An in vitro system for the editing of apolipoprotein B mRNA

Cell, Vol. 58, 519-525, August 11, 1989, Copyright 0 1989 by Cell Press

An In Vitro System for the Editing of Apolipoptatein B mRNA Donna M. Driscoll: Judy K. Wynne, Simon C. Wallis,t and James Scott Division of Molecular Medicine MRC Clinical Research Centre Watford Road Harrow, Middlesex HA1 3UJ England

Summary A novel form of RNA editing generates two forms of apolipoprotein B (apo-B) mRNA by converting C at nucleotlde 6666 to U or a U-like base. We have established an in vitro system for the editing of apo-B mRNA using synthetic RNAs and SlOO extracts from rat hepatoma cells. Editing was detected by a sensitive primer extension assay and confirmed by DNA sequencing. The in vitro editing activity is specific and sensitive to protelnase K. Apo-BlOO RNAs were synthesized in vitro from deletion mutants spanning nucleotide 6666. Synthetic RNA5 containing 2363, 463, and 55 nucleotides of ape-B mRNA sequence were edited in vitro with similar efficiency, but an RNA containing 26 nucleotides was not edited.

A novel form of RNA editing is responsible for the generation of two forms of apolipoprotein B (ape-B) in human plasma. Apo-BlOO, a 512 kd protein, is synthesized in human liver whereas apo-B46, a 242 kd protein, is synthesized in the intestine and represents the amino-terminal half of apo-BlOO (Kane, 1963; Knott et al., 1986; Powell et al., 1987). A single apo-B gene encodes a primary transcript that is then posttranscriptionally modified in a tissue-specific manner. In humans, both the apeB gene and hepatic cDNA contain C at nucleotide 8688, whereas intestinal cDNA contains T at this position (Chen et al., 1987; Hospattankar et al., 1987, Powell et al., 1987). This converts codon 2153 from glutamine (CAA) to an in-frame stop codon (TAA), resulting in the synthesis of the apo848 protein by the intestine. The rat liver also produces apo-B48 by the same RNA editing mechanism (Davidson et al., 1988; Tennyson et al., 1989), and in this species the process is regulated by thyroid hormone (Davidson et al., 1988). Recently a number of other examples of RNA editing have been reported. In the kinetoplast of trypanosomes, uridines are posttranscriptionally added to or deleted from certain mRNAs, which can result in the creation of open * Present address: Department of Physiology and Medicine, Southwest Foundation for Biomedical Research, W. Loop 410 at Military Drive, San Antonio, Texas 70264. 7 Present address: Department of Endocrinology, Royal Postgraduate Medical School, Du Cane Road, London W12 OHS, England.

reading frames and/or the introduction of an AUG initiation codon (reviewed in Benne, 1989). The P and V proteins of the paramyxovirus SV5 are encoded by separate mRNAs that differ only in the presence of two nontemplated guanine residues in the mRNAs encoding P protein (Thomas et al., 1988). In approximately 50% of the mRNA encoding the P protein of measles virus, a G is posttranscriptionally inserted, resulting in the production of a protein containing the amino-terminal region of P joined to a cysteine-rich domain from a cryptic reading frame in the mRNA (Cattaneo et al., 1989). Although RNA editing has not yet been studied in vitro, two systems for in vitro modification of RNA have recently been developed. An unwinding activity has been found in extracts from Xenopus oocytes that converts many of the adenosines in double-stranded RNA to inosines in vitro (Bass and Weintraub, 1988). In the second system, synthetic RNA templates and HeLa cell nuclear extracts have been used to study the specific methylation of a single adenosine residue in the 3’ untranslated region of prolactin mRNA (Narayan and Rottman, 1988). The methylation of internal adenosine residues is common and nonrandom in eukaryotic mRNAs, but the function of this posttranscriptional modification is not known. We are interested in identifying the RNA sequences and cellular factors required for the editing of ap@B mRNA. As a first step, we have established a system for editing in vitro using cell-free extracts and synthetic apo-B RNA templates. Using deletion mutants, we show that a sequence of 55 but not 26 nucleotides in apo-B mRNA is sufficient for editing in vitro. Results Apo-BlOO and Apo-B48 mRNAs Can Be Detected by Primer Extension Previous studies in our laboratory have used differential hybridization with C- and T-specific oligonucleotides to identify apo-BlOO mRNA (with C at nucleotide 8686) and apo-648 mRNA (with U at nucleotide 6886) (Powell et al., 1967). Although this technique is highly specific, it is not sufficiently sensitive to distinguish the two mRNAs in a mixture if one is in low abundance (unpublished data). Given that the conversion of ape-BlOO mRNA to apo-B48 mRNA may be of low efficiency in vitro, we have developed a more sensitive assay using primer extension (Figure 1A). A 35 nucleotide primer (DD3) complementary to apo-B mRNA between nucleotides 8674 and 6708 is annealed to RNA. This region is highly conserved across species (Davies et al., 1989), and the primer anneals to apo-B mRNA from human, rat, and mouse. The annealed product is extended with reverse transcriptase in the presence of dATP, dCTP, dTTP, and high concentrations of dideoxy-GTP. Primer annealed to apo-BlOO mRNA extends to the first upstream C, which is at nucleotide 6666 in all three species, generating a product of 42 nucleotides. Primer annealed to apo-B48 mRNA extends

A. 6655

6666

6661

5**,3 c human

C rat,

32P-primer

C t

reverse transcribe with dATP, dCTP, dTTP, dideoxyGTP

1

CAA 42 base TAA 47 base

I

-

Primer

TAA

I)**”

B.

-

apo-BlOO cDNA

Conversion product cDNA

Primer

/ apo-B apo-B

50

20

1. Primer

5

2

1

0.5

% ape-B48 RNA

R”N8A A& Figure

10

Extension

Analysis

of APO-B mRNA

\

(A) Schematic diagram of primer extension assay. RNA (or cDNA amplified by PCR) is annealed to a 32P-labeled oligonucleotide that is complementary to human apo-B sequences downstream of nucleotide 6666. The annealed product is extended with reverse transcriptase in the presence of dATP, dCTP, dTTP, and dideoxy-GTP and analyzed by electrophoresis as described in Experimental Procedures. (6) Primer extension analysis of synthetic RNAs. RNAs corresponding

to human apo-8100 and apo-648 mRNA were transcribed in vitro with T7 RNA polymerase. Approximately 5 fmol of each RNA was analyzed by primer

extension

as described

in (A). In a mixing

experiment

(right),

primer extension was performed on a mixture of the two RNAs that contained 3 fmol of apo-8100 RNA and variable amounts of apo-I348 RNA as indicated.

to the second upstream C. Because the sequence upstream of nucleotide 6666 is divergent, an extension product of 47 nucleotides is synthesized from rat and mouse apo-648 mRNA, compared with a product of 52 nucleotides from human. We have used apo-BlOO and apo-B48 mRNA templates synthesized in vitro by T7 RNA polymerase to optimize the primer extension assay (Figure 1s). The assay is highly sensitive and will easily detect 0.1 fmol of apo-B mRNA. Total RNA or DNA can also be analyzed by this technique (see below). Experiments in which synthetic apo-BlOO and apo-B48 mRNAs are mixed in varying ratios have shown that the assay is linear and that as little as 1% apo848 mRNA can be detected (Figure 1B). In Vitro Editing of Apo-8100 RNA McArdle 7777 cells, a cell line derived from a rat hepatoma, were used as a source of extract for in vitro editing of apo-B mRNA. Like the rat liver, these cells produce both

ACGT Figure

2. In Vitro Conversion

T G A T A T’ A A T T T

ACGT of APO-B RNA

(A) Three femtomoles of a synthetic human apo-8100 RNA (nucleotides 6411-6893) was analyzed directly by primer extension (in the leftmost lane) or after incubation for 3 hr at 30% with cunversion buffer or with 60 vg of 5100 extract from McArdle 7777 cells as described in Experimental Procedures. Primer extension analysis on the SIOO extract alone is also shown. In the rightmost lane, synthetic human apo648 RNA was mixed with the synthetic apo-8100 RNA and analyzed by primer extension. (6) DNA sequence ladder comparing the sequence of human apoBlOO cDNA and the cDNA sequence of the product generated in an in vitro conversion reaction. The sequence shown is from nucleotides 6634-6693. The altered nucleotide at position 6666 is indicated by an asterisk.

apo-BlOO and apo-848 mRNAs (Davies et al., 1989). SlOO extracts were prepared by the methods of Dignam et al. (1983) and were assayed in vitro for editing activity. Active extracts were obtained only if leupeptin and antipain were added to all buffers to 10 pg/ml. The converting activity appeared to be cryolabile because extracts lost activity if stored at -80% or in liquid nitrogen. Extracts stored at 4% or -20% were stable for at least 3 months. For in vitro conversion, an RNA corresponding to nucleotides 6411-6893 of human liver apo-B cDNA was synthesized in vitro by T7 RNA polymerase. The synthetic apo-BlOO RNA was incubated with conversion buffer (see Experimental Procedures) or with SlOO extract and ana-

Ape-B 521

mRNA

Editing

In Vitro

lyzed by primer extension. The input RNA alone and RNA that had been incubated with buffer contained only apo8100 mRNA, whereas RNA which had been incubated with SlOO extract generated a second extension product of 52 nucleotides, the size expected from human apo-848 RNA (Figure 2A). This product does not represent endogenous rat apo-B48 mRNA in the extract, which would generate an extension product of 47 nucleotides. No primer extension products were detected when SlOO extracts were incubated without exogenous synthetic mRNA (Figure 2A, lane “SlOO”). Dilution experiments with apoBlOO and ape-B48 synthetic RNAs indicated that approximately 2%-3% of the input apo-BlOO RNA had been converted to ape-B48 RNA.

otherwise identical to human apo-BlOO cDNA sequence between nucleotides 6590 and 6735. Requirements for In Vitro Convereion In vitro assays were performed under a variety of conditions to define the requirements for the editing of apo-8100 RNA. Conversion in vitro only occurred in the presence of high levels of EDTA. The optimal EDTA concentration varied between extract preparations, but ranged from 20 to 50 mM (Figure 3A). No conversion was detected when RNA was incubated in conversion buffer containing 0 to 50 mM EDTA(Figure 2A and data not shown). The addition of all four ribonucleotide triphosphates (200 MM) and creatine phosphate (10 mM) did not stimulate the conversion reaction (Figure 3A). The addition of MgC12 and MnC12 (from 1 to 10 mM) in the absence of EDTA also had no effect on the converting activity (data not shown). A time course for the conversion reaction showed that optimal conversion occurs after incubation for 3 hr (Figure 38). Conversion was detected at 30% but not at 4% or 22% (data not shown). Conversion could also be detected at 37% but this was not reproducible. The substrate specificity of the editing reaction was also investigated. The SlOO extracts converted a synthetic apo8100 RNA but not a single- or double-stranded DNA containing the same sequence (Figure 3C). When synthetic

Cloning and Sequencing of Conversion Products To confirm the results of the primer extension assay, cDNA was synthesized from RNA converted in vitro, amplified by the polymerase chain reaction (PCR), and cloned into ProcepBluescript KS- as described in Experimental dures. When colony lifts were screened by differential hybridization, six out of 250 colonies hybridized to the T-specific oligonucleotide (BSTOP; see Experimental Procedures). These positive clones were analyzed by DNA sequencing, and one example is shown in Figure 28. All six clones contained T at nucleotide 8886 but were

A.

B.

EDTA, mM apo-B48 RNA

0 15

Time, hours 0.5 1 2 3 6

NTP

10205OCP

1 a

ape-B 100 RNA

R

-TAA

Figure 3. Optimization sion Assay

a%B RNA -TAA

-cAA

-Primer

D.

C. RNA

DSNSA

.

ds DNA

Convert

Preincubate at 37°C

-TAA

-TAA

-CAA

-Primer -+

-+-4

Sl 00 extract

-Primer buffer

SIOO

proteinaze

K

of the In Vitro Conver-

(A) A synthetic apo-6100 RNA (3 fmol) corresponding to nucieotides 6411-6893 was incubated with 60 ug of Sl96 extract from McArdle 7777 cells in the presence of increasing concentrations of EDTA (0 to 50 mM) or with 50 mM EDTA, 200 uM ribonucleotide triphosphates, and 10 mM creatine phosphate (indicated as NTP, CP). After reactions were incubated at 39% for 3 hr, the EDTA concentration was adjusted to 50 mM in all samples before the addition of proteinase K to stop the reactions as described in Experimental Procedures. The primer extension product of synthetic human apo-B46 RNA is also shown. (B) Conditions were the same as in (A), except the conversion reactions contained 50 mM EDTA and the time was varied as indicated. The primer extension products of synthetic human ape-BlCtO and apo-846 RNAs are also shown. (C) Conditions were the same as in (A), except all reactions contained 50 mM EDTA and 3 fmol of either RNA, single-stranded (ss) DNA, or double-stranded (ds) DNA corresponding to nucleotides 6411-6693 of human apoB mRNA. After the conversion reaction, the doublestranded DNA was boiled for 3 min. chilled on ice, and annealed to the primer. (D) Conditions were the same as in (A), except all reactions contained 60 mM EDTA. RNA was incubated with buffer or Sl90 extract as usual, or with SlOO extract that had been preincubated at 37% with or without 296 9g/ml proteinase K for 30 min prior to the addition of synthetic apo-6190 mRNA.

Cdl 522

A. C-T L673

52sg641 !v6sg3 -

TAA, human

-

TAA, rat

psx7 pRSAl3

B. pSX7

*

*m

-

pRSA13

4. Cell Type Specificity

of the Converting

-

TAA

-

CAA

-

Primer

TAA

Figure

Figure

pBS26

e

+-+-

-

pBS55

Primer

Activity

(A) Primer extension analysis of apo-B mRNA in McArdle 7777, HeLa, and Hep3B cells. The first strand of cDNA was synthesized from 10 ng of total RNA using an internal ape-B-specific oligonucleotide as primer. The cDNAs were enzymatically amplified by PCR using ratspecific oligonucleotides ND1 and ND2 for McArdle 7777 cells or human-specific oligonucleotides PCR5 and PCRlP for HeLs and Hep3B cells. The primer extension products of synthetic human apo6100 RNA and rat ape-B46 RNA are also shown. (8) In vitro conversion assays were as described in Experimental Procedures, using 3 fmol of synthetic apo-6100 mRNA (nucleotides 6411-6993) and 60 ng (lanes I, 3, 5) or 120 ng (lanes 2, 4, 6) of SlOO extract. The primer extension product of synthetic human apo-846 RNA is also shown.

apo-B48 RNA was incubated with SlOO extract, no modification of the C at nucleotide 6666 was detected (data not shown). Treatment of the SlOO extracts with proteinase K for 20 min prior to the addition of apo-BlOO RNA abolished the converting activity, which suggests that a protein moiety is required for the editing reaction (Figure 3D). The Editing Activity Is Not Present in HeptB or HeLa Cells SlOO extracts were prepared from two other cell lines that do not produce apo-B48 mRNA. Hep3B cells are derived from a human hepatoblastoma, and like human liver synthesize apo-BlOO mRNA (Figure 4A). Apo-B48 mRNA was not detected in these cells by the primer extension assay, which can detect less than lo/b apo-B48 RNA. HeLa ceils, derived from a human epithelial carcinoma, do not contain any detectable apo-BlOO or apo-B48 mRNA when as-

5. Minimum

+Sequence

+

- WOO extract

Requirements

for In Vitro Editing

(A) Deletion mutants were constructed as described in Experimental Procedures, and cloned into pGEM or pl3luescript KS- vectors under the control of either the T3 or T7 promoter. (Et) In vitro conversion assays on RNAs transcribed in vitro from the deletion mutants. RNA (3 fmol) was incubated either with conversion buffer or with 60 ng of SIOO extract from McArdle 7777cells in the presence of 50 mM EDTA for 3.5 hr at 30°C, and analyzed by primer extension as described in Experimental Procedures. Oligonucleotide DD3 was used as the primer to analyze the RNAs synthesized from pSX7, pRSA13, and pBS55, and oligonucleotide DD5 was used for RNA synthesized from pBS26.

sayed by primer extension (Figure 4A). As shown in Figure 48, SlOO extracts prepared from Hep3B cells or HeLa cells do not contain any detectable converting activity when assayed under the same conditions used for extracts from McArdle 7777 cells. A Sequence of 55 Nucleotides Can Be Edited In Vitro The RNA template used in the previous experiments was a 483 nucleotide transcript corresponding to nucleotides 6411-6893 of apo-B mRNA. To determine the minimum sequence required for the conversion in vitro, we constructed a series of deletion mutants spanning nucleotide 6666 (Figure 5A). All constructs were derived from exon 26 and only contained coding sequences. Synthetic RNAs transcribed from these plasmids were incubated with SlOO extract and analyzed by primer extension as described above. RNAs containing 2385 nucleotides (52897673), 483 nucleotides (6411-6893) and 55 nucleotides (66496703) of apo-B mRNA sequence were all edited in vitro (Figure 58). However, an RNA containing a 26 nucleotide sequence (6662-6687) that is highly conserved across species was not edited in vitro (Figure 58). This RNA, which contains 26 nucleotides of apo-B sequence

APO-B mRNA 523

Editing

In Vitro

and 47 nucleotides of polylinker sequence, is the smallest RNA analyzed and may have failed to convert in vitro owing to degradation by ribonucleases during the conversion reaction. However, primer extension analysis in the presence of all four deoxynucleotides showed that the 5’ end of the RNA was intact after the conversion assay (data not shown). Discussion We have developed an in vitro system for the editing of apo-6100 mRNA, using synthetic RNA templates and SlOO extracts from rat hepatoma cells. This demonstration of RNA editing in vitro definitively establishes that apo-B mRNA undergoes a posttranscriptional editing reaction. The activity detected in vitro exhibits the same specificity as the in vivo reaction. The SlOO extracts modify only the C at nucleotide 6666 in apo-BlOO RNA, converting it to a nucleotide read as U by reverse transcriptase. The activity is specific for RNA, not DNA, and is only detected in extracts from cells that convert apo-BlOO mRNA (McArdle 7777) but not in extracts from cells that only produce apoBlOO mRNA (Hep3B) or do not express apo-B (HeLa). Requirements for In Vitm Editing The converting activity is stimulated by high levels of EDTA but not by the addition of Mg2+, Mn2+, or ribonucleotide triphosphates. No conversion is detected when RNA is incubated with buffer containing EDTA or when DNA templates or the smallest RNA is incubated with extract and EDTA. Thus EDTA present in the conversion reaction does not alter the fidelity of the reverse transcriptase in the subsequent primer extension assay. EDTA may simply function by chelating metal ions in the extract that either inhibit the converting activity or activate a protease. Although an exogenous energy source is not needed for in vitro conversion, we cannot exclude the possibility that a ribonucleotide triphosphate is required given that there may be low levels of these in the SlOO extract. The efficiency of editing in vitro (20%~3%) is lower than the efficiency of conversion of endogenous apo-BlOO mRNA in McArdle 7777 cells (approximately 15%). This may be due to suboptimal conditions for either extract preparation or the in vitro conversion assay. Minimum Sequence Requirement for Editing In Vitro The results presented here show that 55 nucleotides of the 14,121 nucleotide apo-B mRNA are sufficient for conversion in vitro. This region contains only coding sequences and lacks polyadenylation signals. Thus editing in vitro is not obligatorily coupled to transcription, accurate splicing, polyadenylation, or translation. Capping of the mRNA is also not required since uncapped and capped synthetic mRNAs are converted with equal efficiency in vitro (unpublished data). However, editing of apo-BlOO mRNA may be coupled to one of these processes in vivo. The synthetic apo-BlOO RNA which is not edited in vitro contains a 26 nucleotide sequence (6662-6667) that is

highly conserved across species. This same 26 nucleotide sequence is converted when transfected into McArdle 7777 cells (Davies et al., 1989). These studies used a minigene that contained the 26 nucleotides spanning nucleotide 6666 as well as other apo-B sequences from exon 26 which may influence conversion. It is also possible that the requirements for conversion in vitro are more stringent than in transfected cells. We are currently analyzing this region by site-directed mutagenesis to identify the minimal sequence required for editing of apoBlOO mRNA. Mechanism of Editing of APO-B mRNA The editing of apeB mRNA involves a single nucleotide change converting C at nucleotide 8666 to a nucleotide that is read as U by both reverse transcriptase and the ribosome. The simplest explanation for the C-T change in the cDNA would be deamination at the 4 position of the C in the mRNA, converting it to U, but other explanations must be considered. By analyzing RNA that has been converted in vitro, we may be able to determine the exact nature of the modified nucleotide, which may give some insight into the editing mechanism. The finding that proteinase K abolishes converting activity suggests that editing requires a protein component or components. Preliminary experiments using gel retardation indicate that several proteins in the SlOO extracts bind specifically to the 26 nucleotide RNA that spans nucleotide 6668 (R. Shah, D. M. Driscoll, S. C. Wallis, and J. Scott, unpublished data). The in vitro system described here should enable us to purify the protein or protein complex responsible for the editing of apo-B mRNA. Experimental

Procedures

Oligonucleotides The following oligonucleotides systems 380A DNA synthesizer amide-7 M urea gels:

were synthesized on an Applied Bioand purified on 12% or 15% acryl-

BSTOP: TACTGATCAAATTATATCA, I9-mer with BGLN: TACTGATCAAATTGTATCA, 14mer with DD3: AATCATGTAAATCATAATTATCTTTAATATACTGA, end at 6674 DD5: CGATATCAAGCTTTAATATACTGA, 24-mer NDl: ATCTGACTGGGAGAGACAAGTAG, 25mer ND2: GTTCTTTTTAAGTCCTGTGCATC, 23mar PCR5: CTGAATTCATTCAATTGGGAGAGACAAG, at 6564 PCR12: AACAAATGTAGATCATGG, 18mer with

5’ end at 6679 5’ end at 6679 35mer with 5’ with 5’ end at 6686 with 5’ end at 6512 with 5’ end at 67l6 28-mer with 5’ end 5’ end at 6823

All oligonucleotides correspond to human ape-B sequence, except ND1 and ND2, which correspond to rat. The nucleotide position refers to the human mRNA sequence (Knott et al., 1986). Oligonucleotides DD3, DD5, BSTOP BGLN, PCRlP. and ND2 are complementary to ape-B mRNA, and oligonucleotides PCRC and ND1 correspond to coding sequence. The underlined region in oligonucleotide DD5 corresponds to vector sequences flanking the 26 bp insert in plasmid pBS26. Oligonucleotides were labeled with [y-ssP]ATP (31?06 Gil mmol. Amersham) and T4 polynucleotide kinase (Pharmacia) to a specific activity of 5 x 108 cpmlag as described (Maniatis et al., 1962). Plasmids Plasmid pSX7 contains a 2.4 kb Sall-Xbal fragment from human liver apo-6 cDNA (nucieotides 5289-7673) cloned into the Sall-Xbal site of pGEM4. Plasmid pRSA13 contains a 483 bp Rsal fragment from hu-

man liver apt-B cDNA (nucleotides 64116693) cloned into the Smal site of pGEM4. The plasmid pTAA-1 contains a 750 bp EcoRl fragment from human intestinal apo8 cDNA with a T at nucleotide 6666 cloned into the EcoRl site of pGEM3. To prepare smaller constructs spanning nucleotide 6666, oligonucleotide primers complementary to ape-B cDNA sequences were annealed to plasmid pXS7 DNA and amplified by PCR as described (Davies et al., 1969). The products were cloned into the Hindlll-Accl site of the pBluescript KS- vector. Plasmid pBS55 contains a 55 bp insert corresponding to nucleotides 66496703 of human ape-B cDNA, and plasmid pBS26 contains a 26 bp insert corresponding to nucleotides 66626667. RNAs transcribed from these plasmids contain 47 nucleotides of polylinker sequence in addition to the apo-B mRNA sequences.

RNA Synthesis Linearized plasmid DNA (1 rrg) was transcribed at 3pC for 90 min in 40 mM Tris-HCI (pH 9.25) 6 mM MgClz, 2 mM spermidine. 200 &ml BSA, 10 mM DTT, 200 uM each ATP, CTP GTP, and UTP, and 20 U of T3 or T7 RNA polymerase. The reactions were treated with RNAasefree DNAase I (Boehringer Mannheim) and Pstl (Bethesda Research Laboratories) in the presence of RNAguard (Pharmacia). A Pstl site is present at position 6646 in the human ape-B cDNA sequence. After extraction with phenol-chloroform (l:l), the samples were purified through Sephadex G-50 spin columns. In Vitro Conversion Assay McArdle 7777 rat hepatoma cells (McA-RH7777, ATCC-CR1.1601) were grown in Dulbecco’s modified Eagle’s medium with 10% fetal calf serum to 75%-60% confluency. Nuclear and St00 extracts were prepared as described (Dignam et al., 1963) except that all buffers contained 10 rig/ml each leupeptin and antipain. The protein concentrations of the extracts were determined according to Bradford (1976) and ranged from 16-20 mg/ml. All extracts were stored at 4% or -2oOC, and retained activity for over 3 months. The standard conversion assay contained 2-3 fmol of synthetic RNA, 40-60 pg of SlOO extract, 10 mM HEPES (pH 7.9) 10% glycerol, 50 mM KCI, 20-50 mM EDTA, and 0.25 mM DTT (conversion buffer). In control experiments the RNA was incubated in conversion buffer only. Ribonucleotides, creatine phosphate, or divalent ions were added as described in the text. The reactions were incubated at 30°C for 3 hr and stopped by the addition of an equal volume of 100 mM TrisHCI (pH 75) 10 mM EDTA. 0.4% SDS, 0.2 M NaCI, 200 ug/ml proteinase K. 100 &ml Escherichia coli tANA. After a further incubation at 3ooc for 20 min, the reactions were extracted twice with phenolchloroform (1:i) and once with chloroform, precipitated with ethanol, and analyzed by primer extension.

Prlmer

Extension

Approximately 20 fmol of 32P-labeled oligonucleotide DD3 was mixed with 2-3 fmol of synthetic RNA, heated to 65OC for 10 min, and annealed at 3pc for 60 min in 50 mM PIPES (pH 6.4) 0.2 M NaCI. After ethanol precipitation the annealed products were incubated in 50 mM Tris-HCI (pH 6.2) 6 mM MgClp, 10 mM DTT 500 uM each dATP dCTR and dTTP 250 uM dideoxy-GTP (Pharmacia), and 2 U/n1 Super reverse transcriptase (East Anglian Biotechnology) at 4X for 90 min. The reactions were precipitated with ethanol, fractionated on a 7.5% polyacrylamide-7 M urea gel, and analyzed by autoradiography at -70% with Cronex Lightening Plus intensifying screens (Du Pont).

RNA Analysis Total RNA was isolated from cells using guanidinium isothiocyanate (Chirgwin et al., 1979) and ultracentrifugation through cesium chloride (Glizin et al., 1974). To remove contaminating genomic DNA, RNA was treated with RNAase-free DNAase I (Boehringer Mannheim) and either Pstl or SauM (Bethesda Research Laboratories) in the presence of RNAguard (Pharmacia). A Pstl site is present at position 6646 in the human ape-B sequence, and a Sau3A site is present at position 6673 in the rat ape-B sequence. The first strand of cDNA was synthesized from 10 pg of total RNA as described above for primer extension, using oligo(dT) as primer and AMV reverse transcriptase (Amersham). Cnetenth of a cDNA reaction was enzymatically amplified by PCR using apo-B-specific oligonucleotides and Taq DNA polymerase (PerkinElmer-Cetus) in a reaction containing 10 mM his-HCI (pH 6.3). 1.5 mM

MgCIz, ration mable 55oC, tension boiled

and 200 pM each dATP, dCTP dGTP and dTTF! After denatuat 94% for 5 min, the reactions were amplified using a programDri-Block (Techne) for 25 cycles of 60 set at 91oC, 30 set at and 90 set at 72oC. PCR products were analyzed by primer exas described above, except that 5-20 ng of amplified DNA was for 3 min and chilled on ice before annealing to the primer.

Cloning

and !Sequencing

the Conversion

Product

Approximately one-tenth of a conversion reaction was used for cDNA synthesis and amplification by PCR with oligonucleotides PCA5 and PCRlP as described above. The PCR products were cloned into the EcoRI-Hindlll site of the pBluescript KS- vector, and colony lifts were screened by differential hybridization with a C-specific (BGLN) or T-specific (BSTDP) oligonucleotide. Filters were hybridized at 41°C for 16 hr in 6x SSC, 1% SDS, 05% nonfat dried milk powder (Marvel) with lo6 cpmlml 32P-labeled oligonucleotide. The filters were washed in 6x SSC, 1% SDS for 20 min at room temperature. Discriminating washes were in 6x SSC, 1% SDS for 5 min at 46% for BGLN and at 46% for BSTGP (Powell et al., 1967). Single-stranded DNA was prepared from positive colonies using R406 helper phage (Russell et al., 1966) and analyzed by DNA sequencing using Sequenase (United States Biochemical Corp.).

Acknowledgments We are grateful to Drs. S. Tanabe, R. Hay, and N. Davidson for providing McArdle 7777 cells, Dr. T. Knott for oligonucleotide synthesis, Ms. R. Shah for help with extract preparation, and Ms. L. Sargeant for typ ing the manuscript. We also thank Drs. M. Davies, G. Sargent, L. Powell, R. Pease, T Knott, P Hodges, and L. Graham for helpful discussions and critical reading of the manuscript. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 16 USC. Section 1734 solely to indicate this fact. Received

May 9, 1969; revised

June

16, 1969

References Bass, B. L., and Weintraub, H. (1968). An unwinding activity that covalently modifies its double-stranded RNA substrate. Cell 55, 1069-1093. Benne, R. (1969). RNA-editing Biophys. Acta 1007; 131-139.

in trypanosome

mitochondria.

Biochim.

Bjbrk, G. R., Ericson, J. U., Gustafsson, C. E. E., Havevall, T. G., Jonsson, Y. H., and Wikstrom, l? M. (1967). Transfer RNA modification. Annu. Rev. Biochem. 56, 263-267. Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 246-254. Cattaneo, R., Kaelin, K., Baczko, K., and Billeter, M. A. (1969). Measles virus editing provides an additional cysteine-rich protein. Cell 56, 759-764. Chen, S.-H., Habib, G.. Yang, C.-Y., Gu, Z-W., Lee, B. R., Weng, S-A., Silberman, S. R., Cai, S.-J., Deslypere, J. P, Rosseneu, M., Gotto, A. M., Jr.. Li, W.-H., and Chan, L. (1967). Apolipopmtein B-46 is the product of a messenger RNA with an organ-specific in-frame translational stop codon. Science 328, 363-366. Chen-Kiang, S., Nevins, J. R., and Darnell. J. E., Jr. (1979). N-&methyl adenosine type 2 nuclear RNA is conserved in the formation of messenger RNA. J. Mol. Biol. 135, 733-752. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979). Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 78, 5294-5299. Davidson, N. 0.. Powell, L. hf., Walks, S. C., and Scott, J. (1968). Thyroid hormone modulates the introduction of a stop codon in the rat liver apolipoprotein B messenger RNA. J. Biol. Chem. 263, 13462-13465. Davies, M. S., Walks, S. C.. Driscoll, D. M., Wynne, J. K., Williams, G. W., Powell, L. M., and Scott, J. (1969). Sequence requirements for apolipoprotein-B mRNA editing in transfected rat hepatoma cells. J. Biol. Chem., in press.

Apo-B 525

mRNA

Editing

In Vitro

Dignam. T. D., Lebovitz, Ft. M., and Aoeder, R. G. (1983). Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucl. Acids Res. 77, 1475-1489. Glizin, V., Crkvengakov, R., and Byns, lated by cesium chloride centrifugation.

C. (1974). Ribonucleic acid isoBiochemistry 13, 2633-2837.

Grummt, I. (1981). Specific transcription a cell-free system that mimics control USA 78, 727-731.

of mouse ribosomal DNA in in vitro. Proc. Natl. Acad. Sci.

Higuchi. K., Hospattankar, A. V., Law, S. W., Meglin. N., Cartwright. J., and Brewer, H. B., Jr. (1986). Human apolipoprotein B (apo B) mRNA: identification of two distinct apo B mRNAs, mRNA with the apo B-100 sequence and an apo B mRNA containing a premature in-frame translational stop codon in both liver and intestine. Proc. Natl. Acad. Sci. USA 85, 1772-1776. Hospattankar, A. V., Higuchi. K.. Law, S. W., Meglin. N. M., and Brewer, H. B., Jr. (1987). Identification of a novel in-frame translational stop codon in human intestine apo B mRNA. Biochem. Biophys. Res. Commun. 148, 279-285. Kane, J. P (1983). Apolipoprotein 8: structural neity. Annu. Rev. Physiol. 45, 637-650.

and metabolic

heteroge-

Knott, T. J.. Pease, R. J., Powell, L. M., Wallis, S. C., Rail, S. C., Jr., Innerarity, T. L., Blackhart, B., Taylor, W. H., Marcel, Y., Milne, R., Lusis, A. J., McCarthy, B. J.. Mahley, R. W., Levy-Wilson, B., and Scott, J. (1986). Complete protein sequence and identification of structural domains of human apolipoprotein B-100. Nature 323, 734-738. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual (Cold Spring Harbor, New York: Cold Spring Harbor Laboratory). Narayan, P. and Rottman, ation of internal adenosine 1159-1162.

F. M. (1988). An in vitro system for methylresidues in messenger RNA. Science 242,

Powell, L. M., Wallis, S. C., Pease, R. J., Edwards, Y. H., Knott, T. J., and Scott, J. (1987). A novel form of tissue-specific RNA processing produces apolipoproteinB48 in intestine. Cell 50. 831-840. Russell, M.. Kidd, S., and Kelly, M. R. (1986). An improved filamentous helper phage for generating single-stranded plasmid DNA. Gene 45, 333-338. Tennyson, G. E., Sabatos, C. A., Higuchi, K., Meglin, N., and Brewer, H. B., Jr. (1989). Expression of apolipoprotein B mRNAs encoding higher- and lower-molecular weight isoproteins in rat liver and intestine. Proc. Natl. Acad. Sci. USA 86, 500-504. Thomas, S. M., Lamb, R. A., and Paterson, R. G. (1988). Two mRNAs that differ by two nontemplated nucleotides encode the amino coterminal proteins P and V of the paramyxovirus SV5. Cell 54, 891-902.