Agnihotri a, Nirmal Prabhakar a, * a b
Department of Biochemistry, Panjab University, Chandigarh, India Department of Surgery, Postgraduate Institute of Medical Education and Research, Chandigarh, India
h i g h l i g h t s
g r a p h i c a l a b s t r a c t
Aptamer based electrochemical biosensor for detection of MUC1 protein has been reported. This method employs AuePt bimetallic nanoparticles deposited carboxylated graphene oxide as biosensing platform. MUC1 can be detected efficiently upto 0.79 fM with a linear range 1 fM-100 nM. Spiked human serum samples were evaluated for MUC1 detection with recovery range from 92% to 97%.
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 August 2019 Received in revised form 1 November 2019 Accepted 2 November 2019 Available online xxx
A simple electrochemical strategy has been designed for the analysis of MUC1 using electrodeposited gold platinum bimetallic nanoparticles (Au-PtBNPs) on the surface of carboxylated graphene oxide (CGO)/FTO electrode as a signal amplification platform. The carboxylic groups of CGO were activated with EDS-NHS linker and subsequently immobilized with streptavidin for further deposition of biotin labelled aptamer. All the modification steps were characterized by FE-SEM, EDS mapping, FT-IR, contact angle measurements and electrochemical methods. After incubating with target protein MUC1, the aptaelectrode produced some concentration dependent responses which were measured electrochemically by DPV assay. The prepared aptasensor exhibits wide linear range from 1 fM-100 nM with detection limit of 0.79 fM under optimal experimental conditions. The performance of this aptaelectrode was also evaluated showing good selectivity, storage stability (15 days), reproducibility and reusability (up to 3 times). Furthermore, the applicability of the aptasensor for spiked serum samples showed recovery range from 92% to 97%. © 2019 Elsevier B.V. All rights reserved.
Keywords: MUC1 Electrochemical aptasensor Bimetallic nanoparticles Carboxylated graphene oxide Breast cancer
1. Introduction
* Corresponding author. E-mail addresses: [email protected], (N. Prabhakar).
[email protected]
Breast cancer is the most commonly diagnosed cancer amongst women worldwide and is the second leading cause of cancer related deaths [1,2]. In the year 2012, approximately 1 million new cases and more than 5,00,000 deaths occurred due to breast cancer
https://doi.org/10.1016/j.aca.2019.11.005 0003-2670/© 2019 Elsevier B.V. All rights reserved.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
2
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
[3]. Mammography, ultrasound, X-ray, MRI and tissue biopsy are frequently used conventional screening techniques that have significantly reduced the mortality rates of breast cancer patients. But these techniques are associated with very low sensitivity and selectivity with false positive results [4]. Therefore, highly sensitive and minimally invasive detection methods are highly needed for the management of cancer screening as well as treatment strategies. Glycoprotein biomarkers which are highly expressed in breast cancer patients includes CA15-3, HER-2, BRCA-1,2 and MUC1 [5,6]. Mucin1 (MUC1) is a high molecular weight trans-membrane glycoprotein present on the apical surfaces of epithelial cells [7]. It provides protection to the underlying epithelia from various mechanical, chemical and biological damages and also involved in the signal transduction pathways. Aberrant glycosylation and overexpression of MUC1 protein play crucial role in the development of different type of cancers [8,9]. Increased level of MUC1 at the early stages of breast cancer could make it a useful diagnostic biomarker as well as therapeutic target [10,11]. Routinely used methods for MUC1 detection are ELISA, IHC, northern blotting and PCR. These previously reported detection methods are very costly, time consuming and require skilled laboratory person for instrument handling [12,13]. So, biosensors are considered as better alternatives due to its ease of use, cost effectiveness and quick response which could efficiently meet the needs of patients. Many researchers have explored different biosensing methods for cancer detection based on colorimetry [14], electrochemistry [15], piezoelectric sensing [16] and optical measurements [17]. Electrochemical approaches are found to be the most promising alternative in biological sensing due to its cost effectiveness, ease of use, rapid response, high sensitivity and selectivity [18e20]. In the recent years, aptamers as bio-recognition element have been widely used for the detection of various target analytes [21e23]. Aptamers are single stranded nucleic acids synthesized by SELEX method [24]. They undergo some conformational changes after interaction with its target resulting in some measurable responses. Since, aptamer exhibit unique features like easy to synthesize, stability against denaturation, high sensitivity and selectivity suggesting a good alternative to antibodies. To date, many electrochemical aptasensors have been designed for the detection of MUC1, of which some are discussed in detail. Cai et al., constructed a signal amplification aptasensor for the detection of breast cancer cells via free running DNA walker with detection limit of 47 cells mL1 [25]. Wang et al., reported a sandwich electrochemical biosensor for the detection of human breast cancer cells (MCF-7) using polyadenine-aptamer. The biosensor was constructed by hybridizing the MCF-7 cells with polyadenine-aptamer modified gold electrode on one side and polyA-aptamer functionalized AuNPs/GO hybrid on other side to improve the electrochemical response. A detection limit 8 cells mL1 was observed with a linear range of 10-105 cells mL1 [26]. Recently, on the basis of target induced catalytic hairpin assembly combined with PtPdNPs (having peroxidase-like activity), an electrochemical aptasensor was reported for MUC1 detection. The biosensor showed detection limit of about 16 fg mL1 with a linear range of 100 fg mL1-1 ng mL1 [27]. For the immobilization of these aptamer sequences some suitable matrix materials are introduced to the biosensing platform for convenient detection of target molecules. Graphene oxide (GO) has been enormously used in the field of biosensors due to the presence of wide functionality, very high surface to volume ratio, chemical stability, mechanical strength, fast electron transport and excellent biocompatibility [28e31]. The oxygen containing functional groups present on the surface of graphene oxide could make an ideal platform for the immobilization of biomolecules on its surface
[32,33]. Moreover, researchers have focused on the use of bimetallic nanoparticle based approaches to enhance the sensitivity level of biosensors [34,35]. Considering all this, we aimed to prepare a biosensing platform using carboxylated graphene oxide (CGO) coated with gold-platinum bimetallic nanoparticles (Au-PtBNPs) on its surface. The prepared biosensing platform was explored for electrochemical detection of MUC1 protein using biotin tagged aptamer as a recognition element. The eCOOH modification on the surface of GO nanosheets renders a better fabrication platform for the immobilization of biomolecules. The synergistic effect of both the metal nanoparticles shows unique optical, catalytic and electrochemical properties compared to the corresponding monometallic nanoparticles [36]. The size and shape of bimetallic nanoparticles could be modified accordingly based on the methodology and conditions provided for their preparation. The electrodeposited Au-PtBNPs showed uniform distribution on the surface of CGO which has greatly improved the analytical response of developed biosensor. 2. Experimental 2.1. Materials and apparatus MUC1 protein was purchased from Biolink, India. The biotinylated aptamer sequence, FTO (fluorine tin Oxide) sheets, graphite powder, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), N-hydroxysuccinimide (NHS), chloroauric acid (HAuCl4), chloroplatinic acid (H2PtCl6) and streptavidin were purchased from Sigma-Aldrich, USA (www.sigmaaldrich.com). Sodium sulphate (Na2SO4), Sodium chloride (NaCl), sodium hydroxide (NaOH), tris buffer, ethylene diamine tetra acetic acid (EDTA), potassium ferrocyanide trihydrate (K4Fe(CN)6.3H2O) and potassium ferricyanide (K3Fe(CN)6) were purchased from HiMedia Laboratory Pvt. Ltd., Mumbai, India (www.himedialabs.com). Mono-sodium phosphate (NaH2PO4.2H2O) and di-sodium phosphate (Na2HPO4) were purchased from Thermo Fisher Scientific Pvt. Ltd., Mumbai, India (www.thermofisher.com). Different concentrations of aptamer were prepared in TE buffer, whereas PBS was used to make different concentrations of MUC1 protein. PBS buffer containing 5 mM [Fe(CN)6]3-/4- and 0.9% NaCl was used to perform various electrochemical studies. All the reagents used in the study were of analytical grade. Autoclaved buffer solutions were used throughout the experimental work. The 72mer biotinylated aptamer sequence used in this study was chosen from previously reported paper [37]. MUC1 aptamer sequence- [50 -Btn GGGAGACAAGAATAAACGCTCAAGCAGTTGATCCTTTGGATACCCTGGTTCGACAGGAGGCTCACAACAGGC-3’] Mutated aptamer sequence- [50 -Btn GGGAGACAAGAATAAACGCTCAAGCAGATGATCCTTTAGATACCCTGGTTCGACAGGAGGCTCACAACAGGC-3’] FE-SEM (Field Emission-Scanning Electron Microscopy) imaging and EDS (Energy Dispersive X-ray Spectroscopy) mapping were done with Hitachi SU8000 microscope. The FT-IR (Fourier Transform Infrared Spectroscopy) spectra were obtained from PerkinElmer [DB-01]. Contact angles measurements were performed on sessile drop using KRUSS apparatus. All the electrochemical measurements were performed using an electrochemical work station AutoLab 302NFRA32 M, Metrohm-Autolab Instruments, Netherlands.The instrument configuration consist of three electrodes, with modified FTO as working electrode, Ag/AgCl as reference and Pt as the counter electrode.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
2.2. Preparation of aptaelectrode (AptMUC1/SA/Au-PtBNPs/CGO/FTO) The synthesis of graphene oxide was done according to modified Hummer’s method [38]. The process of carboxylation was followed as discussed in our previous paper [39]. The electrode was prepared by applying 15 ml of CGO solution (5 mg mL1) on the surface of FTO coated glass film. After drying, gold-platinum bimetallic nanoparticles were electro-polymerized on its surface by applying 0.2 V potential for 350 s using chronoamperometry. The prepared nanocomposite coated FTO electrode was than incubated with EDC-NHS for 150 min to activate -carboxylic moieties present at the surface of graphene oxide sheets. 0.05 mg mL1 of streptavidin (SA) solution prepared in PBS buffer was drop casted on the electrode surface. The eNH2 moieties of SA molecule interact with the carboxylic groups of CGO by eCOeNH- bonding. Further, SA coated electrode surface was incubated with 10 mL of biotinylated aptamer solution and stored at 4 C prior to use. SA binds to the biotin tagged aptamer sequence through biotin-avidin strong interaction making the aptaelectrode surface more stable for interaction with target molecule. The fabrication strategy employed for the development of presented aptasensor has been depicted in Fig. 1.
2.3. Characterization and optimization parameters Various modifications done on FTO electrode surface were characterized to confirm successful development of the aptasensor. FE-SEM imaging was done to check the morphological appearance of the modified electrodes whereas Energy Dispersive X-ray Spectroscopy (EDS) mapping was done for elemental analysis of the electrode surfaces. The functional groups present on electrode surface and hydrophilic nature of different fabricated materials was detected by FT-IR analysis and contact angle measurements, respectively. Cyclic voltammetry (CV), differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS) was performed to analyse the electrochemical behaviour of modified FTO electrodes. The analytical parameters for the detection of MUC1 using the aptasensor in terms of aptamer concentration and incubation time
3
were optimized. In order to evaluate the effect of aptamer concentration, SA/Au-PtBNPs/CGO/FTO electrode was incubated with varying amount of AptMUC1 (2e15 mM) and corresponding DPV response was taken. Further, the effect of incubation time on the binding efficiency of aptaelectrode for the detection of MUC1 protein was investigated. The DPV response of AptMUC1/SA/AuPtBNPs/CGO/FTO was measured after incubating with MUC1 protein for a series of time interval (5e30 min). 2.4. Detection of MUC1 protein The efficacy of aptasensor to detect varying concentration of MUC1 protein was examined under optimized experimental conditions. AptMUC1/SA/Au-PtBNPs/CGO/FTO was incubated with increased MUC1 concentration from 1 fM to 100 nM for 25 min. Followed by washing with PBS to eliminate the loosely bound protein molecules and DPV current responses were measured to calculate the limit of detection. 2.5. Selectivity, interference and storage stability of the aptasensor Different types of non-complementary targets tested with the aptasensor to evaluate the selectivity include BSA, MPT64 protein (M. tuberculosis surface antigen) and glucose. A mutated aptamer sequence (two base mismatch) was also applied on the SA/AuPtBNPs/CGO/FTO electrode and used for MUC1 detection. The AptMUC1/SA/Au-PtBNPs/CGO/FTO electrode was incubated with different targets for 25 min at a concentration of 1 mg mL1. Interference of various molecules was also tested by treating the aptaelectrode with mixture of non-complementary molecules present along with MUC1 protein. The non-selective targets were washed off in PBS and DPV measurements were taken. Furthermore, the stability of aptaelectrode was also evaluated up to 30 days at an interval of 5 days. 2.6. Reproducibility, regeneration and reusability assay The reproducibility of aptasensor was also assessed by applying
Fig. 1. Schematic illustration of the fabricated aptasensor.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
4
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
10 pM and 10 nM of MUC1 protein on the surface of two sets of seven different electrodes, respectively. Additionally, the regeneration efficiency of fabricated aptasensor was also investigated. The aptamer immobilized electrode was regenerated by incubating the electrodes with 10 mM of NaOH solution for 10 min and rinsed off with PBS. The DPV response of aptaelectrode was measured after each regeneration step. 2.7. Spike-in studies To demonstrate the potential application of developed AptMUC1/ SA/Au-PtBNPs/CGO/FTO electrode for MUC1 detection, human serum was used. Known concentration of standard MUC1 solution (1 fM, 1 101 fM, 1 102 fM, 1 103 fM and 1 104 fM) was spiked in 10% (V/V) human serum sample and incubated on the surface of aptaelectrode for 25 min. Finally, the electrodes were rinsed with PBS and used for DPV measurements as mentioned above. 3. Results and discussion
FTO) as well as biotinylated aptamer (AptMUC1/SA/Au-PtBNPs/CGO/ FTO) on its surface by FE-SEM imaging. CGO nanosheets coated on FTO electrode showed wrinkled and crumpled morphology (i). After the electro-deposition of Au-PtBNPs, uniform distribution of round shaped nanoparticles emerged on the surface of CGO was seen (ii). The carboxylic groups present on CGO surface was activated by applying EDC-NHS so as to bind the amine groups present in streptavidin molecule through strong CHeNH linkage. In Fig. 2A (iii), smooth globular appearance on the electrode surface confirmed the binding of SA molecules. Moreover, biotin tagged aptamer incubated on its surface changed the pattern to condensed globular morphology (iv). Thus, the FE-SEM imaging successfully confirmed the immobilization of various molecules on electrode surface. The elementary composition of the fabricated materials (CGO and Au-PtBNPs/CGO), coated on FTO electrode surface was also characterized by EDS mapping analysis. The characteristic peaks of C and O present in CGO/FTO confirmed the presence of carboxylic moieties available for further linkage (Fig. 2B (i)). The electrochemically deposited Au and Pt showed their respective peaks with homogenous distribution on CGO sheets, which could be seen in Fig. 2B (ii).
3.1. FE-SEM and EDS mapping Fig. 2A shows the surface morphology of as prepared CGO/FTO, AuePt bimetallic nanoparticles coated CGO/FTO and further modifications steps done by applying streptavidin (SA/Au-PtBNPs/CGO/
3.2. FT-IR spectra and contact angle measurements The FT-IR spectra of CGO/FTO, Au-PtBNPs/CGO/FTO, SA/Au-
Fig. 2. (A) FE-SEM images of (i) CGO (ii) Au-PtBNPs/CGO (iii) SA/Au-PtBNPs/CGO and (iv) AptMUC1/SA/Au-PtBNPs/CGO coated FTO electrodes. (B) EDS spectra of (i) CGO/FTO & (ii) Au-PtBNPs/CGO/FTO.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
PtBNPs/CGO/FTO and AptMUC1/SA/Au-PtBNPs/CGO/FTO are given in Fig. 3A. In the IR spectra of CGO, the peaks at 1030 cm1, 1220 cm1, 1360 cm1, 1570 cm1, 1740 cm1 and 3330 cm1 corresponds to the stretching vibrations of CeO, CeOH, OeH, C]C, C]O and eOH, respectively (i) [40]. After coating Au-PtBNPs, only the peaks corresponding to CGO was found with no characteristic peak for bimetallic nanoparticles (ii). The peaks for amide groups, 1670 cm1 (-CONH stretch of amide I) and 1590 cm1 (CeN stretch of amide II) were appeared after the immobilization of streptavidin on the surface of Au-PtBNPs/CGO/FTO electrode (iii) [41,42]. In the AptMUC1 coated SA/Au-PtBNPs/CGO/FTO electrode (iv), the peaks at 1630 cm1 attributed to the presence of thymine in single stranded DNA. The other peaks at 1330 cm1 and 1110 cm1 indicated the presence of C]C and C]N stretch of the pyrimidine and purines, whereas, the peaks at 1010 cm1 and 851 cm1 are due to the presence of phosphate groups and deoxyribose ring vibrations, respectively [43]. The contact angle measurements were done to study the hydrophilic nature of different fabricated materials on the surface of FTO electrode. Fig. 3B shows the contact angle images of various modified electrodes (i) CGO/FTO (ii) Au-PtBNPs/CGO/FTO (iii) SA/ Au-PtBNPs/CGO/FTO and (iv) AptMUC1/SA/Au-PtBNPs/CGO/FTO. Due to the presence of oxygen containing functional groups in CGO, the hydrophilicity of electrode increased showing contact angle of about 18.3 (i). After coating Au-PtBNPs on CGO/FTO, the hydrophilicity decreased and contact angle shows some increase (45.9 ) (ii). When SA was applied on Au-PtBNPs/CGO/FTO electrode
5
surface, the contact angle decreased (39.5 ) due to the presence of eNH3 and eOH groups in peptide molecules (iii). Afterwards, contact angle further decreased to 28.9 , indicating increase in the hydrophilicity of AptMUC1/SA/Au-PtBNPs/CGO/FTO electrode due to the presence of aptamer (iv). 3.3. Electrochemical characterization of modified FTO electrode CV, DPV and EIS studies were selected for the electrochemical characterization of modified electrode surface after each fabrication step. CV measurements were taken in a potential range from 0.6 V to 1.0 V at a scan rate of 50 mV s1 and step potential 0.02 v using ferri-ferro solution, as shown in Fig. 4A. The CGO modified FTO electrode showed a very small peak current (2.06 104 A) due to the presence of negatively charged layer of carboxylic acid groups (curve i). The electron transfer property of the sensing interface was improved by electrochemically depositing bimetallic nanoparticles of gold and platinum on CGO/FTO electrode surface and peak current increased to 5.32 104 A (curve ii). Immobilization of SA molecules on the surface of electrode resulted in decreased current response (4.69 104 A) (curve iii) due to less conducting nature of streptavidin. After the immobilization of aptamer, current response decreased to 4.09 104 A (curve iv), due to the presence of negatively charged phosphate backbone which repelled the redox probe. Similarly, binding of MUC1 protein on aptaelectrode surface was confirmed with further decrease in the current response (3.45 104 A) (curve v). This is
Fig. 3. (A) FT-IR spectra and (B) contact angle measurements of (i) CGO (ii) Au-PtBNPs/CGO (iii) SA/Au-PtBNPs/CGO and (iv) AptMUC1/SA/Au-PtBNPs/CGO coated FTO electrodes.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
6
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
Fig. 4. Electrochemical responses (A) CV and (B) EIS spectra of (i) CGO/FTO (ii) Au-PtBNPs/CGO/FTO (iii) SA/Au-PtBNPs/CGO/FTO (iv) AptMUC1/SA/Au-PtBNPs/CGO/FTO and (v) MUC1 treated AptMUC1/SA/Au-PtBNPs/CGO/FTO in 50 mM PBS (pH-7.0, 0.9%NaCl) containing 5 mM [Fe(CN)6]3-/4-.
due to the formation of aptamer-target 3D complex blocking the flow of electrons between the electrode and [Fe(CN)6]3-/4- solution. In this study, [Fe(CN)6]3-/4- is used as a redox probe indicator, which undergoes some reduction oxidation cycles when potential is applied in an electrochemical cell. The presence of negatively charged phosphates in aptamer sequence and large size of MUC1 could efficiently block the electron transfer from the negatively charged [Fe(CN)6]3-/4- redox probe, thus leads to a significant decrease in the electrochemical signal. A similar trend to the CV measurements was observed in case of DPV studies (Fig. S1). Briefly, the Au-PtBNPs modified electrode (curve ii) showed enhancement in the peak current in comparison to CGO modified FTO (curve i). Modification on the surface of Au-PtBNPs/CGO/FTO with SA resulted in a decreased peak current (curve iii). There was further decrease in peak current after immobilization of biotin tagged aptamer (curve iv) demonstrating successful immobilization of aptamer. Further interaction with the MUC1 protein, a higher decrease in peak current was observed (curve v). The electrochemical properties of various modified electrodes were also verified by comparing the CV, DPV measurements with the EIS responses. The change in electron transfer resistance (Rct) of CGO/FTO, Au-PtBNPs/CGO/FTO, SA/Au-PtBNPs/CGO/FTO, AptMUC1/SA/Au-PtBNPs/CGO/FTO and MUC1 coated aptaelectrode was determined by nyquist plot, as shown in Fig. 4B. The diameter of semicircle in the plot represents Rct value of electrode surface. Due to the greater electron transfer properties of CGO (curve i) the nyquist plot tends to form semicircle like structure whereas AuPtBNPs (curve ii) exhibited a straight line corresponding to the remarkable conducting nature. The conductivity of Au-PtBNPs/ CGO/FTO electrode decreased with the sequential assembly of SA, AptMUC1 as well as MUC1 and the Rct value increased for the SA/AuPtBNPs/CGO/FTO (curve iii), AptMUC1/SA/Au-PtBNPs/CGO/FTO (curve iv) and MUC1 coated aptaelectrode (curve v), respectively. The results obtained in the EIS plot were consistent with the CV and DPV responses confirming the successful synthesis of aptasensor. 3.3.1. Electro-active surface area To calculate the electro-active surface area of modified FTO electrode, CV measurements of each modification was done in PBS
buffer containing 5 mM [Fe(CN)6]3-/4- and 0.9% NaCl within a range of scan rate (10e100 mV s1). Rate of change in the peak currents with the square root of scan rate is given in Fig. S2 for each modified electrode. The slope obtained was utilized to calculate electroactive surface area according to RandleseSevcik equation [44]. 3/
Ipa ¼ 2.69 105 An 2C0Dr
1/2 1/2
v
(1)
Where, Ipa ¼ anodic peak current, A ¼ surface area of the electrode (cm2). n ¼ number of electrons participating in the redox reaction (1), Dr ¼ diffusion coefficient (7.6 106 cm2 s1). C0 ¼ concentration of [Fe(CN)6]3-/4- (5 mol cm3) v ¼ scan rate (V s1) The effective surface of electrode after every modification is given in Table 1. The effective surface area of Au-PtBNPs modified CGO/FTO electrode shows some increase in comparison to CGO/FTO electrode. Afterwards, decrease in effective surface area was observed after further modifications with SA and AptMUC1. The results clearly indicated the cooperative enhanced effects of AuPtBNPs in combination with CGO. 3.4. Optimization of study parameters Various study parameters such as aptamer concentration and incubation time required for MUC1 sensing could affect the performance of developed aptasensor. The current response of varied aptamer concentrations immobilized on SA/Au-PtBNPs/CGO/FTO
Table 1 Effective surface area of FTO electrode after each modification step. S. No.
Sensing platform
Effective surface area
1 2 3 4
CGO/FTO Au-PtBNPs/CGO/FTO SA/Au-PtBNPs/CGO/FTO AptMUC1/SA/Au-PtBNPs/CGO/FTO
0.248 cm2 0.356 cm2 0.308 cm2 0.281 cm2
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
7
was observed (Fig. S3A) and optimum aptamer concentration was found to be 10 mM since no prominent change in the current response was seen afterwards. The influence of incubation time for MUC1 protein detection was also investigated. In Fig. S3B, the DPV peak current decreased with increasing the incubation time (from 5 min to 25 min) due to the formation of strong aptamer protein 3D interaction. However, the current response becomes stable above 25 min of incubation time because of the saturation of binding sites available on electrode surface.
LOD ¼ 3SD/m
3.5. Detection of MUC1 protein
3.6. Selectivity, interference and storage stability
The electrochemical signals of aptasensor coated with a range of MUC1 concentrations were examined by DPV measurements under optimized experimental conditions. As shown in Fig. 5A, the DPV peak current decreased with increasing MUC1 concentration from 1 fM to 100 nM. This is due to the formation of more aptamer target complex which obstruct the electron flow between electrode interface and redox probe. At lowest MUC1 concentration, less amount of aptamer target complex is formed resulting in very less hindrance in the flow of electrons. Thus, the magnitude of peak current was almost equal to bare aptelectrode. Fig. 5B illustrates the rate of change in peak current with respect to MUC1 concentration (1 fM-100 nM). Therefore, a linear calibration plot between the change in peak current and the log of MUC1 protein concentration is given in the inset with a regression equation of:
To evaluate the selectivity of proposed aptasensor, a comparative study between the perfect complementary target protein and non-complementary targets was performed. As demonstrated in Fig. 6A, the current values of aptasensor incubated with mismatched targets are very much similar to the bare aptaelectrode. However, the aptaelectrode exhibited obvious decrease in the current values when incubated with MUC1 as well as the mixture solution. Fig. 6B shows the current response of MUC1 interaction with mutated aptamer sequence immobilized SA/Au-PtBNPs/CGO/ FTO electrode. There was no significant decrease in the DPV signals of the mutated aptamer immobilized SA/Au-PtBNPs/CGO/FTO electrode after incubation with MUC1 (supplementary data, S4 & Fig. S4). These results clearly suggest excellent selectivity of AptMUC1/SA/Au-PtBNPs/CGO/FTO electrode towards target protein, MUC1. The stability of AptMUC1/SA/Au-PtBNPs/CGO/FTO electrode was analysed over 30 days at an interval of 5 days. The fabricated aptaelectrodes were stored at 4 C and subjected to DPV measurements after treating with MUC1 for 25 min. After 5th, 10th, 15th, 20th, 25th and 30th day current responses decreased to 97%, 95%, 93%, 90%, 87% and 84% respectively (Fig. 6C). The results demonstrated good stability of aptasensor up to 15 days as no significant change in the current response was found.
y ¼ 3.83212 105xþ 0.00101 (Correlation coefficient ¼ 0.99915)
(2)
where, x is log of MUC1 concentration (fM) and y is DPV peak current (A). The detection limit as low as 0.79 fM was obtained with wide detection range from 1 fM to 100 nM, calculated from the formula
(3)
where, SD is the standard deviation of blank electrode without target and m is the slope of calibration curve. The results signify that the fabricated aptaelectrode is highly sensitive biosensing platform for the detection of MUC1 protein. The analytical performance of this biosensor was also compared with previously reported electrochemical methods for MUC1 detection as listed in Table 2.
Fig. 5. (A) DPV response of AptMUC1/SA/Au-PtBNPs/CGO coated FTO electrode after incubation with various concentrations of MUC1 (0, 1 fM, 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM and 100 nM) in 50 mM PBS (pH-7.0, 0.9% NaCl) containing 5 mM [Fe(CN)6]3-/4-. (B) Corresponding calibration curve between peak current values and MUC1 concentration (Inset: Linear plot of peak currents vs. log of MUC1 concentration. Error bars represent standard deviation of three measurements).
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
8
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
Table 2 Comparison of present aptasensor with previously reported aptamer based electrochemical biosensors (on the basis of their analytical performances) for the detection of MUC1. Biosensing platform
Detection method
LOD
Linear range
Response time
Ref.
Impedimetric aptasensor based on AuNPs signal amplification Sandwich type aptasensor based on dual signal amplification strategy Detection of MCF-7 cells via free running DNA walker
EIS DPV Chrono-coulometry
0.5e10 nM 1e100 nM 0-500 cells mL1
2h 40 min 25 min
[45] [46] [25]
Aptasensor based on methylene blue electrochemical reduction Sandwich electrochemical aptasensor for the detection of MCF-7 cells AuNPs based electrochemical aptasensor Aptasensor based on coreeshell nanocomposite aZrHCF@mFe3O4@mC
DPV DPV DPV EIS
0.1 nM 1 pM 47 cells mL1 0.6 ng mL1 8 cells mL1 24 nM 0.90 pg mL1
30 min 60 min -
[47] [26] [48] [49]
Electrochemical aptasensor based on exonuclease I-assisted target recycling amplification strategy Aptasensor based on bAuNPs-GO-PEDOT nanocomposite
DPV
0.40 pg mL1
2e20 ng mL1 10-105 cells mL1 50e1000 nM 0.01 ng mL1 -1 mg mL1 1.0 pg mL1 50 ng mL1 1 mg mL1 0.1 fg mL1 100 fg mL1 -1 ng mL1 1 fM-100 nM
60 min
[50]
15 min
[51]
60 min
[27]
25 min
Present work
DPV
0.1 fg mL
1
Aptasensor based on catalytic hairpin assembly coupled with PtPdNPs peroxidase-like Chronoamperometry 16 fg mL1 activity Electrochemical aptasensor based on Au-PtBNPs/CGO nanocomposite and [Fe(CN)6]3-/ DPV 0.79 fM 4signal indicator a b
ZrHCF@mFe3O4@mC: zirconium hexacyanoferrate nanoparticles and mesoporous nanomaterial composed of Fe3O4 and carbon nanospheres. AuNPs-GO-PEDOT: gold nanoparticles and graphene oxide doped poly(3,4-ethylenedioxythiophene).
Fig. 6. Selectivity studies of (A) Fabricated aptasensor for its complementary as well as non-complementary target, (B) Mutated aptamer immobilized SA/Au-PtBNPs/CGO/FTO electrode after interaction with MUC1 and (C) Stability studies of the aptasensor at every 5th day, after storage up to 30 days.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
9
Fig. 7. (A) Reproducibility studies of seven independent electrodes for 10 pM and 10 nM of MUC1 concentration, respectively and (B) Reusability studies of the aptaelectrode after regeneration up to 8 times.
3.7. Reproducibility and reusability studies The aptasensor was also utilized to access its reproducibility for two different MUC1 concentrations. Fig. 7A displays the DPV responses of seven different electrodes for 10 pM and 10 nM and exhibited a RSD of 0.48% and 2.5%, respectively. Finally, the DPV responses obtained before and after the regeneration of aptaelectrode were compared for each measurement. As shown in Fig. 7B, there is 83% decrease in current response after 3rd regeneration indicating that the aptasensor worked efficiently up to 3 times. 3.8. Real sample analysis The current response of the AptMUC1/SA/Au-PtBNPs/CGO/FTO electrode incubated with different concentrations (1-1 104 fM) of MUC1 standard solution as well as spiked serum samples was used to calculate the % age recovery. The recoveries obtained from various spiked serum samples ranged from 92.47% to 97.5% summarized in Table 3. The relative standard deviation ranging from 1.78% to 3.41% suggested practical applicability of the developed MUC1 based aptasensor in real samples. 4. Conclusions An effective electrochemical aptasensor was constructed by depositing target selective biotinylated aptamer on the surface of streptavidin coated Au-PtBNPs/CGO/FTO as immobilization platform for detecting a breast cancer biomarker, MUC1. In the
biosensing platform, eCOOH functionalized GO was used in the immobilization of streptavidin for further interaction with biotinylated aptamer and Au-PtBNPs were used to enhance the electrical conductivity of the electrode surface. The proposed aptasensor had high selectivity towards MUC1 protein with a very low detection limit of 0.79 fM and wide linear range from 1 fM to 100 nM. It also showed good recovery range (92%e97%) in spiked serum samples. The aptaelectrode provides a simple, selective and ultrasensitive assay for the analysis of MUC1 protein, indicating it as a significant platform for point of care diagnosis of breast cancer. Furthermore, the fabrication methodology can also be utilized to detect other protein biomarkers. Also the applicability of presented biosensor in real sample analysis could improve the diagnostic field with rapid, cost effective and minimally invasive approach. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgements The research was financial supported by DST-SERB [EEQ/2017/ 000239], DST-Purse II and Special Assistance Programme (UGCSAP) [F.4-7/2015/DRS-III (SAP-II)]. Central instrument laboratory is highly acknowledged for using the FE-SEM facility. I also want to thank and acknowledge CSIR for providing the award of fellowship [09/135(0729)/2016-EMR-I]. Appendix A. Supplementary data
Table 3 Recoveries obtained for MUC1 in spiked serum samples (n ¼ 3). Sample No.
Added (fM)
Found (fM)
Recovery (%)
RSD (%)
1 2 3 4 5
1 1 101 1 102 1 103 1 104
0.939 9.75 96.53 925.16 9379.76
93.9 97.5 96.53 92.47 93.8
3.2 1.78 1.79 3.41 2.86
Supplementary data to this article can be found online at https://doi.org/10.1016/j.aca.2019.11.005. References [1] A. Jemal, F. Bray, M.M. Center, J. Ferlay, E. Ward, D. Forman, Global cancer statistics, CA A Cancer J. Clin. 61 (2) (2011) 69e90.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
10
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
[2] F. Bray, J. Ferlay, I. Soerjomataram, R.L. Siegel, L.A. Torre, A. Jemal, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA A Cancer J. Clin. 68 (6) (2018) 394e424. [3] J. Ferlay, I. Soerjomataram, R. Dikshit, S. Eser, C. Mathers, M. Rebelo, D.M. Parkin, D. Forman, F. Bray, Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012, Int. J. Cancer 136 (5) (2015) E359eE386. [4] P.G.C. Selwyna, P.R. Loganathan, K.H. Begam, Development of electrochemical biosensor for breast cancer detection using gold nanoparticle doped CA 15-3 antibody and antigen interaction, 2013 International Conference on Signal Processing, Image Proc. Pattern Recognit. (2013) 75e81. [5] M. Hasanzadeh, N. Shadjou, M. de la Guardia, Early stage screening of breast cancer using electrochemical biomarker detection, Trac. Trends Anal. Chem. 91 (2017) 67e76. [6] L. Farzin, M. Shamsipur, Recent advances in design of electrochemical affinity biosensors for low level detection of cancer protein biomarkers using nanomaterial-assisted signal enhancement strategies, J. Pharm. Biomed. Anal. 147 (2018) 185e210. [7] M. Shimizu, K. Yamauchi, Isolation and characterization of mucin-like glycoprotein in human milk fat globule membrane, J. Biochem. 91 (2) (1982) 515e524. [8] S. Nath, P. Mukherjee, MUC1: a multifaceted oncoprotein with a key role in cancer progression, Trends Mol. Med. 20 (6) (2014) 332e342. [9] R. Hu, W. Wen, Q. Wang, H. Xiong, X. Zhang, H. Gu, S. Wang, Novel electrochemical aptamer biosensor based on an enzyme-gold nanoparticle dual label for the ultrasensitive detection of epithelial tumour marker MUC1, Biosens. Bioelectron. 53 (2014) 384e389. [10] M.A. Nawaz, S. Rauf, G. Catanante, M.H. Nawaz, G. Nunes, J.L. Marty, A. Hayat, One Step Assembly of Thin Films of Carbon Nanotubes on Screen Printed Interface for Electrochemical Aptasensing of Breast Cancer Biomarker, Sensors, Basel, 2016, 16(10). [11] J.Z. Zaretsky, I. Barnea, Y. Aylon, M. Gorivodsky, D.H. Wreschner, I. Keydar, MUC1 gene overexpressed in breast cancer: structure and transcriptional activity of the MUC1 promoter and role of estrogen receptor alpha (ERalpha) in regulation of the MUC1 gene expression, Mol. Cancer 5 (2006) 57. [12] S.N. Topkaya, M. Azimzadeh, M. Ozsoz, Electrochemical biosensors for cancer biomarkers detection: recent advances and challenges, Electroanalysis 28 (7) (2016) 1402e1419. [13] J.F. Rusling, C.V. Kumar, J.S. Gutkind, V. Patel, Measurement of biomarker proteins for point-of-care early detection and monitoring of cancer, Analyst 135 (10) (2010) 2496e2511. [14] K. Wang, D. Fan, Y. Liu, E. Wang, Highly sensitive and specific colorimetric detection of cancer cells via dual-aptamer target binding strategy, Biosens. Bioelectron. 73 (2015) 1e6. [15] L. Ribovski, V. Zucolotto, B.C. Janegitz, A label-free electrochemical DNA sensor to identify breast cancer susceptibility, Microchem. J. 133 (2017) 37e42. [16] S. Atay, K. Pis¸kin, F. Yılmaz, C. Çakır, H. Yavuz, A. Denizli, Quartz crystal microbalance based biosensors for detecting highly metastatic breast cancer cells via their transferrin receptors, Anal. Methods 8 (1) (2016) 153e161. [17] F. Fathi, M.-R. Rashidi, Y. Omidi, Ultra-sensitive detection by metal nanoparticles-mediated enhanced SPR biosensors, Talanta 192 (2019) 118e127. [18] K. Mahato, B. Purohit, K. Bhardwaj, A. Jaiswal, P. Chandra, Novel electrochemical biosensor for serotonin detection based on gold nanorattles decorated reduced graphene oxide in biological fluids and in vitro model, Biosens. Bioelectron. 142 (2019), 111502. [19] X. Wang, J. Su, D. Zeng, G. Liu, L. Liu, Y. Xu, C. Wang, X. Liu, L. Wang, X. Mi, Gold nano-flowers (Au NFs) modified screen-printed carbon electrode electrochemical biosensor for label-free and quantitative detection of glycated hemoglobin, Talanta 201 (2019) 119e125. [20] Y. Yang, Y. Fu, H. Su, L. Mao, M. Chen, Sensitive detection of MCF-7 human breast cancer cells by using a novel DNA-labeled sandwich electrochemical biosensor, Biosens. Bioelectron. 122 (2018) 175e182. [21] X. Ma, Y. Jiang, F. Jia, Y. Yu, J. Chen, Z. Wang, An aptamer-based electrochemical biosensor for the detection of Salmonella, J. Microbiol. Methods 98 (2014) 94e98. [22] S. Eissa, M. Zourob, In vitro selection of DNA aptamers targeting b-lactoglobulin and their integration in graphene-based biosensor for the detection of milk allergen, Biosens. Bioelectron. 91 (2017) 169e174. [23] G. Figueroa-Miranda, L. Feng, S.C.-C. Shiu, R.M. Dirkzwager, Y.-W. Cheung, €ning, A. Offenha €usser, D. Mayer, Aptamer-based elecJ.A. Tanner, M.J. Scho trochemical biosensor for highly sensitive and selective malaria detection with adjustable dynamic response range and reusability, Sens. Actuators B Chem. 255 (2018) 235e243. [24] M. Kimoto, M. Nakamura, I. Hirao, Post-ExSELEX stabilization of an unnaturalbase DNA aptamer targeting VEGF165 toward pharmaceutical applications, Nucleic Acids Res. 44 (15) (2016) 7487e7494. [25] S. Cai, M. Chen, M. Liu, W. He, Z. Liu, D. Wu, Y. Xia, H. Yang, J. Chen, A signal amplification electrochemical aptasensor for the detection of breast cancer cell via free-running DNA walker, Biosens. Bioelectron. 85 (2016) 184e189. [26] K. Wang, M.Q. He, F.H. Zhai, R.H. He, Y.L. Yu, A novel electrochemical biosensor based on polyadenine modified aptamer for label-free and ultrasensitive
detection of human breast cancer cells, Talanta 166 (2017) 87e92. [27] R.-N. Zhao, Z. Feng, Y.-N. Zhao, L.-P. Jia, R.-N. Ma, W. Zhang, L. Shang, Q.W. Xue, H.-S. Wang, A sensitive electrochemical aptasensor for Mucin 1 detection based on catalytic hairpin assembly coupled with PtPdNPs peroxidase-like activity, Talanta 200 (2019) 503e510. [28] G. Eda, M. Chhowalla, Chemically derived graphene oxide: towards large-area thin-film electronics and optoelectronics, Adv. Mater. 22 (22) (2010) 2392e2415. [29] Q.B. Zheng, Z.G. Li, J.H. Yang, J.K. Kim, Graphene oxide-based transparent conductive films, Prog. Mater. Sci. 64 (2014) 200e247. [30] Q. Wang, B.T. Wang, Surface plasmon resonance biosensor based on graphene oxide/silver coated polymer cladding silica fiber, Sens. Actuators B Chem. 275 (2018) 332e338. [31] J.B. Li, Y.H. Wang, Y.L. Sun, C.F. Ding, Y.N. Lin, W.Y. Sun, C.N. Luo, A novel ionic liquid functionalized graphene oxide supported gold nanoparticle composite film for sensitive electrochemical detection of dopamine, RSC Adv. 7 (4) (2017) 2315e2322. [32] H.M. Albishri, D. Abd El-Hady, Hyphenation of enzyme/graphene oxide-ionic liquid/glassy carbon biosensors with anodic differential pulse stripping voltammetry for reliable determination of choline and acetylcholine in human serum, Talanta 200 (2019) 107e114. [33] Y. Wang, F.G. Zhai, Y. Hasebe, H.M. Jia, Z.Q. Zhang, A highly sensitive electrochemical biosensor for phenol derivatives using a graphene oxidemodified tyrosinase electrode, Bioelectrochemistry 122 (2018) 174e182. [34] G. Aydogdu Tig, Highly sensitive amperometric biosensor for determination of NADH and ethanol based on Au-Ag nanoparticles/poly(L-Cysteine)/reduced graphene oxide nanocomposite, Talanta 175 (2017) 382e389. [35] R. Mandal, A. Baranwal, A. Srivastava, P. Chandra, Evolving trends in bio/ chemical sensor fabrication incorporating bimetallic nanoparticles, Biosens. Bioelectron. 117 (2018) 546e561. [36] U. Jain, S. Gupta, N. Chauhan, Construction of an amperometric glycated hemoglobin biosensor based on Au-Pt bimetallic nanoparticles and poly (indole5-carboxylic acid) modified Au electrode, Int. J. Biol. Macromol. 105 (Pt 1) (2017) 549e555. [37] C.S. Ferreira, K. Papamichael, G. Guilbault, T. Schwarzacher, J. Gariepy, S. Missailidis, DNA aptamers against the MUC1 tumour marker: design of aptamer-antibody sandwich ELISA for the early diagnosis of epithelial tumours, Anal. Bioanal. Chem. 390 (4) (2008) 1039e1050. [38] C.Y. Lee, Q.V. Le, C. Kim, S.Y. Kim, Use of silane-functionalized graphene oxide in organic photovoltaic cells and organic light-emitting diodes, Phys. Chem. Chem. Phys. 17 (14) (2015) 9369e9374. [39] A. Bharti, N. Agnihotri, N. Prabhakar, A voltammetric hybridization assay for microRNA-21 using carboxylated graphene oxide decorated with goldplatinum bimetallic nanoparticles, Microchim. Acta 186 (3) (2019) 185. [40] M.F. Hossain, J.Y. Park, Plain to point network reduced graphene oxideactivated carbon composites decorated with platinum nanoparticles for urine glucose detection, Sci. Rep. 6 (2016), 21009. [41] A. Barth, Infrared spectroscopy of proteins, Biochim. Biophys. Acta 1767 (9) (2007) 1073e1101. [42] N. Prabhakar, H. Thakur, A. Bharti, N. Kaur, Chitosan-iron oxide nanocomposite based electrochemical aptasensor for determination of malathion, Anal. Chim. Acta 939 (2016) 108e116. [43] C.D. Kanakis, S. Nafisi, M. Rajabi, A. Shadaloi, P.A. Tarantilis, M.G. Polissiou, J. Bariyanga, H.A. Tajmir-Riahi, Structural analysis of DNA and RNA interactions with antioxidant flavonoids, Spectroscopy 23 (1) (2009). [44] A. Profumo, M. Fagnoni, D. Merli, E. Quartarone, S. Protti, D. Dondi, A. Albini, Multiwalled carbon nanotube chemically modified gold electrode for inorganic as speciation and Bi(III) determination, Anal. Chem. 78 (12) (2006) 4194e4199. [45] X. Liu, Y. Qin, C. Deng, J. Xiang, Y. Li, A simple and sensitive impedimetric aptasensor for the detection of tumor markers based on gold nanoparticles signal amplification, Talanta 132 (2015) 150e154. [46] X. Chen, Q. Zhang, C. Qian, N. Hao, L. Xu, C. Yao, Electrochemical aptasensor for mucin 1 based on dual signal amplification of poly(o-phenylenediamine) carrier and functionalized carbon nanotubes tracing tag, Biosens. Bioelectron. 64 (2015) 485e492. [47] B. Ciui, M. Tertis, D. Peia, C. Cristea, R. Sandulescu, Graphene oxide modified aptasensor for the mucin 1 detection, Farmacia 64 (1) (2016) 43e47. [48] J.H. Song, Y. Zhou, B. Chen, W.S. Lou, J.P. Gu, Development of electrochemical aptamer biosensor for tumor marker MUC1 determination, Int. J. Electrochem. Sci. 12 (6) (2017) 5618e5627. [49] M. Wang, B. Hu, H. Ji, Y. Song, J. Liu, D. Peng, L. He, Z. Zhang, Aptasensor based on hierarchical core-shell nanocomposites of zirconium hexacyanoferrate nanoparticles and mesoporous mFe3O4@mC: electrochemical quantitation of epithelial tumor marker mucin-1, ACS Omega 2 (10) (2017) 6809e6818. [50] C. Lin, H. Zheng, Y. Huang, Z. Chen, F. Luo, J. Wang, L. Guo, B. Qiu, Z. Lin, H. Yang, Homogeneous electrochemical aptasensor for mucin 1 detection based on exonuclease I-assisted target recycling amplification strategy, Biosens. Bioelectron. 117 (2018) 474e479. [51] P. Gupta, A. Bharti, N. Kaur, S. Singh, N. Prabhakar, An electrochemical aptasensor based on gold nanoparticles and graphene oxide doped poly(3,4ethylenedioxythiophene) nanocomposite for detection of MUC1, J. Electroanal. Chem. 813 (2018) 102e108.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
Contents lists available at ScienceDirect
Analytica Chimica Acta journal homepage: www.elsevier.com/locate/aca
An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide Anu Bharti a, Shilpa Rana a, Divya Dahiya b, Navneet Agnihotri a, Nirmal Prabhakar a, * a b
Department of Biochemistry, Panjab University, Chandigarh, India Department of Surgery, Postgraduate Institute of Medical Education and Research, Chandigarh, India
h i g h l i g h t s
g r a p h i c a l a b s t r a c t
Aptamer based electrochemical biosensor for detection of MUC1 protein has been reported. This method employs AuePt bimetallic nanoparticles deposited carboxylated graphene oxide as biosensing platform. MUC1 can be detected efficiently upto 0.79 fM with a linear range 1 fM-100 nM. Spiked human serum samples were evaluated for MUC1 detection with recovery range from 92% to 97%.
a r t i c l e i n f o
a b s t r a c t
Article history: Received 6 August 2019 Received in revised form 1 November 2019 Accepted 2 November 2019 Available online xxx
A simple electrochemical strategy has been designed for the analysis of MUC1 using electrodeposited gold platinum bimetallic nanoparticles (Au-PtBNPs) on the surface of carboxylated graphene oxide (CGO)/FTO electrode as a signal amplification platform. The carboxylic groups of CGO were activated with EDS-NHS linker and subsequently immobilized with streptavidin for further deposition of biotin labelled aptamer. All the modification steps were characterized by FE-SEM, EDS mapping, FT-IR, contact angle measurements and electrochemical methods. After incubating with target protein MUC1, the aptaelectrode produced some concentration dependent responses which were measured electrochemically by DPV assay. The prepared aptasensor exhibits wide linear range from 1 fM-100 nM with detection limit of 0.79 fM under optimal experimental conditions. The performance of this aptaelectrode was also evaluated showing good selectivity, storage stability (15 days), reproducibility and reusability (up to 3 times). Furthermore, the applicability of the aptasensor for spiked serum samples showed recovery range from 92% to 97%. © 2019 Elsevier B.V. All rights reserved.
Keywords: MUC1 Electrochemical aptasensor Bimetallic nanoparticles Carboxylated graphene oxide Breast cancer
1. Introduction
* Corresponding author. E-mail addresses: [email protected], (N. Prabhakar).
[email protected]
Breast cancer is the most commonly diagnosed cancer amongst women worldwide and is the second leading cause of cancer related deaths [1,2]. In the year 2012, approximately 1 million new cases and more than 5,00,000 deaths occurred due to breast cancer
https://doi.org/10.1016/j.aca.2019.11.005 0003-2670/© 2019 Elsevier B.V. All rights reserved.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
2
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
[3]. Mammography, ultrasound, X-ray, MRI and tissue biopsy are frequently used conventional screening techniques that have significantly reduced the mortality rates of breast cancer patients. But these techniques are associated with very low sensitivity and selectivity with false positive results [4]. Therefore, highly sensitive and minimally invasive detection methods are highly needed for the management of cancer screening as well as treatment strategies. Glycoprotein biomarkers which are highly expressed in breast cancer patients includes CA15-3, HER-2, BRCA-1,2 and MUC1 [5,6]. Mucin1 (MUC1) is a high molecular weight trans-membrane glycoprotein present on the apical surfaces of epithelial cells [7]. It provides protection to the underlying epithelia from various mechanical, chemical and biological damages and also involved in the signal transduction pathways. Aberrant glycosylation and overexpression of MUC1 protein play crucial role in the development of different type of cancers [8,9]. Increased level of MUC1 at the early stages of breast cancer could make it a useful diagnostic biomarker as well as therapeutic target [10,11]. Routinely used methods for MUC1 detection are ELISA, IHC, northern blotting and PCR. These previously reported detection methods are very costly, time consuming and require skilled laboratory person for instrument handling [12,13]. So, biosensors are considered as better alternatives due to its ease of use, cost effectiveness and quick response which could efficiently meet the needs of patients. Many researchers have explored different biosensing methods for cancer detection based on colorimetry [14], electrochemistry [15], piezoelectric sensing [16] and optical measurements [17]. Electrochemical approaches are found to be the most promising alternative in biological sensing due to its cost effectiveness, ease of use, rapid response, high sensitivity and selectivity [18e20]. In the recent years, aptamers as bio-recognition element have been widely used for the detection of various target analytes [21e23]. Aptamers are single stranded nucleic acids synthesized by SELEX method [24]. They undergo some conformational changes after interaction with its target resulting in some measurable responses. Since, aptamer exhibit unique features like easy to synthesize, stability against denaturation, high sensitivity and selectivity suggesting a good alternative to antibodies. To date, many electrochemical aptasensors have been designed for the detection of MUC1, of which some are discussed in detail. Cai et al., constructed a signal amplification aptasensor for the detection of breast cancer cells via free running DNA walker with detection limit of 47 cells mL1 [25]. Wang et al., reported a sandwich electrochemical biosensor for the detection of human breast cancer cells (MCF-7) using polyadenine-aptamer. The biosensor was constructed by hybridizing the MCF-7 cells with polyadenine-aptamer modified gold electrode on one side and polyA-aptamer functionalized AuNPs/GO hybrid on other side to improve the electrochemical response. A detection limit 8 cells mL1 was observed with a linear range of 10-105 cells mL1 [26]. Recently, on the basis of target induced catalytic hairpin assembly combined with PtPdNPs (having peroxidase-like activity), an electrochemical aptasensor was reported for MUC1 detection. The biosensor showed detection limit of about 16 fg mL1 with a linear range of 100 fg mL1-1 ng mL1 [27]. For the immobilization of these aptamer sequences some suitable matrix materials are introduced to the biosensing platform for convenient detection of target molecules. Graphene oxide (GO) has been enormously used in the field of biosensors due to the presence of wide functionality, very high surface to volume ratio, chemical stability, mechanical strength, fast electron transport and excellent biocompatibility [28e31]. The oxygen containing functional groups present on the surface of graphene oxide could make an ideal platform for the immobilization of biomolecules on its surface
[32,33]. Moreover, researchers have focused on the use of bimetallic nanoparticle based approaches to enhance the sensitivity level of biosensors [34,35]. Considering all this, we aimed to prepare a biosensing platform using carboxylated graphene oxide (CGO) coated with gold-platinum bimetallic nanoparticles (Au-PtBNPs) on its surface. The prepared biosensing platform was explored for electrochemical detection of MUC1 protein using biotin tagged aptamer as a recognition element. The eCOOH modification on the surface of GO nanosheets renders a better fabrication platform for the immobilization of biomolecules. The synergistic effect of both the metal nanoparticles shows unique optical, catalytic and electrochemical properties compared to the corresponding monometallic nanoparticles [36]. The size and shape of bimetallic nanoparticles could be modified accordingly based on the methodology and conditions provided for their preparation. The electrodeposited Au-PtBNPs showed uniform distribution on the surface of CGO which has greatly improved the analytical response of developed biosensor. 2. Experimental 2.1. Materials and apparatus MUC1 protein was purchased from Biolink, India. The biotinylated aptamer sequence, FTO (fluorine tin Oxide) sheets, graphite powder, 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), N-hydroxysuccinimide (NHS), chloroauric acid (HAuCl4), chloroplatinic acid (H2PtCl6) and streptavidin were purchased from Sigma-Aldrich, USA (www.sigmaaldrich.com). Sodium sulphate (Na2SO4), Sodium chloride (NaCl), sodium hydroxide (NaOH), tris buffer, ethylene diamine tetra acetic acid (EDTA), potassium ferrocyanide trihydrate (K4Fe(CN)6.3H2O) and potassium ferricyanide (K3Fe(CN)6) were purchased from HiMedia Laboratory Pvt. Ltd., Mumbai, India (www.himedialabs.com). Mono-sodium phosphate (NaH2PO4.2H2O) and di-sodium phosphate (Na2HPO4) were purchased from Thermo Fisher Scientific Pvt. Ltd., Mumbai, India (www.thermofisher.com). Different concentrations of aptamer were prepared in TE buffer, whereas PBS was used to make different concentrations of MUC1 protein. PBS buffer containing 5 mM [Fe(CN)6]3-/4- and 0.9% NaCl was used to perform various electrochemical studies. All the reagents used in the study were of analytical grade. Autoclaved buffer solutions were used throughout the experimental work. The 72mer biotinylated aptamer sequence used in this study was chosen from previously reported paper [37]. MUC1 aptamer sequence- [50 -Btn GGGAGACAAGAATAAACGCTCAAGCAGTTGATCCTTTGGATACCCTGGTTCGACAGGAGGCTCACAACAGGC-3’] Mutated aptamer sequence- [50 -Btn GGGAGACAAGAATAAACGCTCAAGCAGATGATCCTTTAGATACCCTGGTTCGACAGGAGGCTCACAACAGGC-3’] FE-SEM (Field Emission-Scanning Electron Microscopy) imaging and EDS (Energy Dispersive X-ray Spectroscopy) mapping were done with Hitachi SU8000 microscope. The FT-IR (Fourier Transform Infrared Spectroscopy) spectra were obtained from PerkinElmer [DB-01]. Contact angles measurements were performed on sessile drop using KRUSS apparatus. All the electrochemical measurements were performed using an electrochemical work station AutoLab 302NFRA32 M, Metrohm-Autolab Instruments, Netherlands.The instrument configuration consist of three electrodes, with modified FTO as working electrode, Ag/AgCl as reference and Pt as the counter electrode.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
2.2. Preparation of aptaelectrode (AptMUC1/SA/Au-PtBNPs/CGO/FTO) The synthesis of graphene oxide was done according to modified Hummer’s method [38]. The process of carboxylation was followed as discussed in our previous paper [39]. The electrode was prepared by applying 15 ml of CGO solution (5 mg mL1) on the surface of FTO coated glass film. After drying, gold-platinum bimetallic nanoparticles were electro-polymerized on its surface by applying 0.2 V potential for 350 s using chronoamperometry. The prepared nanocomposite coated FTO electrode was than incubated with EDC-NHS for 150 min to activate -carboxylic moieties present at the surface of graphene oxide sheets. 0.05 mg mL1 of streptavidin (SA) solution prepared in PBS buffer was drop casted on the electrode surface. The eNH2 moieties of SA molecule interact with the carboxylic groups of CGO by eCOeNH- bonding. Further, SA coated electrode surface was incubated with 10 mL of biotinylated aptamer solution and stored at 4 C prior to use. SA binds to the biotin tagged aptamer sequence through biotin-avidin strong interaction making the aptaelectrode surface more stable for interaction with target molecule. The fabrication strategy employed for the development of presented aptasensor has been depicted in Fig. 1.
2.3. Characterization and optimization parameters Various modifications done on FTO electrode surface were characterized to confirm successful development of the aptasensor. FE-SEM imaging was done to check the morphological appearance of the modified electrodes whereas Energy Dispersive X-ray Spectroscopy (EDS) mapping was done for elemental analysis of the electrode surfaces. The functional groups present on electrode surface and hydrophilic nature of different fabricated materials was detected by FT-IR analysis and contact angle measurements, respectively. Cyclic voltammetry (CV), differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS) was performed to analyse the electrochemical behaviour of modified FTO electrodes. The analytical parameters for the detection of MUC1 using the aptasensor in terms of aptamer concentration and incubation time
3
were optimized. In order to evaluate the effect of aptamer concentration, SA/Au-PtBNPs/CGO/FTO electrode was incubated with varying amount of AptMUC1 (2e15 mM) and corresponding DPV response was taken. Further, the effect of incubation time on the binding efficiency of aptaelectrode for the detection of MUC1 protein was investigated. The DPV response of AptMUC1/SA/AuPtBNPs/CGO/FTO was measured after incubating with MUC1 protein for a series of time interval (5e30 min). 2.4. Detection of MUC1 protein The efficacy of aptasensor to detect varying concentration of MUC1 protein was examined under optimized experimental conditions. AptMUC1/SA/Au-PtBNPs/CGO/FTO was incubated with increased MUC1 concentration from 1 fM to 100 nM for 25 min. Followed by washing with PBS to eliminate the loosely bound protein molecules and DPV current responses were measured to calculate the limit of detection. 2.5. Selectivity, interference and storage stability of the aptasensor Different types of non-complementary targets tested with the aptasensor to evaluate the selectivity include BSA, MPT64 protein (M. tuberculosis surface antigen) and glucose. A mutated aptamer sequence (two base mismatch) was also applied on the SA/AuPtBNPs/CGO/FTO electrode and used for MUC1 detection. The AptMUC1/SA/Au-PtBNPs/CGO/FTO electrode was incubated with different targets for 25 min at a concentration of 1 mg mL1. Interference of various molecules was also tested by treating the aptaelectrode with mixture of non-complementary molecules present along with MUC1 protein. The non-selective targets were washed off in PBS and DPV measurements were taken. Furthermore, the stability of aptaelectrode was also evaluated up to 30 days at an interval of 5 days. 2.6. Reproducibility, regeneration and reusability assay The reproducibility of aptasensor was also assessed by applying
Fig. 1. Schematic illustration of the fabricated aptasensor.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
4
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
10 pM and 10 nM of MUC1 protein on the surface of two sets of seven different electrodes, respectively. Additionally, the regeneration efficiency of fabricated aptasensor was also investigated. The aptamer immobilized electrode was regenerated by incubating the electrodes with 10 mM of NaOH solution for 10 min and rinsed off with PBS. The DPV response of aptaelectrode was measured after each regeneration step. 2.7. Spike-in studies To demonstrate the potential application of developed AptMUC1/ SA/Au-PtBNPs/CGO/FTO electrode for MUC1 detection, human serum was used. Known concentration of standard MUC1 solution (1 fM, 1 101 fM, 1 102 fM, 1 103 fM and 1 104 fM) was spiked in 10% (V/V) human serum sample and incubated on the surface of aptaelectrode for 25 min. Finally, the electrodes were rinsed with PBS and used for DPV measurements as mentioned above. 3. Results and discussion
FTO) as well as biotinylated aptamer (AptMUC1/SA/Au-PtBNPs/CGO/ FTO) on its surface by FE-SEM imaging. CGO nanosheets coated on FTO electrode showed wrinkled and crumpled morphology (i). After the electro-deposition of Au-PtBNPs, uniform distribution of round shaped nanoparticles emerged on the surface of CGO was seen (ii). The carboxylic groups present on CGO surface was activated by applying EDC-NHS so as to bind the amine groups present in streptavidin molecule through strong CHeNH linkage. In Fig. 2A (iii), smooth globular appearance on the electrode surface confirmed the binding of SA molecules. Moreover, biotin tagged aptamer incubated on its surface changed the pattern to condensed globular morphology (iv). Thus, the FE-SEM imaging successfully confirmed the immobilization of various molecules on electrode surface. The elementary composition of the fabricated materials (CGO and Au-PtBNPs/CGO), coated on FTO electrode surface was also characterized by EDS mapping analysis. The characteristic peaks of C and O present in CGO/FTO confirmed the presence of carboxylic moieties available for further linkage (Fig. 2B (i)). The electrochemically deposited Au and Pt showed their respective peaks with homogenous distribution on CGO sheets, which could be seen in Fig. 2B (ii).
3.1. FE-SEM and EDS mapping Fig. 2A shows the surface morphology of as prepared CGO/FTO, AuePt bimetallic nanoparticles coated CGO/FTO and further modifications steps done by applying streptavidin (SA/Au-PtBNPs/CGO/
3.2. FT-IR spectra and contact angle measurements The FT-IR spectra of CGO/FTO, Au-PtBNPs/CGO/FTO, SA/Au-
Fig. 2. (A) FE-SEM images of (i) CGO (ii) Au-PtBNPs/CGO (iii) SA/Au-PtBNPs/CGO and (iv) AptMUC1/SA/Au-PtBNPs/CGO coated FTO electrodes. (B) EDS spectra of (i) CGO/FTO & (ii) Au-PtBNPs/CGO/FTO.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
PtBNPs/CGO/FTO and AptMUC1/SA/Au-PtBNPs/CGO/FTO are given in Fig. 3A. In the IR spectra of CGO, the peaks at 1030 cm1, 1220 cm1, 1360 cm1, 1570 cm1, 1740 cm1 and 3330 cm1 corresponds to the stretching vibrations of CeO, CeOH, OeH, C]C, C]O and eOH, respectively (i) [40]. After coating Au-PtBNPs, only the peaks corresponding to CGO was found with no characteristic peak for bimetallic nanoparticles (ii). The peaks for amide groups, 1670 cm1 (-CONH stretch of amide I) and 1590 cm1 (CeN stretch of amide II) were appeared after the immobilization of streptavidin on the surface of Au-PtBNPs/CGO/FTO electrode (iii) [41,42]. In the AptMUC1 coated SA/Au-PtBNPs/CGO/FTO electrode (iv), the peaks at 1630 cm1 attributed to the presence of thymine in single stranded DNA. The other peaks at 1330 cm1 and 1110 cm1 indicated the presence of C]C and C]N stretch of the pyrimidine and purines, whereas, the peaks at 1010 cm1 and 851 cm1 are due to the presence of phosphate groups and deoxyribose ring vibrations, respectively [43]. The contact angle measurements were done to study the hydrophilic nature of different fabricated materials on the surface of FTO electrode. Fig. 3B shows the contact angle images of various modified electrodes (i) CGO/FTO (ii) Au-PtBNPs/CGO/FTO (iii) SA/ Au-PtBNPs/CGO/FTO and (iv) AptMUC1/SA/Au-PtBNPs/CGO/FTO. Due to the presence of oxygen containing functional groups in CGO, the hydrophilicity of electrode increased showing contact angle of about 18.3 (i). After coating Au-PtBNPs on CGO/FTO, the hydrophilicity decreased and contact angle shows some increase (45.9 ) (ii). When SA was applied on Au-PtBNPs/CGO/FTO electrode
5
surface, the contact angle decreased (39.5 ) due to the presence of eNH3 and eOH groups in peptide molecules (iii). Afterwards, contact angle further decreased to 28.9 , indicating increase in the hydrophilicity of AptMUC1/SA/Au-PtBNPs/CGO/FTO electrode due to the presence of aptamer (iv). 3.3. Electrochemical characterization of modified FTO electrode CV, DPV and EIS studies were selected for the electrochemical characterization of modified electrode surface after each fabrication step. CV measurements were taken in a potential range from 0.6 V to 1.0 V at a scan rate of 50 mV s1 and step potential 0.02 v using ferri-ferro solution, as shown in Fig. 4A. The CGO modified FTO electrode showed a very small peak current (2.06 104 A) due to the presence of negatively charged layer of carboxylic acid groups (curve i). The electron transfer property of the sensing interface was improved by electrochemically depositing bimetallic nanoparticles of gold and platinum on CGO/FTO electrode surface and peak current increased to 5.32 104 A (curve ii). Immobilization of SA molecules on the surface of electrode resulted in decreased current response (4.69 104 A) (curve iii) due to less conducting nature of streptavidin. After the immobilization of aptamer, current response decreased to 4.09 104 A (curve iv), due to the presence of negatively charged phosphate backbone which repelled the redox probe. Similarly, binding of MUC1 protein on aptaelectrode surface was confirmed with further decrease in the current response (3.45 104 A) (curve v). This is
Fig. 3. (A) FT-IR spectra and (B) contact angle measurements of (i) CGO (ii) Au-PtBNPs/CGO (iii) SA/Au-PtBNPs/CGO and (iv) AptMUC1/SA/Au-PtBNPs/CGO coated FTO electrodes.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
6
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
Fig. 4. Electrochemical responses (A) CV and (B) EIS spectra of (i) CGO/FTO (ii) Au-PtBNPs/CGO/FTO (iii) SA/Au-PtBNPs/CGO/FTO (iv) AptMUC1/SA/Au-PtBNPs/CGO/FTO and (v) MUC1 treated AptMUC1/SA/Au-PtBNPs/CGO/FTO in 50 mM PBS (pH-7.0, 0.9%NaCl) containing 5 mM [Fe(CN)6]3-/4-.
due to the formation of aptamer-target 3D complex blocking the flow of electrons between the electrode and [Fe(CN)6]3-/4- solution. In this study, [Fe(CN)6]3-/4- is used as a redox probe indicator, which undergoes some reduction oxidation cycles when potential is applied in an electrochemical cell. The presence of negatively charged phosphates in aptamer sequence and large size of MUC1 could efficiently block the electron transfer from the negatively charged [Fe(CN)6]3-/4- redox probe, thus leads to a significant decrease in the electrochemical signal. A similar trend to the CV measurements was observed in case of DPV studies (Fig. S1). Briefly, the Au-PtBNPs modified electrode (curve ii) showed enhancement in the peak current in comparison to CGO modified FTO (curve i). Modification on the surface of Au-PtBNPs/CGO/FTO with SA resulted in a decreased peak current (curve iii). There was further decrease in peak current after immobilization of biotin tagged aptamer (curve iv) demonstrating successful immobilization of aptamer. Further interaction with the MUC1 protein, a higher decrease in peak current was observed (curve v). The electrochemical properties of various modified electrodes were also verified by comparing the CV, DPV measurements with the EIS responses. The change in electron transfer resistance (Rct) of CGO/FTO, Au-PtBNPs/CGO/FTO, SA/Au-PtBNPs/CGO/FTO, AptMUC1/SA/Au-PtBNPs/CGO/FTO and MUC1 coated aptaelectrode was determined by nyquist plot, as shown in Fig. 4B. The diameter of semicircle in the plot represents Rct value of electrode surface. Due to the greater electron transfer properties of CGO (curve i) the nyquist plot tends to form semicircle like structure whereas AuPtBNPs (curve ii) exhibited a straight line corresponding to the remarkable conducting nature. The conductivity of Au-PtBNPs/ CGO/FTO electrode decreased with the sequential assembly of SA, AptMUC1 as well as MUC1 and the Rct value increased for the SA/AuPtBNPs/CGO/FTO (curve iii), AptMUC1/SA/Au-PtBNPs/CGO/FTO (curve iv) and MUC1 coated aptaelectrode (curve v), respectively. The results obtained in the EIS plot were consistent with the CV and DPV responses confirming the successful synthesis of aptasensor. 3.3.1. Electro-active surface area To calculate the electro-active surface area of modified FTO electrode, CV measurements of each modification was done in PBS
buffer containing 5 mM [Fe(CN)6]3-/4- and 0.9% NaCl within a range of scan rate (10e100 mV s1). Rate of change in the peak currents with the square root of scan rate is given in Fig. S2 for each modified electrode. The slope obtained was utilized to calculate electroactive surface area according to RandleseSevcik equation [44]. 3/
Ipa ¼ 2.69 105 An 2C0Dr
1/2 1/2
v
(1)
Where, Ipa ¼ anodic peak current, A ¼ surface area of the electrode (cm2). n ¼ number of electrons participating in the redox reaction (1), Dr ¼ diffusion coefficient (7.6 106 cm2 s1). C0 ¼ concentration of [Fe(CN)6]3-/4- (5 mol cm3) v ¼ scan rate (V s1) The effective surface of electrode after every modification is given in Table 1. The effective surface area of Au-PtBNPs modified CGO/FTO electrode shows some increase in comparison to CGO/FTO electrode. Afterwards, decrease in effective surface area was observed after further modifications with SA and AptMUC1. The results clearly indicated the cooperative enhanced effects of AuPtBNPs in combination with CGO. 3.4. Optimization of study parameters Various study parameters such as aptamer concentration and incubation time required for MUC1 sensing could affect the performance of developed aptasensor. The current response of varied aptamer concentrations immobilized on SA/Au-PtBNPs/CGO/FTO
Table 1 Effective surface area of FTO electrode after each modification step. S. No.
Sensing platform
Effective surface area
1 2 3 4
CGO/FTO Au-PtBNPs/CGO/FTO SA/Au-PtBNPs/CGO/FTO AptMUC1/SA/Au-PtBNPs/CGO/FTO
0.248 cm2 0.356 cm2 0.308 cm2 0.281 cm2
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
7
was observed (Fig. S3A) and optimum aptamer concentration was found to be 10 mM since no prominent change in the current response was seen afterwards. The influence of incubation time for MUC1 protein detection was also investigated. In Fig. S3B, the DPV peak current decreased with increasing the incubation time (from 5 min to 25 min) due to the formation of strong aptamer protein 3D interaction. However, the current response becomes stable above 25 min of incubation time because of the saturation of binding sites available on electrode surface.
LOD ¼ 3SD/m
3.5. Detection of MUC1 protein
3.6. Selectivity, interference and storage stability
The electrochemical signals of aptasensor coated with a range of MUC1 concentrations were examined by DPV measurements under optimized experimental conditions. As shown in Fig. 5A, the DPV peak current decreased with increasing MUC1 concentration from 1 fM to 100 nM. This is due to the formation of more aptamer target complex which obstruct the electron flow between electrode interface and redox probe. At lowest MUC1 concentration, less amount of aptamer target complex is formed resulting in very less hindrance in the flow of electrons. Thus, the magnitude of peak current was almost equal to bare aptelectrode. Fig. 5B illustrates the rate of change in peak current with respect to MUC1 concentration (1 fM-100 nM). Therefore, a linear calibration plot between the change in peak current and the log of MUC1 protein concentration is given in the inset with a regression equation of:
To evaluate the selectivity of proposed aptasensor, a comparative study between the perfect complementary target protein and non-complementary targets was performed. As demonstrated in Fig. 6A, the current values of aptasensor incubated with mismatched targets are very much similar to the bare aptaelectrode. However, the aptaelectrode exhibited obvious decrease in the current values when incubated with MUC1 as well as the mixture solution. Fig. 6B shows the current response of MUC1 interaction with mutated aptamer sequence immobilized SA/Au-PtBNPs/CGO/ FTO electrode. There was no significant decrease in the DPV signals of the mutated aptamer immobilized SA/Au-PtBNPs/CGO/FTO electrode after incubation with MUC1 (supplementary data, S4 & Fig. S4). These results clearly suggest excellent selectivity of AptMUC1/SA/Au-PtBNPs/CGO/FTO electrode towards target protein, MUC1. The stability of AptMUC1/SA/Au-PtBNPs/CGO/FTO electrode was analysed over 30 days at an interval of 5 days. The fabricated aptaelectrodes were stored at 4 C and subjected to DPV measurements after treating with MUC1 for 25 min. After 5th, 10th, 15th, 20th, 25th and 30th day current responses decreased to 97%, 95%, 93%, 90%, 87% and 84% respectively (Fig. 6C). The results demonstrated good stability of aptasensor up to 15 days as no significant change in the current response was found.
y ¼ 3.83212 105xþ 0.00101 (Correlation coefficient ¼ 0.99915)
(2)
where, x is log of MUC1 concentration (fM) and y is DPV peak current (A). The detection limit as low as 0.79 fM was obtained with wide detection range from 1 fM to 100 nM, calculated from the formula
(3)
where, SD is the standard deviation of blank electrode without target and m is the slope of calibration curve. The results signify that the fabricated aptaelectrode is highly sensitive biosensing platform for the detection of MUC1 protein. The analytical performance of this biosensor was also compared with previously reported electrochemical methods for MUC1 detection as listed in Table 2.
Fig. 5. (A) DPV response of AptMUC1/SA/Au-PtBNPs/CGO coated FTO electrode after incubation with various concentrations of MUC1 (0, 1 fM, 10 fM, 100 fM, 1 pM, 10 pM, 100 pM, 1 nM, 10 nM and 100 nM) in 50 mM PBS (pH-7.0, 0.9% NaCl) containing 5 mM [Fe(CN)6]3-/4-. (B) Corresponding calibration curve between peak current values and MUC1 concentration (Inset: Linear plot of peak currents vs. log of MUC1 concentration. Error bars represent standard deviation of three measurements).
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
8
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
Table 2 Comparison of present aptasensor with previously reported aptamer based electrochemical biosensors (on the basis of their analytical performances) for the detection of MUC1. Biosensing platform
Detection method
LOD
Linear range
Response time
Ref.
Impedimetric aptasensor based on AuNPs signal amplification Sandwich type aptasensor based on dual signal amplification strategy Detection of MCF-7 cells via free running DNA walker
EIS DPV Chrono-coulometry
0.5e10 nM 1e100 nM 0-500 cells mL1
2h 40 min 25 min
[45] [46] [25]
Aptasensor based on methylene blue electrochemical reduction Sandwich electrochemical aptasensor for the detection of MCF-7 cells AuNPs based electrochemical aptasensor Aptasensor based on coreeshell nanocomposite aZrHCF@mFe3O4@mC
DPV DPV DPV EIS
0.1 nM 1 pM 47 cells mL1 0.6 ng mL1 8 cells mL1 24 nM 0.90 pg mL1
30 min 60 min -
[47] [26] [48] [49]
Electrochemical aptasensor based on exonuclease I-assisted target recycling amplification strategy Aptasensor based on bAuNPs-GO-PEDOT nanocomposite
DPV
0.40 pg mL1
2e20 ng mL1 10-105 cells mL1 50e1000 nM 0.01 ng mL1 -1 mg mL1 1.0 pg mL1 50 ng mL1 1 mg mL1 0.1 fg mL1 100 fg mL1 -1 ng mL1 1 fM-100 nM
60 min
[50]
15 min
[51]
60 min
[27]
25 min
Present work
DPV
0.1 fg mL
1
Aptasensor based on catalytic hairpin assembly coupled with PtPdNPs peroxidase-like Chronoamperometry 16 fg mL1 activity Electrochemical aptasensor based on Au-PtBNPs/CGO nanocomposite and [Fe(CN)6]3-/ DPV 0.79 fM 4signal indicator a b
ZrHCF@mFe3O4@mC: zirconium hexacyanoferrate nanoparticles and mesoporous nanomaterial composed of Fe3O4 and carbon nanospheres. AuNPs-GO-PEDOT: gold nanoparticles and graphene oxide doped poly(3,4-ethylenedioxythiophene).
Fig. 6. Selectivity studies of (A) Fabricated aptasensor for its complementary as well as non-complementary target, (B) Mutated aptamer immobilized SA/Au-PtBNPs/CGO/FTO electrode after interaction with MUC1 and (C) Stability studies of the aptasensor at every 5th day, after storage up to 30 days.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
9
Fig. 7. (A) Reproducibility studies of seven independent electrodes for 10 pM and 10 nM of MUC1 concentration, respectively and (B) Reusability studies of the aptaelectrode after regeneration up to 8 times.
3.7. Reproducibility and reusability studies The aptasensor was also utilized to access its reproducibility for two different MUC1 concentrations. Fig. 7A displays the DPV responses of seven different electrodes for 10 pM and 10 nM and exhibited a RSD of 0.48% and 2.5%, respectively. Finally, the DPV responses obtained before and after the regeneration of aptaelectrode were compared for each measurement. As shown in Fig. 7B, there is 83% decrease in current response after 3rd regeneration indicating that the aptasensor worked efficiently up to 3 times. 3.8. Real sample analysis The current response of the AptMUC1/SA/Au-PtBNPs/CGO/FTO electrode incubated with different concentrations (1-1 104 fM) of MUC1 standard solution as well as spiked serum samples was used to calculate the % age recovery. The recoveries obtained from various spiked serum samples ranged from 92.47% to 97.5% summarized in Table 3. The relative standard deviation ranging from 1.78% to 3.41% suggested practical applicability of the developed MUC1 based aptasensor in real samples. 4. Conclusions An effective electrochemical aptasensor was constructed by depositing target selective biotinylated aptamer on the surface of streptavidin coated Au-PtBNPs/CGO/FTO as immobilization platform for detecting a breast cancer biomarker, MUC1. In the
biosensing platform, eCOOH functionalized GO was used in the immobilization of streptavidin for further interaction with biotinylated aptamer and Au-PtBNPs were used to enhance the electrical conductivity of the electrode surface. The proposed aptasensor had high selectivity towards MUC1 protein with a very low detection limit of 0.79 fM and wide linear range from 1 fM to 100 nM. It also showed good recovery range (92%e97%) in spiked serum samples. The aptaelectrode provides a simple, selective and ultrasensitive assay for the analysis of MUC1 protein, indicating it as a significant platform for point of care diagnosis of breast cancer. Furthermore, the fabrication methodology can also be utilized to detect other protein biomarkers. Also the applicability of presented biosensor in real sample analysis could improve the diagnostic field with rapid, cost effective and minimally invasive approach. Declaration of competing interest The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper. Acknowledgements The research was financial supported by DST-SERB [EEQ/2017/ 000239], DST-Purse II and Special Assistance Programme (UGCSAP) [F.4-7/2015/DRS-III (SAP-II)]. Central instrument laboratory is highly acknowledged for using the FE-SEM facility. I also want to thank and acknowledge CSIR for providing the award of fellowship [09/135(0729)/2016-EMR-I]. Appendix A. Supplementary data
Table 3 Recoveries obtained for MUC1 in spiked serum samples (n ¼ 3). Sample No.
Added (fM)
Found (fM)
Recovery (%)
RSD (%)
1 2 3 4 5
1 1 101 1 102 1 103 1 104
0.939 9.75 96.53 925.16 9379.76
93.9 97.5 96.53 92.47 93.8
3.2 1.78 1.79 3.41 2.86
Supplementary data to this article can be found online at https://doi.org/10.1016/j.aca.2019.11.005. References [1] A. Jemal, F. Bray, M.M. Center, J. Ferlay, E. Ward, D. Forman, Global cancer statistics, CA A Cancer J. Clin. 61 (2) (2011) 69e90.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005
10
A. Bharti et al. / Analytica Chimica Acta xxx (xxxx) xxx
[2] F. Bray, J. Ferlay, I. Soerjomataram, R.L. Siegel, L.A. Torre, A. Jemal, Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries, CA A Cancer J. Clin. 68 (6) (2018) 394e424. [3] J. Ferlay, I. Soerjomataram, R. Dikshit, S. Eser, C. Mathers, M. Rebelo, D.M. Parkin, D. Forman, F. Bray, Cancer incidence and mortality worldwide: sources, methods and major patterns in GLOBOCAN 2012, Int. J. Cancer 136 (5) (2015) E359eE386. [4] P.G.C. Selwyna, P.R. Loganathan, K.H. Begam, Development of electrochemical biosensor for breast cancer detection using gold nanoparticle doped CA 15-3 antibody and antigen interaction, 2013 International Conference on Signal Processing, Image Proc. Pattern Recognit. (2013) 75e81. [5] M. Hasanzadeh, N. Shadjou, M. de la Guardia, Early stage screening of breast cancer using electrochemical biomarker detection, Trac. Trends Anal. Chem. 91 (2017) 67e76. [6] L. Farzin, M. Shamsipur, Recent advances in design of electrochemical affinity biosensors for low level detection of cancer protein biomarkers using nanomaterial-assisted signal enhancement strategies, J. Pharm. Biomed. Anal. 147 (2018) 185e210. [7] M. Shimizu, K. Yamauchi, Isolation and characterization of mucin-like glycoprotein in human milk fat globule membrane, J. Biochem. 91 (2) (1982) 515e524. [8] S. Nath, P. Mukherjee, MUC1: a multifaceted oncoprotein with a key role in cancer progression, Trends Mol. Med. 20 (6) (2014) 332e342. [9] R. Hu, W. Wen, Q. Wang, H. Xiong, X. Zhang, H. Gu, S. Wang, Novel electrochemical aptamer biosensor based on an enzyme-gold nanoparticle dual label for the ultrasensitive detection of epithelial tumour marker MUC1, Biosens. Bioelectron. 53 (2014) 384e389. [10] M.A. Nawaz, S. Rauf, G. Catanante, M.H. Nawaz, G. Nunes, J.L. Marty, A. Hayat, One Step Assembly of Thin Films of Carbon Nanotubes on Screen Printed Interface for Electrochemical Aptasensing of Breast Cancer Biomarker, Sensors, Basel, 2016, 16(10). [11] J.Z. Zaretsky, I. Barnea, Y. Aylon, M. Gorivodsky, D.H. Wreschner, I. Keydar, MUC1 gene overexpressed in breast cancer: structure and transcriptional activity of the MUC1 promoter and role of estrogen receptor alpha (ERalpha) in regulation of the MUC1 gene expression, Mol. Cancer 5 (2006) 57. [12] S.N. Topkaya, M. Azimzadeh, M. Ozsoz, Electrochemical biosensors for cancer biomarkers detection: recent advances and challenges, Electroanalysis 28 (7) (2016) 1402e1419. [13] J.F. Rusling, C.V. Kumar, J.S. Gutkind, V. Patel, Measurement of biomarker proteins for point-of-care early detection and monitoring of cancer, Analyst 135 (10) (2010) 2496e2511. [14] K. Wang, D. Fan, Y. Liu, E. Wang, Highly sensitive and specific colorimetric detection of cancer cells via dual-aptamer target binding strategy, Biosens. Bioelectron. 73 (2015) 1e6. [15] L. Ribovski, V. Zucolotto, B.C. Janegitz, A label-free electrochemical DNA sensor to identify breast cancer susceptibility, Microchem. J. 133 (2017) 37e42. [16] S. Atay, K. Pis¸kin, F. Yılmaz, C. Çakır, H. Yavuz, A. Denizli, Quartz crystal microbalance based biosensors for detecting highly metastatic breast cancer cells via their transferrin receptors, Anal. Methods 8 (1) (2016) 153e161. [17] F. Fathi, M.-R. Rashidi, Y. Omidi, Ultra-sensitive detection by metal nanoparticles-mediated enhanced SPR biosensors, Talanta 192 (2019) 118e127. [18] K. Mahato, B. Purohit, K. Bhardwaj, A. Jaiswal, P. Chandra, Novel electrochemical biosensor for serotonin detection based on gold nanorattles decorated reduced graphene oxide in biological fluids and in vitro model, Biosens. Bioelectron. 142 (2019), 111502. [19] X. Wang, J. Su, D. Zeng, G. Liu, L. Liu, Y. Xu, C. Wang, X. Liu, L. Wang, X. Mi, Gold nano-flowers (Au NFs) modified screen-printed carbon electrode electrochemical biosensor for label-free and quantitative detection of glycated hemoglobin, Talanta 201 (2019) 119e125. [20] Y. Yang, Y. Fu, H. Su, L. Mao, M. Chen, Sensitive detection of MCF-7 human breast cancer cells by using a novel DNA-labeled sandwich electrochemical biosensor, Biosens. Bioelectron. 122 (2018) 175e182. [21] X. Ma, Y. Jiang, F. Jia, Y. Yu, J. Chen, Z. Wang, An aptamer-based electrochemical biosensor for the detection of Salmonella, J. Microbiol. Methods 98 (2014) 94e98. [22] S. Eissa, M. Zourob, In vitro selection of DNA aptamers targeting b-lactoglobulin and their integration in graphene-based biosensor for the detection of milk allergen, Biosens. Bioelectron. 91 (2017) 169e174. [23] G. Figueroa-Miranda, L. Feng, S.C.-C. Shiu, R.M. Dirkzwager, Y.-W. Cheung, €ning, A. Offenha €usser, D. Mayer, Aptamer-based elecJ.A. Tanner, M.J. Scho trochemical biosensor for highly sensitive and selective malaria detection with adjustable dynamic response range and reusability, Sens. Actuators B Chem. 255 (2018) 235e243. [24] M. Kimoto, M. Nakamura, I. Hirao, Post-ExSELEX stabilization of an unnaturalbase DNA aptamer targeting VEGF165 toward pharmaceutical applications, Nucleic Acids Res. 44 (15) (2016) 7487e7494. [25] S. Cai, M. Chen, M. Liu, W. He, Z. Liu, D. Wu, Y. Xia, H. Yang, J. Chen, A signal amplification electrochemical aptasensor for the detection of breast cancer cell via free-running DNA walker, Biosens. Bioelectron. 85 (2016) 184e189. [26] K. Wang, M.Q. He, F.H. Zhai, R.H. He, Y.L. Yu, A novel electrochemical biosensor based on polyadenine modified aptamer for label-free and ultrasensitive
detection of human breast cancer cells, Talanta 166 (2017) 87e92. [27] R.-N. Zhao, Z. Feng, Y.-N. Zhao, L.-P. Jia, R.-N. Ma, W. Zhang, L. Shang, Q.W. Xue, H.-S. Wang, A sensitive electrochemical aptasensor for Mucin 1 detection based on catalytic hairpin assembly coupled with PtPdNPs peroxidase-like activity, Talanta 200 (2019) 503e510. [28] G. Eda, M. Chhowalla, Chemically derived graphene oxide: towards large-area thin-film electronics and optoelectronics, Adv. Mater. 22 (22) (2010) 2392e2415. [29] Q.B. Zheng, Z.G. Li, J.H. Yang, J.K. Kim, Graphene oxide-based transparent conductive films, Prog. Mater. Sci. 64 (2014) 200e247. [30] Q. Wang, B.T. Wang, Surface plasmon resonance biosensor based on graphene oxide/silver coated polymer cladding silica fiber, Sens. Actuators B Chem. 275 (2018) 332e338. [31] J.B. Li, Y.H. Wang, Y.L. Sun, C.F. Ding, Y.N. Lin, W.Y. Sun, C.N. Luo, A novel ionic liquid functionalized graphene oxide supported gold nanoparticle composite film for sensitive electrochemical detection of dopamine, RSC Adv. 7 (4) (2017) 2315e2322. [32] H.M. Albishri, D. Abd El-Hady, Hyphenation of enzyme/graphene oxide-ionic liquid/glassy carbon biosensors with anodic differential pulse stripping voltammetry for reliable determination of choline and acetylcholine in human serum, Talanta 200 (2019) 107e114. [33] Y. Wang, F.G. Zhai, Y. Hasebe, H.M. Jia, Z.Q. Zhang, A highly sensitive electrochemical biosensor for phenol derivatives using a graphene oxidemodified tyrosinase electrode, Bioelectrochemistry 122 (2018) 174e182. [34] G. Aydogdu Tig, Highly sensitive amperometric biosensor for determination of NADH and ethanol based on Au-Ag nanoparticles/poly(L-Cysteine)/reduced graphene oxide nanocomposite, Talanta 175 (2017) 382e389. [35] R. Mandal, A. Baranwal, A. Srivastava, P. Chandra, Evolving trends in bio/ chemical sensor fabrication incorporating bimetallic nanoparticles, Biosens. Bioelectron. 117 (2018) 546e561. [36] U. Jain, S. Gupta, N. Chauhan, Construction of an amperometric glycated hemoglobin biosensor based on Au-Pt bimetallic nanoparticles and poly (indole5-carboxylic acid) modified Au electrode, Int. J. Biol. Macromol. 105 (Pt 1) (2017) 549e555. [37] C.S. Ferreira, K. Papamichael, G. Guilbault, T. Schwarzacher, J. Gariepy, S. Missailidis, DNA aptamers against the MUC1 tumour marker: design of aptamer-antibody sandwich ELISA for the early diagnosis of epithelial tumours, Anal. Bioanal. Chem. 390 (4) (2008) 1039e1050. [38] C.Y. Lee, Q.V. Le, C. Kim, S.Y. Kim, Use of silane-functionalized graphene oxide in organic photovoltaic cells and organic light-emitting diodes, Phys. Chem. Chem. Phys. 17 (14) (2015) 9369e9374. [39] A. Bharti, N. Agnihotri, N. Prabhakar, A voltammetric hybridization assay for microRNA-21 using carboxylated graphene oxide decorated with goldplatinum bimetallic nanoparticles, Microchim. Acta 186 (3) (2019) 185. [40] M.F. Hossain, J.Y. Park, Plain to point network reduced graphene oxideactivated carbon composites decorated with platinum nanoparticles for urine glucose detection, Sci. Rep. 6 (2016), 21009. [41] A. Barth, Infrared spectroscopy of proteins, Biochim. Biophys. Acta 1767 (9) (2007) 1073e1101. [42] N. Prabhakar, H. Thakur, A. Bharti, N. Kaur, Chitosan-iron oxide nanocomposite based electrochemical aptasensor for determination of malathion, Anal. Chim. Acta 939 (2016) 108e116. [43] C.D. Kanakis, S. Nafisi, M. Rajabi, A. Shadaloi, P.A. Tarantilis, M.G. Polissiou, J. Bariyanga, H.A. Tajmir-Riahi, Structural analysis of DNA and RNA interactions with antioxidant flavonoids, Spectroscopy 23 (1) (2009). [44] A. Profumo, M. Fagnoni, D. Merli, E. Quartarone, S. Protti, D. Dondi, A. Albini, Multiwalled carbon nanotube chemically modified gold electrode for inorganic as speciation and Bi(III) determination, Anal. Chem. 78 (12) (2006) 4194e4199. [45] X. Liu, Y. Qin, C. Deng, J. Xiang, Y. Li, A simple and sensitive impedimetric aptasensor for the detection of tumor markers based on gold nanoparticles signal amplification, Talanta 132 (2015) 150e154. [46] X. Chen, Q. Zhang, C. Qian, N. Hao, L. Xu, C. Yao, Electrochemical aptasensor for mucin 1 based on dual signal amplification of poly(o-phenylenediamine) carrier and functionalized carbon nanotubes tracing tag, Biosens. Bioelectron. 64 (2015) 485e492. [47] B. Ciui, M. Tertis, D. Peia, C. Cristea, R. Sandulescu, Graphene oxide modified aptasensor for the mucin 1 detection, Farmacia 64 (1) (2016) 43e47. [48] J.H. Song, Y. Zhou, B. Chen, W.S. Lou, J.P. Gu, Development of electrochemical aptamer biosensor for tumor marker MUC1 determination, Int. J. Electrochem. Sci. 12 (6) (2017) 5618e5627. [49] M. Wang, B. Hu, H. Ji, Y. Song, J. Liu, D. Peng, L. He, Z. Zhang, Aptasensor based on hierarchical core-shell nanocomposites of zirconium hexacyanoferrate nanoparticles and mesoporous mFe3O4@mC: electrochemical quantitation of epithelial tumor marker mucin-1, ACS Omega 2 (10) (2017) 6809e6818. [50] C. Lin, H. Zheng, Y. Huang, Z. Chen, F. Luo, J. Wang, L. Guo, B. Qiu, Z. Lin, H. Yang, Homogeneous electrochemical aptasensor for mucin 1 detection based on exonuclease I-assisted target recycling amplification strategy, Biosens. Bioelectron. 117 (2018) 474e479. [51] P. Gupta, A. Bharti, N. Kaur, S. Singh, N. Prabhakar, An electrochemical aptasensor based on gold nanoparticles and graphene oxide doped poly(3,4ethylenedioxythiophene) nanocomposite for detection of MUC1, J. Electroanal. Chem. 813 (2018) 102e108.
Please cite this article as: A. Bharti et al., An electrochemical aptasensor for analysis of MUC1 using gold platinum bimetallic nanoparticles deposited carboxylated graphene oxide, Analytica Chimica Acta, https://doi.org/10.1016/j.aca.2019.11.005