- Email: [email protected]
Ethanol Increases Apolipoprotein B mRNA Editing in Rat Primary Hepatocytes and McArdle Cells
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.
252, 334 –339 (1998)
RC989647
Ethanol Increases Apolipoprotein B mRNA Editing in Rat Primary Hepatocytes and McArdle Cells David Van Mater,* Mark P. Sowden,* Joanne Cianci,† Janet D. Sparks,† Charles E. Sparks,† Nazzareno Ballatori,‡ and Harold C. Smith*,†,‡,1 Departments of *Biochemistry and Biophysics, †Environmental Medicine and ‡Pathology and Laboratory Medicine, University of Rochester School of Medicine and Dentistry, Rochester, New York 14642
Received October 8, 1998
Apolipoprotein B (apoB) mRNA editing involves a sitespecific cytidine to uridine transition catalyzed by the cytidine deaminase, APOBEC-1, in the context of and regulated by a multi-protein-containing editosome. ApoB mRNA editing in vivo is subject to tissue specific, developmental and metabolic regulation. We demonstrate for the first time that the amount of edited apoB mRNA in rat primary hepatocytes is markedly increased subsequent to transient treatment with ethanol in vitro. The apparent change in editing efficiency was dosedependent (from 0.1%–2.4% initial ethanol dose) and occurred with rapid onset. The proportion of edited apoB mRNA was also markedly enhanced in a rat hepatoma cell line, McArdle RH7777 cells and in a stable McArdle cell line over-expressing APOBEC-1 by transient treatment with 2.5 % ethanol. In contrast, the apoB mRNA editing in a human hepatoma cell line, HepG2 cells and a stable HepG2 cell line over-expressing APOBEC-1 did not respond to ethanol treatment. The data support the possibility that editing activity is ethanol-responsive but suggest that this change is cell type-specific. © 1998 Academic Press
Apolipoprotein B (apoB) mRNA editing is a posttranscriptional, site specific deamination of a cytidine residue to a uridine at nucleoside position 6666 (1, 2). Nucleoside transition converts a glutamine codon (CAA) at amino acid position 2153 to an in-frame translation stop codon (UAA) resulting in the translation of a shorter protein, apoB48 instead of the full length protein, apoB100. These protein variants have different physiological effects on lipoprotein assembly, secretion and uptake by peripheral cells and only very low density lipoproteins (VLDL) containing B100 are converted to low density lipoproteins (LDL), an atherogenic risk factor. The editing site consists of a tripartite 1 Corresponding author. Fax: (716) 273-1027. E-mail: harold_smith@ urmc.rochester.edu.
0006-291X/98 $25.00 Copyright © 1998 by Academic Press All rights of reproduction in any form reserved.
arrangement of cis-acting elements of which the ‘mooring sequence’ is necessary and sufficient for the assembly of a macromolecular complex or ‘editosome’ that directs editing of an appropriately positioned 59 cytidine (4 – 6). ApoB RNA editing is a zinc-dependent process mediated by a cytidine deaminase, APOBEC-1 (7–9). RNA editing activity of APOBEC-1 is dependent upon its assembly with multiple auxiliary proteins within the context of editosomes (7, 9 –12). To date, candidate auxiliary proteins include heterogeneous ribonucleoproteins (hnRNP) C and an hnRNP A/B homolog ABBP-1 (13, 14), mooring sequence-selective RNA binding proteins of 100 kDa, 66 kDa and 55 kDa (9,12,15,16), general RNA binding proteins 40-44 kDa (12, 17) and a protein complex, AUX240, identified by a 240 kDa antigenic protein (16). ApoB mRNA editing is expressed tissue-specifically and the efficiency of editing is regulated metabolically, hormonally and during tissue development (reviewed in 18,19). Recent studies have revealed that depending on the specific type of regulation, the efficiency of editing can be altered by regulating the expression of APOBEC-1 (20 –22) or through other means that have been inferred to involve the auxiliary proteins (20, 23). Mapping of APOBEC-1 protein domains suggested that regulation of apoB mRNA editing might also involve the trafficking of APOBEC-1 between the cytoplasm and the nucleus (24). Particularly relevant to studies described here was the finding that hepatic apoB mRNA editing efficiency was elevated without increases in apobec-1 mRNA levels when rats were fed ethanol as 35.5% of their total daily caloric intake (23). In this study we have established a rat primary hepatocyte in vitro model system for evaluating ethanol-stimulated apoB mRNA editing. We demonstrate a rapid onset and marked stimulation in editing when primary cultures of rat hepatocytes are treated transiently in vitro with 0.1-2.5 % ethanol. Rat hepatoma, McArdle cells with or without over-expression of
334
Vol. 252, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
APOBEC-1 also demonstrated a rapid onset and marked stimulation in editing efficiency upon transient exposure to 2.5% ethanol. Editing activity in human hepatoma, HepG2 cells with or without overexpression of APOBEC-1 did not respond to ethanol treatment. MATERIALS AND METHODS Preparation of rat primary hepatocytes and tissue culture. Hepatocytes were prepared from unfasted, male Sprague-Dawley rats (250 –275 g body weight, Taconic Farms) fed ad libitum normal rat chow. Hepatocytes were released by the type 2 collagenase digestion method (25) and in most analyses were purified by Percoll gradient sedimentation (26). Hepatocytes were plated on rat tail collagen (type I)-coated plastic 60 mm Petri dishes (Beckton Dickinson, NJ) in two mls of Waymouth’s 752/1 media containing 0.2% bovine serum albumin (Sigma Chemical Co., MO) and 0.1 nM porcine insulin (Sigma) and antibiotics as described previously (27) at a cell density of 1 X 106 cells/dish. Hepatocyte cultures were rinsed free of unattached cells 2– 4 hours after plating and then treated as described in the text. Cell viability was determined by trypan blue exclusion and was typically 85%–90% at the time of seeding. McArdle RH7777 and HepG2 cells were obtained from ATCC (Rockville, MD) and cultured as recommended in 2.0 mls of media on uncoated plastic 60 mm Falcon 3002 Petri dishes (28). Stable cell lines of McArdle and HepG2 cells over-expressing APOBEC-1 were prepared and selected as described previously (28-30). Cells were treated with ethanol by rapidly mixing an appropriate aliquot of ethyl alcohol (AAPER Alcohol and Chem. Co., KY) into the media. RNA isolation. Total cellular RNA was isolated from cells using the Tri-Reagent (Molecular Research Center, MRC, OH) according to the manufacturer’s recommendation. After isopropanol precipitation, RNAs were digested with RQ-DNase I (Promega, Corp., WI) and with a restriction enzyme(s) having a recognition site between the PCR primer annealing sites of target substrates as previously described (30). Editing assays. The proportion of editing upon apoB RNAs synthesized in rat and human cells was determined by the reverse transcriptase-polymerase chain reaction, (RT-PCR) methodology described previously (28 –30). First strand cDNA was synthesized using oligo dT-primed total cellular RNA. Specific PCR amplification of rat and human apoB sequences was accomplished using ND1/ND2 and PCR5/PCR12 amplimer pairs respectively. Cycling conditions were 1 cycle at 94°C for 3 min; 5 cycles at 94°C for 30 s, 55 or 50°C (for rat or human sequence respectively) for 2 min, 72°C for 2 min; followed by 25 cycles of 94°C for 30 s, 55 or 50°C (for rat or human sequence respectively) for 90 s, 72°C for 90 s; and complete with one cycle of 72°C for 3 min. PCR products were gel isolated and the editing efficiencies determined by the poisoned primer-extension assay using [g-32P] ATP (6000 mCi/mmol; NEN) end-labeled DD3 primer as described previously (28 –30). Primer-extension products were resolved on a 10% denaturing polyacrylamide gel, autoradiographed and then quantified by laser densitometric scanning (Phosphorimager Model 425E, Molecular Dynamics). Percent editing was determined as the activity in the UAA (edited) plus CAA (unedited) bands divided into that of the UAA band and multiplied by 100. Ethanol analysis. At the indicated times, an aliquot of media was removed to a sealed tube and stored on ice until the time of analysis. Ethanol in the media was quantified by the Emit ethyl alcohol in vitro assay kit (Behring Diagnostics Inc., CA) and analyzed on a Hitachi 911 Chemical Analyzer.
FIG. 1. Editing efficiency in hepatocytes during culture. Rat primary hepatocytes were prepared and cultured and apoB mRNA editing was assayed as described in Materials and Methods after the indicated hours in continuous culture (top). Percent edited apoB mRNA was calculated as described in Materials and Methods and are given below each lane.
Deoxy oligonucleotides used in this study. DD3 ND1 ND2 PCR5 PCR12
59 AATCATGTAAATCATAACTATCTTTAATATACTGA39 59 ATCTGACTGGGAGAGACAAGTAG 39 59 GTTCTTTTTAAGTCCTGTGCATC 39 59 CTGAATTCATTCAATTGGGAGAGACAAG 39 59 AACAAATGTAGATCATGG 39
RESULTS Stability of the apoB mRNA editing activity in cultured primary hepatocytes. To determine how culture conditions affect the ability of rat primary hepatocytes to edit apoB mRNA, total cellular RNA was isolated from primary hepatocytes after the indicated times of continuous culture and assayed for apoB mRNA editing efficiency as described in Materials and Methods. ApoB mRNA editing efficiency in isolated hepatocytes varied with each individual rat and ranged from 38% to 58% (1/2 6% SEM, n512) at the time of their preparation and before they were plated but remained relatively constant for each preparation of cells during the first 48 hours in culture (Figure 1). Thereafter however, the amount of edited apoB mRNA in cells declined. The cell number increased by approximately 15% by 72 hr (indicative of proliferation) and the amount of edited apoB mRNA decreased to 18% following 96 hr of continuous culture. All subsequent analyses with primary hepatocytes were performed between 2 and 20 hours of continuous culture. Ethanol treatment of hepatocytes increased the proportion of edited apoB mRNA. Hepatocytes were treated with the indicated dose of ethanol in unsealed dishes, thereby allowing some of the ethanol to dissipate over time (see Figure 6A). An increase in the proportion of edited apoB mRNA was apparent in hepatocytes treated with an initial dose of 0.1% ethanol relative to untreated controls 18 h after treatment (Figure 2). Treatment of hepatocytes with higher initial doses of ethanol (up to 0.79 %) resulted in an increased proportion of edited apoB mRNA. Cell via-
335
Vol. 252, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. The proportion of edited apoB mRNA in ethanol-treated hepatocytes. Purified rat primary hepatocytes were treated with an initial dose of ethanol indicated at the top of each lane for 18 h and the proportion of edited apoB mRNA (shown at the bottom of each lane) determined.
bility (based on cell counts and trypan blue exclusion) remained comparable to that in untreated cultures (95 %–98 %) even in those cultures that had been treated with 2.5 % ethanol. The relative proportion of edited RNA increased rapidly, reaching a peak within 2 h in hepatocytes treated with 2.5 % ethanol revealed that (Figure 3). After a slight decline, the proportion of edited apoB mRNA remained constant through 18 h of culture. Response of McArdle cells to ethanol treatment. To evaluate the generality of the ethanol effect, McArdle cells were treated with ethanol under similar conditions of culture and cell density as those used to treat primary hepatocytes. The proportion of edited apoB mRNA did not change in McArdle cells treated with 0.7 % ethanol but did respond when the cells were treated with 2.5 % ethanol (Figure 4, left panel). To evaluate the potential role of auxiliary proteins in the change in apoB mRNA editing, a system must be used in which APOBEC-1 is not rate limiting. A stable McArdle cell line over-expressing APOBEC-1 (McAPOBEC) was therefore selected as the experimental subject. These cells have basal levels of editing activity greater than 8-fold higher than that in the parental McArdle cell line due to an increased expression of APOBEC-1 (Figure 4, right panel). Importantly, the increased transcription of apobec-1 mRNA which is directed by the CMV promoter is constitutive and not responsive to physiologic regulation.
FIG. 3. Kinetics of the ethanol effect on edited apoB mRNA. Purified rat primary hepatocytes were treated with an initial dose of 0.7% ethanol and the proportion of edited apoB mRNA determined at various times up to 18h.
FIG. 4. ApoB mRNA editing in ethanol-treated McArdle and McAPOBEC cell lines. The parental McArdle cell line and a McArdle cell line over-expressing APOBEC-1 (McAPOBEC) were treated with the initial dose of ethanol indicated above each lane (2.5 % for McAPOBEC cells) and the proportion of edited apoB mRNA (indicated below each lane) determined after 18 h (McArdle) or at the times after treatment indicated above each lane (McAPOBEC). Additional editing sites (promiscuous editing) were apparent in McAPOBEC apoB mRNA and are indicated as primer extension bands 1 and 2 (right panel).
The proportion of edited apoB mRNA in McAPOBEC cells increased form 69% to 92% upon treatment with 2.5 % ethanol. The increase was evident as early as 5 min after treatment with ethanol and continued to rise over the 2 h assay period (Figure 4, right panel). Editing in HepG2 cells is not responsive to ethanol. To evaluate the generality of the editing response to ethanol HepG2 cells were treated with ethanol under conditions and cell densities similar to those used for primary hepatocytes. As predicted (18, 19) apoB mRNA editing activity in HepG2 was extremely low and at the detection limit of our primer extension assay (Figure 5, left panel). The proportion of edited RNA did not change in HepG2 cells treated with ethanol. Over-expression of APOBEC-1 in HepG2 cells (HepG2-APOBEC stable cell line) increased apoB mRNA editing efficiency in these cells but not to the same absoultely level of edited apoB mRNA as that which was possible in a McArdle cell background (Figure 5, right panel, and ref. 28). Moreover, overexpression of APOBEC-1 in HepG2 cells always induced promiscuous editing activity at C6655 (right panel and refs. 28, 29). Ethanol treatment of HepG2APOBEC cells did not significantly alter the proportion of edited RNA beyond the change already induced by APOBEC-1 over-expression (although a small change was apparent in cells treated with 2.5 % ethanol). Transient nature of the ethanol dose. The high levels of some of the ethanol doses used to treat cells in this study did not affect cell viability in all of the three types of cells tested. One possible explanation for this is that
336
Vol. 252, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 5. ApoB mRNA editing in ethanol-treated HepG2 and HepG2-APOBEC cell lines. The parental HepG2 cell line and a HepG2 cell line over-expressing APOBEC-1 (HepG2-APOBEC) were treated with the initial dose of ethanol indicated above each lane and the proportion of edited apoB mRNA in each condition determined after 18 h of treatment. The proportion of promiscuously edited apoB mRNA in each condition is given as percent editing at C6655 below each lane.
the dissipation of the initial ethanol dose was sufficient to spare cells from longer term consequences of ethanol toxicity. Ethanol concentrations in the media were assayed as described in Material and Methods in either collagen coated plates containing 2 ml of media and 0.7% ethanol with or without primary hepatocytes (Figure 6A) or in plastic dishes containing 2 ml of media and 2.5% ethanol with or without McArdle cells (Figure 6B). The data demonstrated that under all conditions, the initial ethanol dose rapidly dissipated so that by 2 h only 70% and 50% of the initial 0.7% and 2.5% ethanol doses respectively remained. By 18 h, only 10–20% of the initial doses remained in the media. The data also demonstrated that the decline in ethanol concentration in the media was enhanced 16 % (1/2 3 % S.E.M., n53) when primary hepatocytes were present, indicative of ethanol metabolism by the cells, but that the presence of McArdle cells did not affect the ethanol concentration in the media beyond that due to dissipation alone at the ethanol dose that was concentration tested.
from measured changes in apobec-1 mRNA abundance under a variety of developmental, hormonal and metabolic states (18, 19, 20 –22). In contrast, alterations in apoB mRNA editing efficiency have been observed under conditions where the abundance of apobec-1 mRNA did not appear to change (20, 23). Regulation of auxiliary protein abundance and/or function or the trafficking of editing machinery to the nucleus has been suggested as explanations for regulation of apoB mRNA editing in these situations. To examine the potential role of auxiliary proteins in the enhanced editing of apoB mRNA in the liver of rats consuming alcohol (23), we evaluated the response of rat primary hepatocytes and four cell lines to treatment by ethanol. The data demonstrated an increased proportion of edited apoB mRNA in primary hepatocytes, McArdle cells and McAPOBEC cells treated with ethanol. The proportion of edited apoB mRNA in HepG2 and HepG2-APOBEC cells was refractory to change through ethanol treatment. The change in the proportion of edited apoB RNA could be induced at lower ethanol doses in primary hepatocytes than in McArdle or McAPOBEC cells. One explanation for this may lie in the relative ability of these cell types to metabolize ethanol. This interpretation cannot be reconciled with the finding that the highest level of edited apoB mRNA induced by ethanol treatment (92%) was observed in McAPOBEC cells and that the greatest magnitude of this change over untreated cells was observed in McArdle cells (2-fold). In both primary hepatocytes and McArdle cell lines the change in proportion of edited apoB mRNA occurred rapidly and reached near maximum proportions
DISCUSSION The current focus in the apoB mRNA editing field is on the mechanism by which the process can be regulated. In this regard, increased APOBEC-1 expression increased the proportion of edited apoB mRNA in cells and in the liver of transgenic animals (18, 19, 28 –32). Regulation of apoB mRNA editing efficiency via alterations in APOBEC-1 abundance has been inferred
FIG. 6. Change in ethanol concentration in the media. A) The ethanol concentration in the media was assayed over time from collagen-coated Petri dishes that contained only 2 mls of media (control) or contained 2 mls of media plus hepatocytes (at 90% of confluency) and that had been treated with an initial dose of 0.7 % ethanol at t50. B) Ethanol concentration analysis of media from Petri dishes that contained only 2 mls of media (control) or contained 2 mls of media plus McArdle cells (at 90% of confluency) and that had been treated with an initial dose of 2.5 % ethanol at t50.
337
Vol. 252, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
2 h following treatment. At this time the ethanol measured in the media was 50%–70% of the initial dose. Given that low initial doses of ethanol were less or not effective, the data suggest that the cellular and molecular mechanism(s) responsible for altering the proportion of edited apoB mRNA are activated or induced very rapidly upon exposure of cells to a threshold concentration of ethanol. At this point we do not know whether the proportion of edited apoB mRNA is increased by treatment of cells with ethanol through an induction or activation of the editing machinery alone, or whether RNA synthesis or a selective degradation of unedited apoB mRNA might also be involved (30, 33). Ongoing research is addressing these questions. It is important to keep in mind however that the changes in the proportion of edited apoB mRNA occurred within the context of purified primary hepatocytes or in cell lines and therefore mechanistic hypotheses need not evoke factors from non-hepatic cells or tissues to explain the effect of ethanol on this form of RNA processing. Our data also indicate that changes in the proportion of edited apoB mRNA in the liver of alcohol fed rats was due to alterations in the regulation of apoB mRNA editing activity through the auxiliary proteins, supporting previous studies with ethanol fed rats (23). APOBEC-1 abundance is rate limiting in McArdle cells but the abundance of auxiliary proteins are sufficiently high so as to support additional editing activity when APOBEC-1 is experimental over-expressed (8% to 69% edited apoB mRNA in McArdle and McAPOBEC cells respectively). Although the magnitude of change in the proportion of edited apoB mRNA in response to ethanol treatment was greater in McArdle cells (8 % to 25 %) than in McAPOBEC cells (69 % to 92 %), the actual change in all cell types was similar (between 17 % and 25 %). Thus unlike the dramatic change in apoB mRNA editing efficiency that is apparent when APOBEC-1 abundance is changed, the ethanol induced change was comparatively small and therefore may involve more subtle changes in editosome activity or in nuclear trafficking than those that might be envisaged if the abundance of auxiliary proteins had to change. Our findings do suggest however that one or more auxiliary proteins may be rate limiting in HepG2 cells. ACKNOWLEDGMENTS We are grateful to Jenny M.L. Smith for the preparation of the figures. This work was supported by Public Health Services grants HL29837, DK50376, ES01247 and DK43739 awarded to CES, JDS, NB and HCS respectively, by grants from The Council for Tobacco Research and the Rochester Area Pepper Center for Research on Aging awarded to HCS and by grants to MPS from the University of Rochester Environmental Health Sciences Center pilot projects program.
REFERENCES 1. Chen, S.-H., Habib, G., Yang, C. Y., Gu, Z. W., Lee, B. R., Weng, S. A., Silberman, S. R., Cai, S. J., Deslypere, J. P., Rosseneu, M., Gotto, A. M., Li, W. H., and Chan, L. (1987) Science 238, 363–366. 2. Powell, L. M., Wallis, S. C., Pease, R. J., Edwards, Y. H., Knott, T. J., and Scott, J. (1987) Cell 50, 831– 840. 3. Smith, H. C., Kuo, S.-R., Backus, J. W., Harris, S. G., Sparks, C. E., and Sparks, J. D. (1991) Proc. Natl. Acad. Sci USA 88, 1489 –1493. 4. Harris, S. G., Sabio, I., Mayer, E., Steinburg, M. F., Backus, J. W., Sparks, J. D., Sparks, C. E., and Smith, H. C. (1993) J. Biol. Chem 268, 7382–7392. 5. Backus, J. W., and Smith, H. C. (1992) Nucleic Acids Res. 20, 6007– 6014. 6. Backus, J. W., Schock, D., and Smith, H. C. (1994) Biochim. Biophys. Acta 1219, 1–14. 7. Teng, B., Burant, C. F., and Davidson, N. O. (1993) Science 260, 1816 –1819. 8. Barnes, C., and Smith, H. C. (1993) Biochem. and Biophys. Res. Comm. 197, 1410 –1414. 9. Navaratnam, N., Morrison, J. R., Bhattacharya, S., Patel, D., Funahachi, T., Giannoni, F., Teng, B.-B., Davidson, N. O., and Scott, J. (1993) J. Biol. Chem. 268, 20709 –20712. 10. Driscoll, D. M., and Zhang, Q. (1994) J. Biol. Chem. 269, 19843– 19847. 11. Yamanaka, S., Poksay, K. S., Balestra, M., Zeng, G.-Q., and Innerarity, T. L. (1994) J. Biol. Chem. 269, 21725– 21734. 12. Yang, Y. Yang, Y., Kovalski, K., and Smith, H. C. (1997) J. Biol. Chem. 272, 27700 –27706. 13. Greeve, J., Lellek, H., Rautenberg, P., and Greten, H. (1998) Biol. Chem. 379, 1063–1074. 14. Lau, P. P., Zhu, H. K. J., Baldini, A., Chen, S. H., and Chan, L. (1997) J. Biol. Chem. 272, 1452–1455. 15. Navaratnam, N., Shah, R., Patel, D., Fay, V., and Scott, J. (1993) Proc. Natl. Acad. Sci. USA, 90, 222–226. 16. Mehta, A., and Driscoll, D. M. (1998) Molec. Cell. Biol. 18, 4426 – 4432. 17. Lau, P. P., Chen, S.-H., Wang, J. C., and Chan, L. (1990) Nucleic Acids Res. 18, 5817–5821. 18. Smith, H. C., and Sowden, M. P. (1996) Trends in Genetics 12, 418 – 424. 19. Chan, L., Chang, B. H.-J., Nakamuta, M., Li, W.-H., and Smith, L. C. (1997) Biochim. Biophys. Acta 1345, 11–26. 20. Funahashi, T., Giannoni, F., DePaoli, A. M., Skarosi, S. F., and Davidson, N. O. (1995) J. Lipid Res. 36, 414 – 428. 21. Giannoni, F., Chou, S.-C., Skarosi, S. F., Verp, M. S., Field, F. J., Coleman, R. A., and Davidson, N. O. (1995) J. Lipid Res. 36, 1664 –1675. 22. Phung, T. L., Sowden, M. P., Sparks, J. D., Sparks, C. E., and Smith, H. C. (1996) Metabolism 45, 1056 –1058. 23. Lau, P. P., Cahill, D. J., Zhu, H.-J., and Chan, L. (1995) J. Lipid Res. 36, 2069 –2078. 24. Yang, Y., Yang, Y., and Smith, H. C. (1997) Proc. Natl. Acad. Sci. USA 94, 13075–13080. 25. Sparks, C. E., Sparks, J. D., Bolognino, M. Salhanick, A., Strumph, P. S., and Amatruda, J. M. (1966) Metabolism 35, 1128 –1136.
338
Vol. 252, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
26. Okada, T., Sakuma, L., Fukui, Y., Haxeki, O., and Ui, M. (1994) J. Biol. Chem. 269, 3563–3567. 27. Phung, T. L., Roncone, A., de Mesy Jensen, K. L., Sparks, C. E., and Sparks, J. D. (1997) J. Biol. Chem. 272, 30693– 30702. 28. Sowden, M. P., Eagleton, M. J., and Smith, H. C. (1998) Nucleic Acids Res. 26, 1644 –1652. 29. Sowden, M. P, Hamm, J. K., and Smith, H. C. (1996) J. Biol. Chem. 270, 3011–3017.
30. Sowden, M. Hamm, J. K., Spinelli, S., and Smith, H. C. (1996) RNA, 2, 274 –288. 31. Nakamuta, M., Chang, B. H.-J., Zigmond, E., Kobayashi, K., Lei, H., Ishida, Y., Oka, K., Li, E., and Cahn, L. (1966) J. Biol. Chem. 271, 25981–25988. 32. Qian, X., Balestra, M. E., Yamanaka, S., Bore´n, J., Lee, I., and Innerarity, T. L. (1998) Arterioscler. Thromb. Vasc. Biol. 18, 1013–1020. 33. Chen, L., and Chan, L. (1996) J. Theor. Biol. 183, 391– 407.
339
252, 334 –339 (1998)
RC989647
Ethanol Increases Apolipoprotein B mRNA Editing in Rat Primary Hepatocytes and McArdle Cells David Van Mater,* Mark P. Sowden,* Joanne Cianci,† Janet D. Sparks,† Charles E. Sparks,† Nazzareno Ballatori,‡ and Harold C. Smith*,†,‡,1 Departments of *Biochemistry and Biophysics, †Environmental Medicine and ‡Pathology and Laboratory Medicine, University of Rochester School of Medicine and Dentistry, Rochester, New York 14642
Received October 8, 1998
Apolipoprotein B (apoB) mRNA editing involves a sitespecific cytidine to uridine transition catalyzed by the cytidine deaminase, APOBEC-1, in the context of and regulated by a multi-protein-containing editosome. ApoB mRNA editing in vivo is subject to tissue specific, developmental and metabolic regulation. We demonstrate for the first time that the amount of edited apoB mRNA in rat primary hepatocytes is markedly increased subsequent to transient treatment with ethanol in vitro. The apparent change in editing efficiency was dosedependent (from 0.1%–2.4% initial ethanol dose) and occurred with rapid onset. The proportion of edited apoB mRNA was also markedly enhanced in a rat hepatoma cell line, McArdle RH7777 cells and in a stable McArdle cell line over-expressing APOBEC-1 by transient treatment with 2.5 % ethanol. In contrast, the apoB mRNA editing in a human hepatoma cell line, HepG2 cells and a stable HepG2 cell line over-expressing APOBEC-1 did not respond to ethanol treatment. The data support the possibility that editing activity is ethanol-responsive but suggest that this change is cell type-specific. © 1998 Academic Press
Apolipoprotein B (apoB) mRNA editing is a posttranscriptional, site specific deamination of a cytidine residue to a uridine at nucleoside position 6666 (1, 2). Nucleoside transition converts a glutamine codon (CAA) at amino acid position 2153 to an in-frame translation stop codon (UAA) resulting in the translation of a shorter protein, apoB48 instead of the full length protein, apoB100. These protein variants have different physiological effects on lipoprotein assembly, secretion and uptake by peripheral cells and only very low density lipoproteins (VLDL) containing B100 are converted to low density lipoproteins (LDL), an atherogenic risk factor. The editing site consists of a tripartite 1 Corresponding author. Fax: (716) 273-1027. E-mail: harold_smith@ urmc.rochester.edu.
0006-291X/98 $25.00 Copyright © 1998 by Academic Press All rights of reproduction in any form reserved.
arrangement of cis-acting elements of which the ‘mooring sequence’ is necessary and sufficient for the assembly of a macromolecular complex or ‘editosome’ that directs editing of an appropriately positioned 59 cytidine (4 – 6). ApoB RNA editing is a zinc-dependent process mediated by a cytidine deaminase, APOBEC-1 (7–9). RNA editing activity of APOBEC-1 is dependent upon its assembly with multiple auxiliary proteins within the context of editosomes (7, 9 –12). To date, candidate auxiliary proteins include heterogeneous ribonucleoproteins (hnRNP) C and an hnRNP A/B homolog ABBP-1 (13, 14), mooring sequence-selective RNA binding proteins of 100 kDa, 66 kDa and 55 kDa (9,12,15,16), general RNA binding proteins 40-44 kDa (12, 17) and a protein complex, AUX240, identified by a 240 kDa antigenic protein (16). ApoB mRNA editing is expressed tissue-specifically and the efficiency of editing is regulated metabolically, hormonally and during tissue development (reviewed in 18,19). Recent studies have revealed that depending on the specific type of regulation, the efficiency of editing can be altered by regulating the expression of APOBEC-1 (20 –22) or through other means that have been inferred to involve the auxiliary proteins (20, 23). Mapping of APOBEC-1 protein domains suggested that regulation of apoB mRNA editing might also involve the trafficking of APOBEC-1 between the cytoplasm and the nucleus (24). Particularly relevant to studies described here was the finding that hepatic apoB mRNA editing efficiency was elevated without increases in apobec-1 mRNA levels when rats were fed ethanol as 35.5% of their total daily caloric intake (23). In this study we have established a rat primary hepatocyte in vitro model system for evaluating ethanol-stimulated apoB mRNA editing. We demonstrate a rapid onset and marked stimulation in editing when primary cultures of rat hepatocytes are treated transiently in vitro with 0.1-2.5 % ethanol. Rat hepatoma, McArdle cells with or without over-expression of
334
Vol. 252, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
APOBEC-1 also demonstrated a rapid onset and marked stimulation in editing efficiency upon transient exposure to 2.5% ethanol. Editing activity in human hepatoma, HepG2 cells with or without overexpression of APOBEC-1 did not respond to ethanol treatment. MATERIALS AND METHODS Preparation of rat primary hepatocytes and tissue culture. Hepatocytes were prepared from unfasted, male Sprague-Dawley rats (250 –275 g body weight, Taconic Farms) fed ad libitum normal rat chow. Hepatocytes were released by the type 2 collagenase digestion method (25) and in most analyses were purified by Percoll gradient sedimentation (26). Hepatocytes were plated on rat tail collagen (type I)-coated plastic 60 mm Petri dishes (Beckton Dickinson, NJ) in two mls of Waymouth’s 752/1 media containing 0.2% bovine serum albumin (Sigma Chemical Co., MO) and 0.1 nM porcine insulin (Sigma) and antibiotics as described previously (27) at a cell density of 1 X 106 cells/dish. Hepatocyte cultures were rinsed free of unattached cells 2– 4 hours after plating and then treated as described in the text. Cell viability was determined by trypan blue exclusion and was typically 85%–90% at the time of seeding. McArdle RH7777 and HepG2 cells were obtained from ATCC (Rockville, MD) and cultured as recommended in 2.0 mls of media on uncoated plastic 60 mm Falcon 3002 Petri dishes (28). Stable cell lines of McArdle and HepG2 cells over-expressing APOBEC-1 were prepared and selected as described previously (28-30). Cells were treated with ethanol by rapidly mixing an appropriate aliquot of ethyl alcohol (AAPER Alcohol and Chem. Co., KY) into the media. RNA isolation. Total cellular RNA was isolated from cells using the Tri-Reagent (Molecular Research Center, MRC, OH) according to the manufacturer’s recommendation. After isopropanol precipitation, RNAs were digested with RQ-DNase I (Promega, Corp., WI) and with a restriction enzyme(s) having a recognition site between the PCR primer annealing sites of target substrates as previously described (30). Editing assays. The proportion of editing upon apoB RNAs synthesized in rat and human cells was determined by the reverse transcriptase-polymerase chain reaction, (RT-PCR) methodology described previously (28 –30). First strand cDNA was synthesized using oligo dT-primed total cellular RNA. Specific PCR amplification of rat and human apoB sequences was accomplished using ND1/ND2 and PCR5/PCR12 amplimer pairs respectively. Cycling conditions were 1 cycle at 94°C for 3 min; 5 cycles at 94°C for 30 s, 55 or 50°C (for rat or human sequence respectively) for 2 min, 72°C for 2 min; followed by 25 cycles of 94°C for 30 s, 55 or 50°C (for rat or human sequence respectively) for 90 s, 72°C for 90 s; and complete with one cycle of 72°C for 3 min. PCR products were gel isolated and the editing efficiencies determined by the poisoned primer-extension assay using [g-32P] ATP (6000 mCi/mmol; NEN) end-labeled DD3 primer as described previously (28 –30). Primer-extension products were resolved on a 10% denaturing polyacrylamide gel, autoradiographed and then quantified by laser densitometric scanning (Phosphorimager Model 425E, Molecular Dynamics). Percent editing was determined as the activity in the UAA (edited) plus CAA (unedited) bands divided into that of the UAA band and multiplied by 100. Ethanol analysis. At the indicated times, an aliquot of media was removed to a sealed tube and stored on ice until the time of analysis. Ethanol in the media was quantified by the Emit ethyl alcohol in vitro assay kit (Behring Diagnostics Inc., CA) and analyzed on a Hitachi 911 Chemical Analyzer.
FIG. 1. Editing efficiency in hepatocytes during culture. Rat primary hepatocytes were prepared and cultured and apoB mRNA editing was assayed as described in Materials and Methods after the indicated hours in continuous culture (top). Percent edited apoB mRNA was calculated as described in Materials and Methods and are given below each lane.
Deoxy oligonucleotides used in this study. DD3 ND1 ND2 PCR5 PCR12
59 AATCATGTAAATCATAACTATCTTTAATATACTGA39 59 ATCTGACTGGGAGAGACAAGTAG 39 59 GTTCTTTTTAAGTCCTGTGCATC 39 59 CTGAATTCATTCAATTGGGAGAGACAAG 39 59 AACAAATGTAGATCATGG 39
RESULTS Stability of the apoB mRNA editing activity in cultured primary hepatocytes. To determine how culture conditions affect the ability of rat primary hepatocytes to edit apoB mRNA, total cellular RNA was isolated from primary hepatocytes after the indicated times of continuous culture and assayed for apoB mRNA editing efficiency as described in Materials and Methods. ApoB mRNA editing efficiency in isolated hepatocytes varied with each individual rat and ranged from 38% to 58% (1/2 6% SEM, n512) at the time of their preparation and before they were plated but remained relatively constant for each preparation of cells during the first 48 hours in culture (Figure 1). Thereafter however, the amount of edited apoB mRNA in cells declined. The cell number increased by approximately 15% by 72 hr (indicative of proliferation) and the amount of edited apoB mRNA decreased to 18% following 96 hr of continuous culture. All subsequent analyses with primary hepatocytes were performed between 2 and 20 hours of continuous culture. Ethanol treatment of hepatocytes increased the proportion of edited apoB mRNA. Hepatocytes were treated with the indicated dose of ethanol in unsealed dishes, thereby allowing some of the ethanol to dissipate over time (see Figure 6A). An increase in the proportion of edited apoB mRNA was apparent in hepatocytes treated with an initial dose of 0.1% ethanol relative to untreated controls 18 h after treatment (Figure 2). Treatment of hepatocytes with higher initial doses of ethanol (up to 0.79 %) resulted in an increased proportion of edited apoB mRNA. Cell via-
335
Vol. 252, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. The proportion of edited apoB mRNA in ethanol-treated hepatocytes. Purified rat primary hepatocytes were treated with an initial dose of ethanol indicated at the top of each lane for 18 h and the proportion of edited apoB mRNA (shown at the bottom of each lane) determined.
bility (based on cell counts and trypan blue exclusion) remained comparable to that in untreated cultures (95 %–98 %) even in those cultures that had been treated with 2.5 % ethanol. The relative proportion of edited RNA increased rapidly, reaching a peak within 2 h in hepatocytes treated with 2.5 % ethanol revealed that (Figure 3). After a slight decline, the proportion of edited apoB mRNA remained constant through 18 h of culture. Response of McArdle cells to ethanol treatment. To evaluate the generality of the ethanol effect, McArdle cells were treated with ethanol under similar conditions of culture and cell density as those used to treat primary hepatocytes. The proportion of edited apoB mRNA did not change in McArdle cells treated with 0.7 % ethanol but did respond when the cells were treated with 2.5 % ethanol (Figure 4, left panel). To evaluate the potential role of auxiliary proteins in the change in apoB mRNA editing, a system must be used in which APOBEC-1 is not rate limiting. A stable McArdle cell line over-expressing APOBEC-1 (McAPOBEC) was therefore selected as the experimental subject. These cells have basal levels of editing activity greater than 8-fold higher than that in the parental McArdle cell line due to an increased expression of APOBEC-1 (Figure 4, right panel). Importantly, the increased transcription of apobec-1 mRNA which is directed by the CMV promoter is constitutive and not responsive to physiologic regulation.
FIG. 3. Kinetics of the ethanol effect on edited apoB mRNA. Purified rat primary hepatocytes were treated with an initial dose of 0.7% ethanol and the proportion of edited apoB mRNA determined at various times up to 18h.
FIG. 4. ApoB mRNA editing in ethanol-treated McArdle and McAPOBEC cell lines. The parental McArdle cell line and a McArdle cell line over-expressing APOBEC-1 (McAPOBEC) were treated with the initial dose of ethanol indicated above each lane (2.5 % for McAPOBEC cells) and the proportion of edited apoB mRNA (indicated below each lane) determined after 18 h (McArdle) or at the times after treatment indicated above each lane (McAPOBEC). Additional editing sites (promiscuous editing) were apparent in McAPOBEC apoB mRNA and are indicated as primer extension bands 1 and 2 (right panel).
The proportion of edited apoB mRNA in McAPOBEC cells increased form 69% to 92% upon treatment with 2.5 % ethanol. The increase was evident as early as 5 min after treatment with ethanol and continued to rise over the 2 h assay period (Figure 4, right panel). Editing in HepG2 cells is not responsive to ethanol. To evaluate the generality of the editing response to ethanol HepG2 cells were treated with ethanol under conditions and cell densities similar to those used for primary hepatocytes. As predicted (18, 19) apoB mRNA editing activity in HepG2 was extremely low and at the detection limit of our primer extension assay (Figure 5, left panel). The proportion of edited RNA did not change in HepG2 cells treated with ethanol. Over-expression of APOBEC-1 in HepG2 cells (HepG2-APOBEC stable cell line) increased apoB mRNA editing efficiency in these cells but not to the same absoultely level of edited apoB mRNA as that which was possible in a McArdle cell background (Figure 5, right panel, and ref. 28). Moreover, overexpression of APOBEC-1 in HepG2 cells always induced promiscuous editing activity at C6655 (right panel and refs. 28, 29). Ethanol treatment of HepG2APOBEC cells did not significantly alter the proportion of edited RNA beyond the change already induced by APOBEC-1 over-expression (although a small change was apparent in cells treated with 2.5 % ethanol). Transient nature of the ethanol dose. The high levels of some of the ethanol doses used to treat cells in this study did not affect cell viability in all of the three types of cells tested. One possible explanation for this is that
336
Vol. 252, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 5. ApoB mRNA editing in ethanol-treated HepG2 and HepG2-APOBEC cell lines. The parental HepG2 cell line and a HepG2 cell line over-expressing APOBEC-1 (HepG2-APOBEC) were treated with the initial dose of ethanol indicated above each lane and the proportion of edited apoB mRNA in each condition determined after 18 h of treatment. The proportion of promiscuously edited apoB mRNA in each condition is given as percent editing at C6655 below each lane.
the dissipation of the initial ethanol dose was sufficient to spare cells from longer term consequences of ethanol toxicity. Ethanol concentrations in the media were assayed as described in Material and Methods in either collagen coated plates containing 2 ml of media and 0.7% ethanol with or without primary hepatocytes (Figure 6A) or in plastic dishes containing 2 ml of media and 2.5% ethanol with or without McArdle cells (Figure 6B). The data demonstrated that under all conditions, the initial ethanol dose rapidly dissipated so that by 2 h only 70% and 50% of the initial 0.7% and 2.5% ethanol doses respectively remained. By 18 h, only 10–20% of the initial doses remained in the media. The data also demonstrated that the decline in ethanol concentration in the media was enhanced 16 % (1/2 3 % S.E.M., n53) when primary hepatocytes were present, indicative of ethanol metabolism by the cells, but that the presence of McArdle cells did not affect the ethanol concentration in the media beyond that due to dissipation alone at the ethanol dose that was concentration tested.
from measured changes in apobec-1 mRNA abundance under a variety of developmental, hormonal and metabolic states (18, 19, 20 –22). In contrast, alterations in apoB mRNA editing efficiency have been observed under conditions where the abundance of apobec-1 mRNA did not appear to change (20, 23). Regulation of auxiliary protein abundance and/or function or the trafficking of editing machinery to the nucleus has been suggested as explanations for regulation of apoB mRNA editing in these situations. To examine the potential role of auxiliary proteins in the enhanced editing of apoB mRNA in the liver of rats consuming alcohol (23), we evaluated the response of rat primary hepatocytes and four cell lines to treatment by ethanol. The data demonstrated an increased proportion of edited apoB mRNA in primary hepatocytes, McArdle cells and McAPOBEC cells treated with ethanol. The proportion of edited apoB mRNA in HepG2 and HepG2-APOBEC cells was refractory to change through ethanol treatment. The change in the proportion of edited apoB RNA could be induced at lower ethanol doses in primary hepatocytes than in McArdle or McAPOBEC cells. One explanation for this may lie in the relative ability of these cell types to metabolize ethanol. This interpretation cannot be reconciled with the finding that the highest level of edited apoB mRNA induced by ethanol treatment (92%) was observed in McAPOBEC cells and that the greatest magnitude of this change over untreated cells was observed in McArdle cells (2-fold). In both primary hepatocytes and McArdle cell lines the change in proportion of edited apoB mRNA occurred rapidly and reached near maximum proportions
DISCUSSION The current focus in the apoB mRNA editing field is on the mechanism by which the process can be regulated. In this regard, increased APOBEC-1 expression increased the proportion of edited apoB mRNA in cells and in the liver of transgenic animals (18, 19, 28 –32). Regulation of apoB mRNA editing efficiency via alterations in APOBEC-1 abundance has been inferred
FIG. 6. Change in ethanol concentration in the media. A) The ethanol concentration in the media was assayed over time from collagen-coated Petri dishes that contained only 2 mls of media (control) or contained 2 mls of media plus hepatocytes (at 90% of confluency) and that had been treated with an initial dose of 0.7 % ethanol at t50. B) Ethanol concentration analysis of media from Petri dishes that contained only 2 mls of media (control) or contained 2 mls of media plus McArdle cells (at 90% of confluency) and that had been treated with an initial dose of 2.5 % ethanol at t50.
337
Vol. 252, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
2 h following treatment. At this time the ethanol measured in the media was 50%–70% of the initial dose. Given that low initial doses of ethanol were less or not effective, the data suggest that the cellular and molecular mechanism(s) responsible for altering the proportion of edited apoB mRNA are activated or induced very rapidly upon exposure of cells to a threshold concentration of ethanol. At this point we do not know whether the proportion of edited apoB mRNA is increased by treatment of cells with ethanol through an induction or activation of the editing machinery alone, or whether RNA synthesis or a selective degradation of unedited apoB mRNA might also be involved (30, 33). Ongoing research is addressing these questions. It is important to keep in mind however that the changes in the proportion of edited apoB mRNA occurred within the context of purified primary hepatocytes or in cell lines and therefore mechanistic hypotheses need not evoke factors from non-hepatic cells or tissues to explain the effect of ethanol on this form of RNA processing. Our data also indicate that changes in the proportion of edited apoB mRNA in the liver of alcohol fed rats was due to alterations in the regulation of apoB mRNA editing activity through the auxiliary proteins, supporting previous studies with ethanol fed rats (23). APOBEC-1 abundance is rate limiting in McArdle cells but the abundance of auxiliary proteins are sufficiently high so as to support additional editing activity when APOBEC-1 is experimental over-expressed (8% to 69% edited apoB mRNA in McArdle and McAPOBEC cells respectively). Although the magnitude of change in the proportion of edited apoB mRNA in response to ethanol treatment was greater in McArdle cells (8 % to 25 %) than in McAPOBEC cells (69 % to 92 %), the actual change in all cell types was similar (between 17 % and 25 %). Thus unlike the dramatic change in apoB mRNA editing efficiency that is apparent when APOBEC-1 abundance is changed, the ethanol induced change was comparatively small and therefore may involve more subtle changes in editosome activity or in nuclear trafficking than those that might be envisaged if the abundance of auxiliary proteins had to change. Our findings do suggest however that one or more auxiliary proteins may be rate limiting in HepG2 cells. ACKNOWLEDGMENTS We are grateful to Jenny M.L. Smith for the preparation of the figures. This work was supported by Public Health Services grants HL29837, DK50376, ES01247 and DK43739 awarded to CES, JDS, NB and HCS respectively, by grants from The Council for Tobacco Research and the Rochester Area Pepper Center for Research on Aging awarded to HCS and by grants to MPS from the University of Rochester Environmental Health Sciences Center pilot projects program.
REFERENCES 1. Chen, S.-H., Habib, G., Yang, C. Y., Gu, Z. W., Lee, B. R., Weng, S. A., Silberman, S. R., Cai, S. J., Deslypere, J. P., Rosseneu, M., Gotto, A. M., Li, W. H., and Chan, L. (1987) Science 238, 363–366. 2. Powell, L. M., Wallis, S. C., Pease, R. J., Edwards, Y. H., Knott, T. J., and Scott, J. (1987) Cell 50, 831– 840. 3. Smith, H. C., Kuo, S.-R., Backus, J. W., Harris, S. G., Sparks, C. E., and Sparks, J. D. (1991) Proc. Natl. Acad. Sci USA 88, 1489 –1493. 4. Harris, S. G., Sabio, I., Mayer, E., Steinburg, M. F., Backus, J. W., Sparks, J. D., Sparks, C. E., and Smith, H. C. (1993) J. Biol. Chem 268, 7382–7392. 5. Backus, J. W., and Smith, H. C. (1992) Nucleic Acids Res. 20, 6007– 6014. 6. Backus, J. W., Schock, D., and Smith, H. C. (1994) Biochim. Biophys. Acta 1219, 1–14. 7. Teng, B., Burant, C. F., and Davidson, N. O. (1993) Science 260, 1816 –1819. 8. Barnes, C., and Smith, H. C. (1993) Biochem. and Biophys. Res. Comm. 197, 1410 –1414. 9. Navaratnam, N., Morrison, J. R., Bhattacharya, S., Patel, D., Funahachi, T., Giannoni, F., Teng, B.-B., Davidson, N. O., and Scott, J. (1993) J. Biol. Chem. 268, 20709 –20712. 10. Driscoll, D. M., and Zhang, Q. (1994) J. Biol. Chem. 269, 19843– 19847. 11. Yamanaka, S., Poksay, K. S., Balestra, M., Zeng, G.-Q., and Innerarity, T. L. (1994) J. Biol. Chem. 269, 21725– 21734. 12. Yang, Y. Yang, Y., Kovalski, K., and Smith, H. C. (1997) J. Biol. Chem. 272, 27700 –27706. 13. Greeve, J., Lellek, H., Rautenberg, P., and Greten, H. (1998) Biol. Chem. 379, 1063–1074. 14. Lau, P. P., Zhu, H. K. J., Baldini, A., Chen, S. H., and Chan, L. (1997) J. Biol. Chem. 272, 1452–1455. 15. Navaratnam, N., Shah, R., Patel, D., Fay, V., and Scott, J. (1993) Proc. Natl. Acad. Sci. USA, 90, 222–226. 16. Mehta, A., and Driscoll, D. M. (1998) Molec. Cell. Biol. 18, 4426 – 4432. 17. Lau, P. P., Chen, S.-H., Wang, J. C., and Chan, L. (1990) Nucleic Acids Res. 18, 5817–5821. 18. Smith, H. C., and Sowden, M. P. (1996) Trends in Genetics 12, 418 – 424. 19. Chan, L., Chang, B. H.-J., Nakamuta, M., Li, W.-H., and Smith, L. C. (1997) Biochim. Biophys. Acta 1345, 11–26. 20. Funahashi, T., Giannoni, F., DePaoli, A. M., Skarosi, S. F., and Davidson, N. O. (1995) J. Lipid Res. 36, 414 – 428. 21. Giannoni, F., Chou, S.-C., Skarosi, S. F., Verp, M. S., Field, F. J., Coleman, R. A., and Davidson, N. O. (1995) J. Lipid Res. 36, 1664 –1675. 22. Phung, T. L., Sowden, M. P., Sparks, J. D., Sparks, C. E., and Smith, H. C. (1996) Metabolism 45, 1056 –1058. 23. Lau, P. P., Cahill, D. J., Zhu, H.-J., and Chan, L. (1995) J. Lipid Res. 36, 2069 –2078. 24. Yang, Y., Yang, Y., and Smith, H. C. (1997) Proc. Natl. Acad. Sci. USA 94, 13075–13080. 25. Sparks, C. E., Sparks, J. D., Bolognino, M. Salhanick, A., Strumph, P. S., and Amatruda, J. M. (1966) Metabolism 35, 1128 –1136.
338
Vol. 252, No. 2, 1998
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
26. Okada, T., Sakuma, L., Fukui, Y., Haxeki, O., and Ui, M. (1994) J. Biol. Chem. 269, 3563–3567. 27. Phung, T. L., Roncone, A., de Mesy Jensen, K. L., Sparks, C. E., and Sparks, J. D. (1997) J. Biol. Chem. 272, 30693– 30702. 28. Sowden, M. P., Eagleton, M. J., and Smith, H. C. (1998) Nucleic Acids Res. 26, 1644 –1652. 29. Sowden, M. P, Hamm, J. K., and Smith, H. C. (1996) J. Biol. Chem. 270, 3011–3017.
30. Sowden, M. Hamm, J. K., Spinelli, S., and Smith, H. C. (1996) RNA, 2, 274 –288. 31. Nakamuta, M., Chang, B. H.-J., Zigmond, E., Kobayashi, K., Lei, H., Ishida, Y., Oka, K., Li, E., and Cahn, L. (1966) J. Biol. Chem. 271, 25981–25988. 32. Qian, X., Balestra, M. E., Yamanaka, S., Bore´n, J., Lee, I., and Innerarity, T. L. (1998) Arterioscler. Thromb. Vasc. Biol. 18, 1013–1020. 33. Chen, L., and Chan, L. (1996) J. Theor. Biol. 183, 391– 407.
339