- Email: [email protected]
An integration-free iPSC line SDQLCHi025-A from a girl with multiminicore disease carrying compound heterozygote mutations in RYR1 gene
Stem Cell Research 45 (2020) 101775
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
An integration-free iPSC line SDQLCHi025-A from a girl with multiminicore disease carrying compound heterozygote mutations in RYR1 gene
T
Haiyan Zhang#, Yanyan Ma#, Yuqiang Lv, Ya Wan, Quanli Zhao, Zhongtao Gai , Yi Liu ⁎
⁎
Pediatric Research Institute, Qilu Children's Hospital of Shandong University, Jinan, Shandong 250022, China
ARTICLE INFO
ABSTRACT
Keywords: iPSC Reprogramming RYR1 multiminicore disease
Peripheral blood mononuclear cells for reprogramming in this work were donated by a girl with clinically and genetically diagnosed multiminicore disease harboring compound heterozygote mutations of RYR1 gene. Induced pluripotent stem cells (iPSCs) were obtained by non-integrating episomal vectors containing OCT4, SOX2, KLF4, BCL-XL and c-MYC. The iPSC line (SDQLCHi025-A) presented pluripotent cell morphology, high mRNA levels of pluripotency markers, differentiation potential in vitro, a normal karyotype, and carrying RYR1 gene mutations.
Resource Table: Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
SDQLCHi025-A N/A Research Institute of Pediatrics, Qilu Children's Hospital of Shandong University, Jinan, Shangdong, China Yi Liu, [email protected] iPSC Human Age: 8 years old Sex: female Ethnicity if known: Han Chinese Peripheral blood mononuclear cells Clonal Transgene free (episomal vectors) Yes Hereditary Multiminicore disease RYR1/chromosome19, mutations: c.1163C>T, c.14422_14423delTTinsAA N/A N/A N/A August 2019 https://hpscreg.eu/cell-line/SDQLCHi025-A The study was approved by Medical Ethics Committee of Qilu Children's Hospital of Shandong University, approval number: ETYY-2019203
1. Resource utility
represents an in vitro model for the disease study and drug screening.
Multiminicore disease (MMD) is a congenital myopathy and has been associated with recessive mutations in the skeletal muscle ryanodine receptor (RYR1) gene. MMD patient-specific iPSC line
2. Resource details Multiminicore disease (MMD, OMIM# 255320) is a recessively
Corresponding authors. E-mail address: [email protected] (Y. Liu). # Contributed equally to this work. ⁎
https://doi.org/10.1016/j.scr.2020.101775 Received 27 December 2019; Received in revised form 27 February 2020; Accepted 16 March 2020 Available online 20 March 2020 1873-5061/ © 2020 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 45 (2020) 101775
H. Zhang, et al.
Table 1. Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis Immunocytochemistry Quantitative analysis qRT-PCR Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis
Normal Positive staining for TRA-1-81, TRA-1-60, SSEA4, OCT4 and NANOG
Fig. 1 panel A Fig. 1 panel A
Expression of endogenous pluripotent markers OCT4, SOX2 and NANOG 46XX, Resolution 400-500
Fig. 1 panel D Fig. 1 panel B
N/A 20 loci analyzed, all matching
N/A Available with the authors Fig. 1 panel C N/A Supplementary Fig. 1 panel E
Genotype Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential
Sequencing Southern Blot OR WGS Mycoplasma Embryoid body formation
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Compound heterozygous mutations in RYR1 gene N/A Mycoplasma testing by luminescence. Negative Expression of genes of all three germ layers: ectodermal markers (PAX6, NR2F2), endodermal markers (SOX17, GATA4) and mesodermal markers (RUNX1, HAND1) N/A N/A N/A
N/A N/A N/A
(1.077 g/ml) (G&E Healthcare) and maintained in erythroid medium for 5–7 days. Erythroid medium contains serum-free (SFM) medium supplemented with 100 ng/ml hSCF (PeproTech), 10 ng/ml IL-3 (PeproTech), 2U/ml EPO (R&D Systems), 40 ng/ml IGF-1(PeproTech), 1 µM dexamethasone (Sigma–Aldrich) and 100 µg/ml holotransferring (R&D Systems). SFM medium consists of IMDM (Invitrogen) and Ham's F-12 (Mediatech), supplemented with 1% insulin-intransferrinseleniumX supplement (Invitrogen), 1% chemically defined lipid concentrate (Invitrogen), 1% L-glutamine (Invitrogen), 50 ug/ml of L-ascorbic acid (SigmaAldrich), 5 mg/ml of BSA (Sigma–Aldrich) and 200 µM 1-thioglycerol (Sigma–Aldrich). 2 × 106 PBMCs were electroporated by an Amaxa P3 Primary Cell 4D Nucleofector Kit according to the standard protocol on 4D Nucleofector System (Lonza), with 2 ug pEV-SFFV-OCT4-E2A-SOX2-Wpre, 1 ug pEV-SFFV-Myc-Wpre, 1 ug pEV-SFFV-KLF4-Wpre and 0.5 ug pEV-SFFV-BLC-XL-Wpre, program EO-100. The PBMCs were initially seeded onto 12 wells coated with feeder cells (mouse embryonic fibroblasts, MEFs) in erythroid medium. MEFs were made from 13.5-day-old embryos of CF-1 mouse stain and treated with mitomycin C before use. From the next day, the medium was replaced by ReproTeSR medium (Stem Cell Technologies). By day 14 (after nucleofection), the clone appeared. Emerging iPSC colonies were manually picked up and expanded in mTeSR1 medium (Stem Cell Technologies) on Matrigel (BD Biosciences). iPSCs were dissociated with ReLeSR (Stem Cell Technologies) at a 1:6 split ratio every 5 days. Cells were cultured at 37°C in 5% CO2.
inherited neuromuscular disorder characterized by the presence of multiple minicore structures in the sarcopla. MMD is caused by homozygous or compound heterozygote variants of the RYR1 gene (MIM# 180901) locating on chromosome 19q13 (Jungbluth et al. 2000). RYR1 gene, encoding the skeletal muscle ryanodine receptor 1, acts as a calcium release channel. It is essential for excitation-contraction coupling in the sarcoplasmic reticulum of skeletal muscles (Jungbluth et al., 2002). Patients with RYR1 gene mutations suffer severe congenital muscular dystrophy with ophthalmoplegia. In this study, we successfully established an iPSC line from peripheral blood mononuclear cells (PBMCs) donated by a MMD child with compound heterozygote mutations (c.1163C>T, c.14422_14423delTTinsAA) in RYR1 gene. The characterizations were mentioned in Table 1. PBMCs were reprogrammed using EBNA1/oriP based episomal vectors expressing human reprogramming factors OCT4, SOX2, KLF4, BCL-XL and MYC. The established SDQLCHi025-A iPSC line showed typical human embryonic stem cell-like morphology, and expressed pluripotency markers TRA-1-81, TRA-1-60, SSEA4, OCT4 and NANOG detected by immunofluorescence (Fig. 1A, 200x, Scale bars = 50 um). Quantitative reverse transcription real-time PCR (qRT-PCR) experiments of iPSC line at passages 10 demonstrated that the corresponding endogenous genes OCT4, SOX2 and NANOG (Fig. 1D) were activated in iPSCs. G-band chromosome analysis at passages 20 revealed a normal 46, XX karyotype (Fig. 1B). Sanger sequencing of the RYR1 genomic region confirmed the expected mutations c.1163C>T and c.14422_14423delTTinsAA (Fig. 1C) in iPSCs. Elimination of the vectors was observed by PCR analysis after 10 passages, compared with pEV-SFFV-Myc-Wpre plasmid as a positive control (Fig. 1E). Furthermore, in vitro differentiation via embryoid body formation affirmed the differentiation capacity of the established iPSC line, expression levels of ectodermal markers PAX6 and NR2F2, endodermal markers SOX17 and GATA4, mesodermal markers RUNX1 and HAND1, were detected by qRT-PCR (Fig. 1F). SDQLCHi025-A line was authenticated with 100% concordance with the corresponding PBMCs tested by short tandem repeat (STR) analysis (STR data available with the authors). Lastly, Mycoplasma contamination testing of the cell line at passage 15 was negative by luminescence (Supplementary file).
3.2. Immunofluorescence staining iPSCs were fixed in 4% paraformaldehyde at room temperature (RT) for 15 min and washed with Phosphate Buffered Saline, blocked with 5% BSA (containing 0.2% Triton X-100 for intracellular antigens) for 30 min at RT, then stained with primary antibodies (diluted in 1% BSA) overnight at 4 °C, and incubated with secondary antibodies (diluted in PBS) at RT for 1 h. Antibodies used in this study were listed in Table 2. The samples were counterstained with DAPI and captured under the Olympus IX71 Fluorescence Microscope (Olympus Corp.,Tokyo, Japan). 3.3. qRT-PCR
3. Materials and methods
Total RNA was extracted from both iPSCs and PBMCs using Trizol (Invitrogen) and 1 μg RNA was converted into cDNA using the PrimeScriptTM RT reagent Kit (TaKaRa). Real-time qPCR reactions were run on a LightCycler 480 II machine (Roche) with SYBR Premix Ex
3.1. PBMCs isolation and iPSC generation PBMCs were isolated using centrifugation with Ficoll-Hypaque 2
Stem Cell Research 45 (2020) 101775
H. Zhang, et al.
Fig 1. Characterization of SDQLCHi025-A iPSC line.
TaqTM II PCR reagent kit (TaKaRa) and indicated primers (Table 2). All samples were normalized to GAPDH and conducted in triplicate.
3.6. Genome analysis of variants in RYR1 gene Genomic DNA was isolated as described above, PCR reactions were amplified with primers of RYR1 gene (Table 2). PCR products were sequenced on a 3130XL DNA Analyzer (Applied Biosystems, Foster City, CA, USA).
3.4. Detection of exogenous transgene DNA from parental PBMCs and iPSC clones was obtained by Genomic DNA Purification Kit (TIANGEN, Beijing, China), PCR reactions were carried out with plasmids specific primers (Table 2) and Taq MasterMix (CWBIO, Beijing, China) for 35 cycles (94°C for 30 s, 58 °C for 30 s and 72 °C for 30 s) on PTC-200 machine (BIO-RAD) .
3.7. In vitro differentiation To form embryoid bodies (EBs), iPSCs were harvested with ReLeSR™ (STEMCELL Technologies) and transferred into ultra-low attachment 6well-plates (Costar) in mTeSR™ with 10 µmol/L ROCK inhibitor Y27632(STEMCELL Technologies). After 4–8 days, EBs were collected and transferred to dishes coated with Matrigel in DMEM/F12 medium (Gibco) supplemented with 20% Knockout serum replacement (Gibco), 1% L-GlutaMax (Gibco), 1% NEAA (Gibco), 1‰ b-mercaptoethanol (Gibco). Differentiating EBs cultured for 4-8 days were harvested with Trizol.
3.5. Karyotyping and STR analysis Cells of passage 20 were incubated with colcemid (0.32 µg/ml) for 55 min, collected with trypsin and washed with PBS. Then the cells were treated with 0.075 M KCL for 36 min at 37 °C. Following fixed twice in methanol: acetic acid (3:1, v/v) and Giemsa staining, images of chromosome spread were taken using an automated cytogenetic imaging system (Leica, GSL-120). Fifty metaphase cells were examined in this study. Analysis of 20 distinct STR markers were carried out with the GoldenEye 20A kit (Peoplespot, Beijing, China) on an ABI Genetic Analyzer 3130xl (Applied Biosystems).
3.8. Mycoplasma detection Absence of mycoplasma was detected by Mycoplasma Test Kit
3
Stem Cell Research 45 (2020) 101775
H. Zhang, et al.
Table 2. Reagents details. Antibodies used for immunocytochemistry/flow-citometry Description Antibody
Dilution
Company Cat # and RRID
Pluripotency Markers Pluripotency Markers Pluripotency Markers Pluripotency Markers Pluripotency Markers Secondary antibodies Secondary antibodies Secondary antibodies
1:500 1:100 1:1000 1:1000 1:500 1:1000 1:500 1:500
Abcam Cat# ab19857, RRID:AB_445175 Life Technology Cat# MC813-70, RRID:AB_1658242 Cell Signaling Technology Cat# 4745, RRID:AB_2119060 Cell Signaling Technology Cat# 4746, RRID:AB_2119059 Cell Signaling Technology Cat# 3580, RRID:AB_2150399 Abcam Cat# ab150121, RRID: AB_2801490 Proteintech Cat# SA00006-4, RRID:AB_2756337 Proteintech Cat# SA00006-3, RRID:AB_2757247
Mouse anti-OCT3/4 Mouse anti-SSEA-4 Mouse anti-TRA-1-81 Mouse anti-TRA-1-60 Rabbit anti-Nanog Goat anti-mouse IgM Alexa Fluor 488 conjugated Goat anti-Rabbit IgG Alexa Fluor 594 conjugated Goat anti-mouse IgG Alexa Fluor 594 conjugated
Primers Episomal Plasmids (PCR) Episomal Plasmids (PCR) House-Keeping Genes Pluripotency Markers (qRT-PCR) Pluripotency Markers (qRT-PCR) Pluripotency Markers (qRT-PCR) Targeted mutation analysis(sanger sequencing) Targeted mutation analysis(sanger sequencing) Embryoid body formation (RT-PCR) Embryoid body formation (RT-PCR) Embryoid body formation (RT-PCR) Embryoid body formation (RT-PCR) Embryoid body formation (RT-PCR) Embryoid body formation (RT-PCR)
Target
Forward/Reverse primer (5′–3′)
EBNA1/666bp Wpre/1741bp GAPDH/152bp OCT4(endogenous)/164bp SOX2(endogenous)/151bp NANOG/154bp RYR1-1163/316bp RYR1-14422/446bp PAX6/110bp NR2F2/192bp SOX17/190bp GATA4/104bp RUNX1/163bp HAND1/120bp
ATCGTCAAAGCTGCACACAG/CCCAGGAGTCCCAGTAGTCA CCTGCTTCTCGCTTCTGTTC/AAGCCATACGGGAAGCAATA GTGGACCTGACCTGCCGTCT/GGAGGAGTGGGTGTCGCTGT CCTCACTTCACTGCACTGTA/CAGGTTTTCTTTCCCTAGCT CCCAGCAGACTTCACATGT/CCTCCCATTTCCCTCGTTTT TGAACCTCAGCTACAAACAG/TGGTGGTAGGAAGAGTAAAG GGCAAGTGCAGAACTCAAGTC/GGTGTGGGCAACAGAGGTAG GCCCTGATCCTCCATGTACTC/AGTCCCTGTGGCTCTACCTTG GTCCATCTTTGCTTGGGAAA/TAGCCAGGTTGCGAAGAACT GACCAGCACCATCGCAACC/ GCGCAACAGCAGGGAAAT GCTTTCATGGTGTGGGCTAA/ACTTGTAGTTGGGGTGGTCC CGCCCGACACCCCAATCTC/ CCGTCCCATCTCGCCTCCA CCCTAGGGGATGTTCCAGAT/TGAAGCTTTTCCCTCTTCCA TCAAGGCTGAACTCAAGAAGG/TGCGTCCTTTAATCCTCTTCTC
(KeyGEN BioTECH, China) following the manufacturer's instructions.
Supplementary materials
Conflict of Interest
Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2020.101775. References
The authors (Haiyan Zhang, Yanyan Ma, Yuqiang Lv, Ya Wan, Quanli Zhao, Zhongtao Gai, Yi Liu,) declared there is no conflict of interest.
Jungbluth, H., Sewry, C., Brown, S.C., Manzur, A.Y., Mercuri, E., Bushby, K., Rowe, P., Johnson, M.A., Hughes, I., Kelsey, A., Dubowitz, V., Muntoni, F., 2000. Minicore myopathy in children: a clinical and histopathological study of 19 cases. Neuromuscul. Disord. 10, 264–273. Jungbluth, H., Müller, C.R., Halliger-Keller, B., Brockington, M., Brown, S.C., Feng, L., Chattopadhyay, A., Mercuri, E., Manzur, A.Y., Ferreiro, A., Laing, N.G., Davis, M.R., Roper, H.P., Dubowitz, V., Bydder, G., Sewry, C.A., Muntoni, F., 2002. Autosomal recessive inheritance of RYR1 mutations in a congenital myopathy with cores. Neurology 23, 284–287.
Acknowledgments This study was funded by the National Natural Science Foundation of China, Grant number: 81671362.
4
Contents lists available at ScienceDirect
Stem Cell Research journal homepage: www.elsevier.com/locate/scr
Lab resource: Stem Cell Line
An integration-free iPSC line SDQLCHi025-A from a girl with multiminicore disease carrying compound heterozygote mutations in RYR1 gene
T
Haiyan Zhang#, Yanyan Ma#, Yuqiang Lv, Ya Wan, Quanli Zhao, Zhongtao Gai , Yi Liu ⁎
⁎
Pediatric Research Institute, Qilu Children's Hospital of Shandong University, Jinan, Shandong 250022, China
ARTICLE INFO
ABSTRACT
Keywords: iPSC Reprogramming RYR1 multiminicore disease
Peripheral blood mononuclear cells for reprogramming in this work were donated by a girl with clinically and genetically diagnosed multiminicore disease harboring compound heterozygote mutations of RYR1 gene. Induced pluripotent stem cells (iPSCs) were obtained by non-integrating episomal vectors containing OCT4, SOX2, KLF4, BCL-XL and c-MYC. The iPSC line (SDQLCHi025-A) presented pluripotent cell morphology, high mRNA levels of pluripotency markers, differentiation potential in vitro, a normal karyotype, and carrying RYR1 gene mutations.
Resource Table: Unique stem cell line identifier Alternative name(s) of stem cell line Institution Contact information of distributor Type of cell line Origin Additional origin info Cell Source Clonality Method of reprogramming Genetic Modification Type of Modification Associated disease Gene/locus Method of modification Name of transgene or resistance Inducible/constitutive system Date archived/stock date Cell line repository/bank Ethical approval
SDQLCHi025-A N/A Research Institute of Pediatrics, Qilu Children's Hospital of Shandong University, Jinan, Shangdong, China Yi Liu, [email protected] iPSC Human Age: 8 years old Sex: female Ethnicity if known: Han Chinese Peripheral blood mononuclear cells Clonal Transgene free (episomal vectors) Yes Hereditary Multiminicore disease RYR1/chromosome19, mutations: c.1163C>T, c.14422_14423delTTinsAA N/A N/A N/A August 2019 https://hpscreg.eu/cell-line/SDQLCHi025-A The study was approved by Medical Ethics Committee of Qilu Children's Hospital of Shandong University, approval number: ETYY-2019203
1. Resource utility
represents an in vitro model for the disease study and drug screening.
Multiminicore disease (MMD) is a congenital myopathy and has been associated with recessive mutations in the skeletal muscle ryanodine receptor (RYR1) gene. MMD patient-specific iPSC line
2. Resource details Multiminicore disease (MMD, OMIM# 255320) is a recessively
Corresponding authors. E-mail address: [email protected] (Y. Liu). # Contributed equally to this work. ⁎
https://doi.org/10.1016/j.scr.2020.101775 Received 27 December 2019; Received in revised form 27 February 2020; Accepted 16 March 2020 Available online 20 March 2020 1873-5061/ © 2020 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/BY-NC-ND/4.0/).
Stem Cell Research 45 (2020) 101775
H. Zhang, et al.
Table 1. Characterization and validation. Classification
Test
Result
Data
Morphology Phenotype
Photography Qualitative analysis Immunocytochemistry Quantitative analysis qRT-PCR Karyotype (G-banding) and resolution Microsatellite PCR (mPCR) OR STR analysis
Normal Positive staining for TRA-1-81, TRA-1-60, SSEA4, OCT4 and NANOG
Fig. 1 panel A Fig. 1 panel A
Expression of endogenous pluripotent markers OCT4, SOX2 and NANOG 46XX, Resolution 400-500
Fig. 1 panel D Fig. 1 panel B
N/A 20 loci analyzed, all matching
N/A Available with the authors Fig. 1 panel C N/A Supplementary Fig. 1 panel E
Genotype Identity Mutation analysis (IF APPLICABLE) Microbiology and virology Differentiation potential
Sequencing Southern Blot OR WGS Mycoplasma Embryoid body formation
Donor screening (OPTIONAL) Genotype additional info (OPTIONAL)
HIV 1 + 2 Hepatitis B, Hepatitis C Blood group genotyping HLA tissue typing
Compound heterozygous mutations in RYR1 gene N/A Mycoplasma testing by luminescence. Negative Expression of genes of all three germ layers: ectodermal markers (PAX6, NR2F2), endodermal markers (SOX17, GATA4) and mesodermal markers (RUNX1, HAND1) N/A N/A N/A
N/A N/A N/A
(1.077 g/ml) (G&E Healthcare) and maintained in erythroid medium for 5–7 days. Erythroid medium contains serum-free (SFM) medium supplemented with 100 ng/ml hSCF (PeproTech), 10 ng/ml IL-3 (PeproTech), 2U/ml EPO (R&D Systems), 40 ng/ml IGF-1(PeproTech), 1 µM dexamethasone (Sigma–Aldrich) and 100 µg/ml holotransferring (R&D Systems). SFM medium consists of IMDM (Invitrogen) and Ham's F-12 (Mediatech), supplemented with 1% insulin-intransferrinseleniumX supplement (Invitrogen), 1% chemically defined lipid concentrate (Invitrogen), 1% L-glutamine (Invitrogen), 50 ug/ml of L-ascorbic acid (SigmaAldrich), 5 mg/ml of BSA (Sigma–Aldrich) and 200 µM 1-thioglycerol (Sigma–Aldrich). 2 × 106 PBMCs were electroporated by an Amaxa P3 Primary Cell 4D Nucleofector Kit according to the standard protocol on 4D Nucleofector System (Lonza), with 2 ug pEV-SFFV-OCT4-E2A-SOX2-Wpre, 1 ug pEV-SFFV-Myc-Wpre, 1 ug pEV-SFFV-KLF4-Wpre and 0.5 ug pEV-SFFV-BLC-XL-Wpre, program EO-100. The PBMCs were initially seeded onto 12 wells coated with feeder cells (mouse embryonic fibroblasts, MEFs) in erythroid medium. MEFs were made from 13.5-day-old embryos of CF-1 mouse stain and treated with mitomycin C before use. From the next day, the medium was replaced by ReproTeSR medium (Stem Cell Technologies). By day 14 (after nucleofection), the clone appeared. Emerging iPSC colonies were manually picked up and expanded in mTeSR1 medium (Stem Cell Technologies) on Matrigel (BD Biosciences). iPSCs were dissociated with ReLeSR (Stem Cell Technologies) at a 1:6 split ratio every 5 days. Cells were cultured at 37°C in 5% CO2.
inherited neuromuscular disorder characterized by the presence of multiple minicore structures in the sarcopla. MMD is caused by homozygous or compound heterozygote variants of the RYR1 gene (MIM# 180901) locating on chromosome 19q13 (Jungbluth et al. 2000). RYR1 gene, encoding the skeletal muscle ryanodine receptor 1, acts as a calcium release channel. It is essential for excitation-contraction coupling in the sarcoplasmic reticulum of skeletal muscles (Jungbluth et al., 2002). Patients with RYR1 gene mutations suffer severe congenital muscular dystrophy with ophthalmoplegia. In this study, we successfully established an iPSC line from peripheral blood mononuclear cells (PBMCs) donated by a MMD child with compound heterozygote mutations (c.1163C>T, c.14422_14423delTTinsAA) in RYR1 gene. The characterizations were mentioned in Table 1. PBMCs were reprogrammed using EBNA1/oriP based episomal vectors expressing human reprogramming factors OCT4, SOX2, KLF4, BCL-XL and MYC. The established SDQLCHi025-A iPSC line showed typical human embryonic stem cell-like morphology, and expressed pluripotency markers TRA-1-81, TRA-1-60, SSEA4, OCT4 and NANOG detected by immunofluorescence (Fig. 1A, 200x, Scale bars = 50 um). Quantitative reverse transcription real-time PCR (qRT-PCR) experiments of iPSC line at passages 10 demonstrated that the corresponding endogenous genes OCT4, SOX2 and NANOG (Fig. 1D) were activated in iPSCs. G-band chromosome analysis at passages 20 revealed a normal 46, XX karyotype (Fig. 1B). Sanger sequencing of the RYR1 genomic region confirmed the expected mutations c.1163C>T and c.14422_14423delTTinsAA (Fig. 1C) in iPSCs. Elimination of the vectors was observed by PCR analysis after 10 passages, compared with pEV-SFFV-Myc-Wpre plasmid as a positive control (Fig. 1E). Furthermore, in vitro differentiation via embryoid body formation affirmed the differentiation capacity of the established iPSC line, expression levels of ectodermal markers PAX6 and NR2F2, endodermal markers SOX17 and GATA4, mesodermal markers RUNX1 and HAND1, were detected by qRT-PCR (Fig. 1F). SDQLCHi025-A line was authenticated with 100% concordance with the corresponding PBMCs tested by short tandem repeat (STR) analysis (STR data available with the authors). Lastly, Mycoplasma contamination testing of the cell line at passage 15 was negative by luminescence (Supplementary file).
3.2. Immunofluorescence staining iPSCs were fixed in 4% paraformaldehyde at room temperature (RT) for 15 min and washed with Phosphate Buffered Saline, blocked with 5% BSA (containing 0.2% Triton X-100 for intracellular antigens) for 30 min at RT, then stained with primary antibodies (diluted in 1% BSA) overnight at 4 °C, and incubated with secondary antibodies (diluted in PBS) at RT for 1 h. Antibodies used in this study were listed in Table 2. The samples were counterstained with DAPI and captured under the Olympus IX71 Fluorescence Microscope (Olympus Corp.,Tokyo, Japan). 3.3. qRT-PCR
3. Materials and methods
Total RNA was extracted from both iPSCs and PBMCs using Trizol (Invitrogen) and 1 μg RNA was converted into cDNA using the PrimeScriptTM RT reagent Kit (TaKaRa). Real-time qPCR reactions were run on a LightCycler 480 II machine (Roche) with SYBR Premix Ex
3.1. PBMCs isolation and iPSC generation PBMCs were isolated using centrifugation with Ficoll-Hypaque 2
Stem Cell Research 45 (2020) 101775
H. Zhang, et al.
Fig 1. Characterization of SDQLCHi025-A iPSC line.
TaqTM II PCR reagent kit (TaKaRa) and indicated primers (Table 2). All samples were normalized to GAPDH and conducted in triplicate.
3.6. Genome analysis of variants in RYR1 gene Genomic DNA was isolated as described above, PCR reactions were amplified with primers of RYR1 gene (Table 2). PCR products were sequenced on a 3130XL DNA Analyzer (Applied Biosystems, Foster City, CA, USA).
3.4. Detection of exogenous transgene DNA from parental PBMCs and iPSC clones was obtained by Genomic DNA Purification Kit (TIANGEN, Beijing, China), PCR reactions were carried out with plasmids specific primers (Table 2) and Taq MasterMix (CWBIO, Beijing, China) for 35 cycles (94°C for 30 s, 58 °C for 30 s and 72 °C for 30 s) on PTC-200 machine (BIO-RAD) .
3.7. In vitro differentiation To form embryoid bodies (EBs), iPSCs were harvested with ReLeSR™ (STEMCELL Technologies) and transferred into ultra-low attachment 6well-plates (Costar) in mTeSR™ with 10 µmol/L ROCK inhibitor Y27632(STEMCELL Technologies). After 4–8 days, EBs were collected and transferred to dishes coated with Matrigel in DMEM/F12 medium (Gibco) supplemented with 20% Knockout serum replacement (Gibco), 1% L-GlutaMax (Gibco), 1% NEAA (Gibco), 1‰ b-mercaptoethanol (Gibco). Differentiating EBs cultured for 4-8 days were harvested with Trizol.
3.5. Karyotyping and STR analysis Cells of passage 20 were incubated with colcemid (0.32 µg/ml) for 55 min, collected with trypsin and washed with PBS. Then the cells were treated with 0.075 M KCL for 36 min at 37 °C. Following fixed twice in methanol: acetic acid (3:1, v/v) and Giemsa staining, images of chromosome spread were taken using an automated cytogenetic imaging system (Leica, GSL-120). Fifty metaphase cells were examined in this study. Analysis of 20 distinct STR markers were carried out with the GoldenEye 20A kit (Peoplespot, Beijing, China) on an ABI Genetic Analyzer 3130xl (Applied Biosystems).
3.8. Mycoplasma detection Absence of mycoplasma was detected by Mycoplasma Test Kit
3
Stem Cell Research 45 (2020) 101775
H. Zhang, et al.
Table 2. Reagents details. Antibodies used for immunocytochemistry/flow-citometry Description Antibody
Dilution
Company Cat # and RRID
Pluripotency Markers Pluripotency Markers Pluripotency Markers Pluripotency Markers Pluripotency Markers Secondary antibodies Secondary antibodies Secondary antibodies
1:500 1:100 1:1000 1:1000 1:500 1:1000 1:500 1:500
Abcam Cat# ab19857, RRID:AB_445175 Life Technology Cat# MC813-70, RRID:AB_1658242 Cell Signaling Technology Cat# 4745, RRID:AB_2119060 Cell Signaling Technology Cat# 4746, RRID:AB_2119059 Cell Signaling Technology Cat# 3580, RRID:AB_2150399 Abcam Cat# ab150121, RRID: AB_2801490 Proteintech Cat# SA00006-4, RRID:AB_2756337 Proteintech Cat# SA00006-3, RRID:AB_2757247
Mouse anti-OCT3/4 Mouse anti-SSEA-4 Mouse anti-TRA-1-81 Mouse anti-TRA-1-60 Rabbit anti-Nanog Goat anti-mouse IgM Alexa Fluor 488 conjugated Goat anti-Rabbit IgG Alexa Fluor 594 conjugated Goat anti-mouse IgG Alexa Fluor 594 conjugated
Primers Episomal Plasmids (PCR) Episomal Plasmids (PCR) House-Keeping Genes Pluripotency Markers (qRT-PCR) Pluripotency Markers (qRT-PCR) Pluripotency Markers (qRT-PCR) Targeted mutation analysis(sanger sequencing) Targeted mutation analysis(sanger sequencing) Embryoid body formation (RT-PCR) Embryoid body formation (RT-PCR) Embryoid body formation (RT-PCR) Embryoid body formation (RT-PCR) Embryoid body formation (RT-PCR) Embryoid body formation (RT-PCR)
Target
Forward/Reverse primer (5′–3′)
EBNA1/666bp Wpre/1741bp GAPDH/152bp OCT4(endogenous)/164bp SOX2(endogenous)/151bp NANOG/154bp RYR1-1163/316bp RYR1-14422/446bp PAX6/110bp NR2F2/192bp SOX17/190bp GATA4/104bp RUNX1/163bp HAND1/120bp
ATCGTCAAAGCTGCACACAG/CCCAGGAGTCCCAGTAGTCA CCTGCTTCTCGCTTCTGTTC/AAGCCATACGGGAAGCAATA GTGGACCTGACCTGCCGTCT/GGAGGAGTGGGTGTCGCTGT CCTCACTTCACTGCACTGTA/CAGGTTTTCTTTCCCTAGCT CCCAGCAGACTTCACATGT/CCTCCCATTTCCCTCGTTTT TGAACCTCAGCTACAAACAG/TGGTGGTAGGAAGAGTAAAG GGCAAGTGCAGAACTCAAGTC/GGTGTGGGCAACAGAGGTAG GCCCTGATCCTCCATGTACTC/AGTCCCTGTGGCTCTACCTTG GTCCATCTTTGCTTGGGAAA/TAGCCAGGTTGCGAAGAACT GACCAGCACCATCGCAACC/ GCGCAACAGCAGGGAAAT GCTTTCATGGTGTGGGCTAA/ACTTGTAGTTGGGGTGGTCC CGCCCGACACCCCAATCTC/ CCGTCCCATCTCGCCTCCA CCCTAGGGGATGTTCCAGAT/TGAAGCTTTTCCCTCTTCCA TCAAGGCTGAACTCAAGAAGG/TGCGTCCTTTAATCCTCTTCTC
(KeyGEN BioTECH, China) following the manufacturer's instructions.
Supplementary materials
Conflict of Interest
Supplementary material associated with this article can be found, in the online version, at doi:10.1016/j.scr.2020.101775. References
The authors (Haiyan Zhang, Yanyan Ma, Yuqiang Lv, Ya Wan, Quanli Zhao, Zhongtao Gai, Yi Liu,) declared there is no conflict of interest.
Jungbluth, H., Sewry, C., Brown, S.C., Manzur, A.Y., Mercuri, E., Bushby, K., Rowe, P., Johnson, M.A., Hughes, I., Kelsey, A., Dubowitz, V., Muntoni, F., 2000. Minicore myopathy in children: a clinical and histopathological study of 19 cases. Neuromuscul. Disord. 10, 264–273. Jungbluth, H., Müller, C.R., Halliger-Keller, B., Brockington, M., Brown, S.C., Feng, L., Chattopadhyay, A., Mercuri, E., Manzur, A.Y., Ferreiro, A., Laing, N.G., Davis, M.R., Roper, H.P., Dubowitz, V., Bydder, G., Sewry, C.A., Muntoni, F., 2002. Autosomal recessive inheritance of RYR1 mutations in a congenital myopathy with cores. Neurology 23, 284–287.
Acknowledgments This study was funded by the National Natural Science Foundation of China, Grant number: 81671362.
4