- Email: [email protected]
An isothermal amplification system based on the tandem-repeated DNA probe
Molecular and Cellular Probes 18 (2004) 383–388 www.elsevier.com/locate/ymcpr
An isothermal amplification system based on the tandem-repeated DNA probe Xiao Mou Peng*, Yang Su Huang, Jian Guo Li, Yong Yu Mei, Lin Gu, Zhi Liang Gao, Gang Li Department of Infectious Diseases, Hepatitis Research Laboratory, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou 510630, Guangdong Province, China Received 19 April 2004; accepted for publication 25 June 2004
Abstract The hybridization methods and polymerase-based amplification methods are usually employed to detect pathogens and gene expressions quantitatively in clinical practices nowadays. However, the sensitiveness of the former and the specificity of the latter are not yet satisfied. To solve this problem, some promising comprehensive methods have been developed recently. Here we reported a new comprehensive method, a tandem repeated DNA probe-based amplification (TRPBA) system. To establish the TRPBA, TR48, an artificial tandem repeated DNA probe with 48 repeats of a 50 base pair unit was constructed. It could be efficiently amplified by Bst DNA polymerase at 61 8C for only 1 h. The products were analyzed either by direct gel electrophoresis or by gel electrophoresis after the digestion with restriction endonuclease HincII. The sensitiveness was as few as 100 copies per test, which was comparable with PCR-based techniques. The TR48 splicing with the DNA fragment of hepatitis B virus used as probe could successfully develop TRPBA to detect hepatitis B virus DNA. The TRPBA can be used in the future to detect many other genes or microorganisms simply by splicing TR48 with their DNA fragments. Thus, TRPBA might be useful because of its sensitiveness and simpleness. q 2004 Published by Elsevier Ltd. Keywords: DNA probe; Tandem repeats; Amplification; Polymerase; Hybridization
1. Introduction To demonstrate the copy numbers of pathogens or gene expressions is of important role in clinical practice because of its therapeutic and prognostic implications in human diseases [1,2]. Two kinds of methods are employed for this purpose. One kind is hybridization, including dot hybridization, branched DNA and Digene Hybrid Capture assay [3,4]. The other kind is the polymerase-based amplification, including polymerase chain reaction (PCR) and nucleic acid sequence-based amplification (NASBA) [5,6]. Both of them have the advantages and disadvantages of their own. The hybridization methods are usually of high specificity. Though some hybridization methods are still used in laboratories at present time, to improve their sensitiveness
* Corresponding author. Tel.: C86-20-85516867x2019; fax: C86-2085515940. E-mail address: [email protected] (X.M. Peng). 0890-8508/$ - see front matter q 2004 Published by Elsevier Ltd. doi:10.1016/j.mcp.2004.06.004
is critical for them to be used further. Tandem-repeated DNA sequence with proper length might enhance the signals of hybridization since it could combine with more than one copy of the target sequences or secondary probes. When used as immobilized probe in hybridization on microtiter wells, the tandem-repeated sequence increased the sensitiveness of hybridization indeed [7]. The best of this function of the tandem-repeated sequence were made in branched DNA, in which the tandem-repeated sequences were used as a series of detecting probes to obtain much stronger signals [3]. The polymerase-based amplification methods, such as PCR and NASBA, are common methods for the clinical diagnosis [8,9]. They are usually more sensitive than those methods based on hybridization [10,11]. Their results, however, are less believable because its specificity in most situations only depends on two primers of 20 base pairs (bp) in length. Moreover, some PCR methods require a contamination risk step of electrophoresis, or a special apparatus to monitor the amplification of DNA. A high specificity,
384
X.M. Peng et al. / Molecular and Cellular Probes 18 (2004) 383–388
efficiency and rapidity polymerase-based amplification method, loop-mediated isothermal amplification (LAMP) was recently developed by Notomi et al [12–14]. Its specificity depended on six regions that were longer than 20 bp in the target sequences. The specificity of hybridization is undoubtedly high because it depends on DNA sequence much longer than that of primers. Comprehensive methods, both polymerase-based and hybridization-based, may be an important way to establish new methods of high specificity and sensitiveness. Recently, such method, called isothermal ramification amplification (RAM), was established [15–17], in which a specific circle structure was generated by DNA ligase after a special probe (C-probe) hybridized with target sequence, and then the circle structure was amplified using DNA polymerase. In this report, we describe another comprehensive technique, the tandem-repeated DNA probe-based amplification (TRPBA), in which the tandem-repeated probe was directly amplified after its hybridization with target DNA. Thus, this method would be simple and timesaving as comparing with RAM methods based on the C-probe.
Table 1 Oligonucleotides, primers and probes Oligonucleotide fragment or primers
Oligonucleotide fragment or primer sequence 5 0 –3 0
BU
AGTCAATGTCAACCAGCAGTCTCAGGGCGTAGAGTAGGGAGTGCGAGTGT CTCACTCTCGTGTAGATAGTCAATGTCAACCAGC TAGTGGACGTGCCGTGAACACTCGCACTCCCTAC TCACGGCACGTCCACTAAGTCAATGTCAACCAGC TGCTAAGACATCGCCAGACACTCGCACTCCCTAC CTGGCGATGTCTTAGCAAGTCAATGTCAACCAGC CTCGCTGATGCTGACCTACACTCGCACTCCCTAC TGCTAAGACATCGCCAG CTGGCGATGTCTTAGCA CAAGAATTCGGTTACCCTCACTCTCGTGTAGAT TTCGAGCTCCTCGCTGATGCTGACCT CCTGAGCTCCTCACTCTCGTGTAGAT CCCGGTACCCTCGCTGATGCTGACCT CCTGGTACCCTCACTCTCGTGTAGAT CCTGGATCCCTCGCTGATGCTGACCT CAAGAATTCGGATCCCTCACTCTCGTGTAGAT CATTCTAGAGGTTACCCTCGCTGATGCTGACCT CCCGAATTCTCTAGACTCACTCTCGTGTAGAT CCGCTGCAGGTGACCTCGCTGATGCTGACCT ATAAGTCAATGTCAACCAGCAGTCTCAG GTGACACTCGCACTCCCTACTCTACGCC CCACTGCAGAGACCGTTCATGTCCTACTGTTCAAGC CCCAAGCTTATCCACACTCCAAAAGACACC Biotin-CCCTGCGCTGAACATGGAGAACATCACATCAGG Biotin-TCAAGGTATGTTGCCCGTTTGTCCTCTAATTCC
P1 P2 P3 P4 P5 P6 P7 P8 R4-P1
2. Materials and methods
R4-P2 R4-P3 R4-P4 R4-P5 R4-P6 R4-P7
2.1. Oligonucleotide fragment and PCR primers
R4-P8
The basic unit (BU, in Table 1) for the construction of the tandem-repeated sequence was a random sequence of 50 bp in size, which did not share any relationship with common pathogens, such as hepatitis B virus (HBV), hepatitis C virus and human immunodeficiency virus according to the Blast program (htpp://www.ncbi.nlm.nih.gov). This design would let it be possible for the tandem-repeated sequence to be used as probe in clinical practices. Primers, from P1 to P8, were used to amplify the basic unit in order to obtain a set of overlapping fragments for the construction of the fourrepeat sequence. Primers, from R4-P1 to R4-P10 were used to amplify the four-repeat sequence in order to obtain a set of four-repeat fragments for the construction of the 48-repeat sequence. Primers, TRP1 and TRP2 were used in TRPBA analysis. The rest of primers or probes were used to adapt the TRPBA to detect HBV DNA. All oligonucleotide fragments and PCR primers were synthesized using standard phosphoramidite chemistry on an ABI 394 DNA synthesizer. 2.2. Construction of tandem-repeated DNA sequence The artificial tandem-repeated DNA sequence, TR48, constructed in this study had 48 repeats of the BU (Table 1). The strategy for the construction of TR48 was shown in Fig. 1. The first step was to construct the four-repeats, 4R, by splicing four fragments that were shown in Fig. 1A using splicing by overlap extension [18]. The 4R was then
R4-P9 R4-P10 TRP1 TRP2 HB-P1a HB-P2a HB-BIO1a HB-BIO2a
a The sequences were derived from HBV complete genome (GeneBank accession no. AB10290).
recovered from the agarose gel, and cloned into phagemid pGEM-3zf(C) (Promega) to generate the recombinant vector pTR4. The second step was to generate seven fragments of the four-repeats with different type of restriction endonuclease sites in terminals using PCR, in which pTR4 was utilized as template, and 4R-P1/4R-P2, 4R-P3/4R-P4, 4R-P5/4R-P6, 4R-P7/4R-P2, 4R-P5/4R-P8, 4R-P9/4R-P2 and 4R-P5/4R-P10 as primers, respectively. The restriction endonuclease sites of each fragment were shown in Fig. 1A. The last step was to construct pTR48 by cloning those seven fragments into pGEM-3zf(C) in the order as shown in Fig. 1B.
X.M. Peng et al. / Molecular and Cellular Probes 18 (2004) 383–388
385
Fig. 1. The strategy for the construction of pTR48. (A) The plan for the construction of seven fragments with four repeats. BU was the basic unit. 1R, 2R and 4R were the fragments contained 1, 2 and 4 repeats, respectively. P1 to P6 were primers that were shown in detail in Table 1. SOE stood for the splicing by overlap extension. Characters, E, S, K, B, X and P stood for restriction endonuclease sites of EcoRI, SacI, KpnI, BamHI, XbaI and PstI, respectively. E/X or E/B indicated that there were sites of EcoRI and XbaI or EcoRI and BamHI in the same terminal. (B) The protocol for the construction of pTR48 by cloning, which showed the adding order of the four repeats. pGEM-3zf(C) was a commercial phagemid. The characters in the parentheses just after the name of the given recombinant vectors indicated the restriction endonuclease sites in pGEM-3zf(C) that the interest sequence has been inserted.
2.3. Preparation of single-stranded DNA of pTR48 JM109 strain of Escherichia coli (Promega) was used as host bacteria of the recombinant phagemid, pTR48. The transformed bacteria were cultivated in Luria–Bertani culture with ampicillin. The cultures were incubated at 37 8C for half an hour before superinfected by helper phage R408 (Promega) with the ratio of 1:10 (bacteria: phage). The cultures were further incubated at 37 8C for 10 h. The single-stranded DNA of pTR48 was extracted from the supernatant of the cultures using M13 single-stranded DNA preparation kits (Omega). 2.4. Evaluation of TR48 The sequence of pTR48 could not be confirmed by DNA sequencing because it contained too much repeats. However, it could be confirmed according to the specific bands when using several restriction endonucleases in the restriction fragment length polymorphism (RFLP) analysis. The single-stranded DNA prepared above was the complement strand of TR48. Thus, it was possible to confirm the sequence of TR48 by the hybridization analysis of the single-stranded DNA with the basic unit. If the sequence
of TR48 was correct, the hybrids would be much bigger since TR48 could combine as many as 48 basic units. 2.5. Reaction components of TRPBA The reaction mixture was 25 ml, and contained 20 mM Tris–HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 4 mM Mg SO4, 0.1% Triton-X100, 0.4 mM dNTPs, 8 U Bst DNA polymerase large fragment (New England Biolabs), 20 pmol of each primers, TRP1 and TRP2 (Table 1), and given amount of the single-stranded DNA of pTR48. The reaction was performed at 61 8C for 1 h. The products were detected either by direct gel electrophoresis or gel electrophoresis after the digestion with restriction endonuclease HincII (Promega). 2.6. Evaluation of TRPBA The copy numbers of the single-stranded DNA of pTR48 were calculated out according to the DNA amount measured by the UV spectrometer. The single-stranded DNA was diluted in a series, and then used to evaluate the specificity and the sensitivity of the TRPBA. The specificity of the TRPBA products was confirmed using RFLP analysis.
386
X.M. Peng et al. / Molecular and Cellular Probes 18 (2004) 383–388
2.7. Detection of HBV DNA using TRPBA A DNA fragment of HBV (position at 1848–2277, GeneBank accession no. AB10290) was obtained from the recombinant plasmid, pTZ19U-HBV [19], which contained complete genome of HBV by PCR using primers of HB-P1 and HB-P2 (Table 1), and cloned into pTR48 between the sites of PstI and HindIII to generate pTR48-HBV. The single-stranded DNA of pTR48-HBV was prepared just as that of pTR48. 107 copies/ml single-stranded DNA and a series of dilutions of pTZ19U-HBV were mixed, boiled for 10 min and quenched quickly on ice. The mixture was added to microtiter wells that coated with the streptavidin and Biotin-labeled probes (Table 1, HB-BIO1 and HB-BIO2). The hybridization reaction and the hybrid immobilization were carried out at 61 8C for 1 h. After washing five times with TBST (50 mM Tris–HCl (pH 7.2), 0.2 M NaCl, 0.05% Tween-20), the TRPBA was performed as mentioned above. Normal saline, pGEM3zf(C) and pTR48 were used as empty or negative controls.
Fig. 2. The gel electrophoresis of the splicing products in 2% agarose with ethidium bromide staining. Lane M1 in (A), (B), (C) was DNA size marker (100, 250, 500, 750, 1000 and 2000 bp upwards). (A) Modified basic units. From lanes 1 to 4 were four fragments (from F1 to F4) of basic unit with overlap region in their terminals obtained by PCR. Their molecular sizes were 84 bp. (B) Two-repeats generated by splicing PCR. Lanes 1 and 2 were products of F1/F2 and F3/F4, respectively. Their molecular sizes were 160 bp. (C) Four-repeat fragment. Lane 1 was the product of four-repeat sequence. Its molecular size was 303 bp.
3.3. Identification of TR48 3. Results 3.1. Constructing the fragment of four repeats
The inserted fragment in pTR48 might be in the right size as comparing with pTR12 and pTR24 directly (Fig. 4A). The interest fragment in TR4, TR8, TR12, TR24 and TR48 were about 303, 595, 886, 1766 and 3517 bp, respectively.
Four modified basic fragments with overlap region in their terminals were obtained by PCR, which were shown in Fig. 2A. They were in the right size. Two fragments of the two-repeats (Fig. 2B) were generated by splicing the modified basic fragments using splicing by overlap extension. Though there were many unexpected bands, the specific bands were obvious and in the size as design. The fragment of the four-repeats (Fig. 2C) was generated through splicing the fragments of two-repeats using splicing by overlap extension again. Though the specific band was not clear, the four-repeat fragment was obtained after extracting the main band using DNA gel extraction kit. 3.2. Construction of pTR48 pTR4 was obtained with the digested fragment that was in same size as the four-repeats obtained by splicing (Fig. 3A). Seven fragments of four-repeats (Fig. 3B) with different types of restriction endonuclease sites were obtained by amplifying the interest fragment in pTR4. Those fragments were cloned in the order that mentioned in the constructing strategy (Fig. 1A). The sizes of the recombinant phagemids, pTR4, pTR8 (with eight repeats) and pTR12 (with 12 repeats) were enlarged as expected (Fig. 3C). Two pTR24 (with 24 repeats) were obtained with correct inserted fragments in RFLP analysis (Fig. 3D). Compared with pTR12 and pTR24, The pTR48 with 48 repeats were in the right size (Fig. 4A).
Fig. 3. The gel electrophoresis in 1% agarose with ethidium bromide staining. Lane M2 in (A) and (D) was DNA size marker (250, 1000, 2500, 5000, 7500, 10,000 and 15000 bp, upwards). Lane M1 in (B) was the same DNA size marker as in Fig. 1. (A) RFLP analysis of the four-repeat construct. Lanes 1 and 2 were the pGEM3zf(C) and candidate pTR4 digested with the restriction endonucleases EcoRI and SacI, respectively. Lane 3 was the purified spliced product of the four-repeat. (B) The fourrepeats with different site of restriction endonuclease. (C) Compared the constructs with different number of repeats. Lane 1 was pGEM3zf(C). Lanes 2 and 3 were the constructs pTR4 and pTR8, respectively. Lanes 4–7 were the constructs of 12-repeat. (D) RFLP analysis of two constructs of 24-repeat. Lanes 1 and 2 were the constructs digested with one restriction endonucleases, and lanes 3 and 4 were the same constructs digested with two restriction endonuclease.
X.M. Peng et al. / Molecular and Cellular Probes 18 (2004) 383–388
Fig. 4. The gel electrophoresis in 1% agarose with ethidium bromide staining. Lane M2 in (B) and (C) was the same DNA size marker that mentioned in Fig. 2. (A) The comparing of the constructs of pTR12, pTR24 and pTR48. (B) RFLP analysis. Lanes 1–3 were pTR12, pTR24 and pTR48 digested with the restriction endonucleases EcoRI and PstI, respectively. (C) RFLP analysis of pTR48. Lane 1 was digested with EcoRI and PstI. Lane 2 was digested with EcoRI and XbaI. Lane 3 was digested with EcoRI and BamHI. Lane 4 was digested with EcoRI and SacI.
The interest fragment of pTR48 was the same as expected since it was a little larger than pGEM3zf(C) that was 3199 bp in length (Fig. 4B, lane 3). The four-repeat fragments in pTR48 might be in the same order as design since the expected bands were obtained in RFLP analysis with restriction endonucleases EcoRI and PstI, XbaI, BamHI or SacI (Fig. 4C). 3.4. Hybridization analysis of TR48 The interest sequence in pTR48 could not be confirmed by DNA sequencing since it had too much repeats. However, the exact order of the basic units in pTR48 could be indirectly demonstrated using hybridization analysis. If it was in the expected order, pTR48 could combine as many as 48 copies of the basic units. The hybridization results of the single-stranded DNA of pTR48 with the basic fragments were shown in Fig. 5A. It was obvious that the pTR48 could combine with much more than one copy of the basic unit. 3.5. TRPBA reaction The typical results of TRPBA were shown in Fig. 5(B) and (C). The products were not a single band when analyzed by gel electrophoresis (Fig. 5B). The size of the digested products was not 50 bp but 67 or 90 bp theoretically since there was 17 or 40 bp linker between each basic unit. The digested products indeed had two bands with expected size (Fig. 5C). It was obvious that the products of TRPBA were specific. Some products could not be digested, even during the prolonged incubation time. Those products might be single-stranded DNA. With the help of HincII, TRPBA could give positive results when the single-stranded pTR48 was as few as 100 copies per test (Fig. 5C).
387
Fig. 5. (A) The hybridization analysis of the single-stranded DNA of pTR48 with the fragment of basic unit. Lane 1 was the single-stranded DNA of p48R alone. Lanes 2 and 3 were the hybrids of the single-stranded pTR48 with different amount of the basic unit. Lane 4 was the basic unit alone. (B) and (C) The gel electrophoresis of the TRPBA products in 2% agarose with ethidium bromide staining. Lane 1 was the product of control, phagemid pGEM-3zf(C) with initial templates of 106 copies per test. Lanes 2–4 were the products of the single-stranded pTR48 with initial templates of 102 copies, 104 copies and 106 copies per test, respectively. Lanes M1 and M2 were the same DNA size markers that were mentioned in Figs. 1 or 3. (B) Direct gel electrophoresis of the TRPBA products. (C) Gel electrophoresis of TRPBA products after digestion with HincII.
3.6. Detection of HBV DNA The DNA fragment of HBV in pTR48-HBV was 430 bp. An expected band was obtained when pTR48-HBV was digested by PstI and HindIII. Its sequence was confirmed by DNA sequence analysis. The single-stranded DNA of pTR48-HBV was successfully obtained, and used to establish TRPBA for detecting HBV DNA. The products were analyzed by gel electrophoresis after the digestion with HincII. About as few as 103 copies of pTZ19U-HBV DNA per test were detected by this method with negative results of all empty and negative controls.
4. Discussion Tandem-repeated DNA sequence is the common structures in genome of human being and other organisms. Its functions are under intensively exploiting nowadays. Some scientists have used it as DNA probes in hybridization. It can enhance the signal of hybridization because of its multiple-sequence binding character [3,7]. The efficacy, however, may be limited since there is tridimensional hindrance when combining with too many secondary probes. It may be a promising way to make the best use of the tandem-repeated sequence by combining with the polymerase-based amplification. The TRPBA, as well as the LAMP and RAM methods, was performed by a DNA polymerase with high strand displacement activity [13,17]. It was just like rolling circle replication of some viruses with circular double-stranded
388
X.M. Peng et al. / Molecular and Cellular Probes 18 (2004) 383–388
DNA genome. The polymerase displaces the DNA strand encountered in its way of extension instead of cutting the nucleotides one by one from the 5 0 terminal like Taq DNA polymerase. In TRPBA, as many as 48 forward primers could simultaneously bind to TR48 in the beginning. These primers extended and displaced the downstream primers and their extended products. The displaced single-stranded sequences could then be bound by the reverse primers to produce more displaced single-stranded sequences for the forward primers again. In this way, large ramifying DNA complexes could be formed within a few circles and in the same temperature. The theoretical amplification capacity of TR48 is 248 times. In actual, as few as 100 copies per test of the single-stranded pTR48 could give positive results, and about 103 copies per test of HBV DNA could be detected in TRSBA with the digestion of HincII. With the assistance of more sensitive techniques, such as fluorescence or luminescence in the future, the TRPBA might be sensitive enough for the purposes of the most clinical practices. The RAM method consists of three steps, generating a circular structure by target-specific ligation, obtaining tandem-repeated sequences and amplifying tandemrepeated sequences with DNA polymerase [15–17]. As comparing with the RAM method, the TRPBA is simple and timesaving. Moreover, TR48 can be easily adapted to the detection of many kinds of gene or microorganisms by splicing it with the DNA fragment of target gene. For these reasons, TRPBA is worth for further investigations. References [1] Niesters HG. Molecular and diagnostic clinical virology in real time. Clin Microbiol Infect 2004;10:5–11. [2] Schutten M, Niesters HG. Clinical utility of viral quantification as a tool for disease monitoring. Expert Rev Mol Diagn 2001;1:153–62. [3] Horn T, Urdea MS. Forks and combs and DNA: the synthesis of branched oligodeoxyribonucleotides. Nucleic Acids Res 1989;17: 6959–67. [4] Niesters HG, Krajden M, Cork L, de Medina M, Hill M, Fries E, Osterhaus AD. A multicenter study evaluation of the digene hybrid capture II signal amplification technique for detection of hepatitis B virus DNA in serum samples and testing of EUROHEP standards. J Clin Microbiol 2000;38:2150–5.
[5] Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol 1986;51:263–73. [6] Yates S, Penning M, Goudsmit J, Frantzen I, van de Weijer B, van Strijp D, van Gemen B. Quantitative detection of hepatitis B virus DNA by real-time nucleic acid sequence-based amplification with molecular beacon detection. J Clin Microbiol 2001;39: 3656–65. [7] Kawai S, Maekawajiri S, Yamane A. A simple method of detecting amplified DNA with immobilized probes on microtiter wells. Anal Biochem 1993;209:63–9. [8] Grant PR, Garson JA, Tedder RS, Chan PK, Tam JS, Sung JJ. Detection of SARS coronavirus in plasma by real-time RT-PCR. N Engl J Med 2003;349:2468–9. [9] Ginocchio CC, Kemper M, Stellrecht KA, Witt DJ. Multicenter evaluation of the performance characteristics of the NucliSens HIV-1 QT assay used for quantitation of human immunodeficiency virus type 1 RNA. J Clin Microbiol 2003;41:164–73. [10] Pekler VA, Robbins WA, Nyamathi A, Yashina TL, Leak B, Robins TA. Use of versant TMA and bDNA 3.0 assays to detect and quantify hepatitis C virus in semen. J Clin Lab Anal 2003;17: 264–70. [11] Gilbert N, Corden S, Ijaz S, Grant PR, Tedder RS, Boxall EH. Comparison of commercial assays for the quantification of HBV DNA load in health care workers: calibration differences. J Virol Methods 2002;100:37–47. [12] Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 2000;28:E63. [13] Nagamine K, Watanabe K, Ohtsuka K, Hase T, Notomi T. Loopmediated isothermal amplification reaction using a nondenatured template. Clin Chem 2001;47:1742–3. [14] Nagamine K, Hase T, Notomi T. Accelerated reaction by loopmediated isothermal amplification using loop primers. Mol Cell Probes 2002;16:223–9. [15] Zhang DY, Brandwein M, Hsuih TC, Li H. Amplification of target-specific, ligation-dependent circular probe. Gene 1998;211: 277–85. [16] Zhang DY, Zhang W, Li X, Konomi Y. Detection of rare DNA targets by isothermal ramification amplification. Gene 2001;274:209–16. [17] Zhang W, Cohenford M, Lentrichia B, Isenberg HD, Simson E, Li H, Yi J, Zhang DY. Detection of Chlamydia trachomatis by isothermal ramification amplification method: a feasibility study. J Clin Microbiol 2002;40:128–32. [18] Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 1989;77:61–8. [19] Peng XM, Chen XJ, Li JG, Gu L, Huang YS, Gao ZL. Novel assay of competitively differentiated polymerase chain reaction for screening point mutation of hepatitis B virus. World J Gastroenterol 2003;9: 1743–6.
An isothermal amplification system based on the tandem-repeated DNA probe Xiao Mou Peng*, Yang Su Huang, Jian Guo Li, Yong Yu Mei, Lin Gu, Zhi Liang Gao, Gang Li Department of Infectious Diseases, Hepatitis Research Laboratory, The Third Affiliated Hospital, Sun Yat-sen University, Guangzhou 510630, Guangdong Province, China Received 19 April 2004; accepted for publication 25 June 2004
Abstract The hybridization methods and polymerase-based amplification methods are usually employed to detect pathogens and gene expressions quantitatively in clinical practices nowadays. However, the sensitiveness of the former and the specificity of the latter are not yet satisfied. To solve this problem, some promising comprehensive methods have been developed recently. Here we reported a new comprehensive method, a tandem repeated DNA probe-based amplification (TRPBA) system. To establish the TRPBA, TR48, an artificial tandem repeated DNA probe with 48 repeats of a 50 base pair unit was constructed. It could be efficiently amplified by Bst DNA polymerase at 61 8C for only 1 h. The products were analyzed either by direct gel electrophoresis or by gel electrophoresis after the digestion with restriction endonuclease HincII. The sensitiveness was as few as 100 copies per test, which was comparable with PCR-based techniques. The TR48 splicing with the DNA fragment of hepatitis B virus used as probe could successfully develop TRPBA to detect hepatitis B virus DNA. The TRPBA can be used in the future to detect many other genes or microorganisms simply by splicing TR48 with their DNA fragments. Thus, TRPBA might be useful because of its sensitiveness and simpleness. q 2004 Published by Elsevier Ltd. Keywords: DNA probe; Tandem repeats; Amplification; Polymerase; Hybridization
1. Introduction To demonstrate the copy numbers of pathogens or gene expressions is of important role in clinical practice because of its therapeutic and prognostic implications in human diseases [1,2]. Two kinds of methods are employed for this purpose. One kind is hybridization, including dot hybridization, branched DNA and Digene Hybrid Capture assay [3,4]. The other kind is the polymerase-based amplification, including polymerase chain reaction (PCR) and nucleic acid sequence-based amplification (NASBA) [5,6]. Both of them have the advantages and disadvantages of their own. The hybridization methods are usually of high specificity. Though some hybridization methods are still used in laboratories at present time, to improve their sensitiveness
* Corresponding author. Tel.: C86-20-85516867x2019; fax: C86-2085515940. E-mail address: [email protected] (X.M. Peng). 0890-8508/$ - see front matter q 2004 Published by Elsevier Ltd. doi:10.1016/j.mcp.2004.06.004
is critical for them to be used further. Tandem-repeated DNA sequence with proper length might enhance the signals of hybridization since it could combine with more than one copy of the target sequences or secondary probes. When used as immobilized probe in hybridization on microtiter wells, the tandem-repeated sequence increased the sensitiveness of hybridization indeed [7]. The best of this function of the tandem-repeated sequence were made in branched DNA, in which the tandem-repeated sequences were used as a series of detecting probes to obtain much stronger signals [3]. The polymerase-based amplification methods, such as PCR and NASBA, are common methods for the clinical diagnosis [8,9]. They are usually more sensitive than those methods based on hybridization [10,11]. Their results, however, are less believable because its specificity in most situations only depends on two primers of 20 base pairs (bp) in length. Moreover, some PCR methods require a contamination risk step of electrophoresis, or a special apparatus to monitor the amplification of DNA. A high specificity,
384
X.M. Peng et al. / Molecular and Cellular Probes 18 (2004) 383–388
efficiency and rapidity polymerase-based amplification method, loop-mediated isothermal amplification (LAMP) was recently developed by Notomi et al [12–14]. Its specificity depended on six regions that were longer than 20 bp in the target sequences. The specificity of hybridization is undoubtedly high because it depends on DNA sequence much longer than that of primers. Comprehensive methods, both polymerase-based and hybridization-based, may be an important way to establish new methods of high specificity and sensitiveness. Recently, such method, called isothermal ramification amplification (RAM), was established [15–17], in which a specific circle structure was generated by DNA ligase after a special probe (C-probe) hybridized with target sequence, and then the circle structure was amplified using DNA polymerase. In this report, we describe another comprehensive technique, the tandem-repeated DNA probe-based amplification (TRPBA), in which the tandem-repeated probe was directly amplified after its hybridization with target DNA. Thus, this method would be simple and timesaving as comparing with RAM methods based on the C-probe.
Table 1 Oligonucleotides, primers and probes Oligonucleotide fragment or primers
Oligonucleotide fragment or primer sequence 5 0 –3 0
BU
AGTCAATGTCAACCAGCAGTCTCAGGGCGTAGAGTAGGGAGTGCGAGTGT CTCACTCTCGTGTAGATAGTCAATGTCAACCAGC TAGTGGACGTGCCGTGAACACTCGCACTCCCTAC TCACGGCACGTCCACTAAGTCAATGTCAACCAGC TGCTAAGACATCGCCAGACACTCGCACTCCCTAC CTGGCGATGTCTTAGCAAGTCAATGTCAACCAGC CTCGCTGATGCTGACCTACACTCGCACTCCCTAC TGCTAAGACATCGCCAG CTGGCGATGTCTTAGCA CAAGAATTCGGTTACCCTCACTCTCGTGTAGAT TTCGAGCTCCTCGCTGATGCTGACCT CCTGAGCTCCTCACTCTCGTGTAGAT CCCGGTACCCTCGCTGATGCTGACCT CCTGGTACCCTCACTCTCGTGTAGAT CCTGGATCCCTCGCTGATGCTGACCT CAAGAATTCGGATCCCTCACTCTCGTGTAGAT CATTCTAGAGGTTACCCTCGCTGATGCTGACCT CCCGAATTCTCTAGACTCACTCTCGTGTAGAT CCGCTGCAGGTGACCTCGCTGATGCTGACCT ATAAGTCAATGTCAACCAGCAGTCTCAG GTGACACTCGCACTCCCTACTCTACGCC CCACTGCAGAGACCGTTCATGTCCTACTGTTCAAGC CCCAAGCTTATCCACACTCCAAAAGACACC Biotin-CCCTGCGCTGAACATGGAGAACATCACATCAGG Biotin-TCAAGGTATGTTGCCCGTTTGTCCTCTAATTCC
P1 P2 P3 P4 P5 P6 P7 P8 R4-P1
2. Materials and methods
R4-P2 R4-P3 R4-P4 R4-P5 R4-P6 R4-P7
2.1. Oligonucleotide fragment and PCR primers
R4-P8
The basic unit (BU, in Table 1) for the construction of the tandem-repeated sequence was a random sequence of 50 bp in size, which did not share any relationship with common pathogens, such as hepatitis B virus (HBV), hepatitis C virus and human immunodeficiency virus according to the Blast program (htpp://www.ncbi.nlm.nih.gov). This design would let it be possible for the tandem-repeated sequence to be used as probe in clinical practices. Primers, from P1 to P8, were used to amplify the basic unit in order to obtain a set of overlapping fragments for the construction of the fourrepeat sequence. Primers, from R4-P1 to R4-P10 were used to amplify the four-repeat sequence in order to obtain a set of four-repeat fragments for the construction of the 48-repeat sequence. Primers, TRP1 and TRP2 were used in TRPBA analysis. The rest of primers or probes were used to adapt the TRPBA to detect HBV DNA. All oligonucleotide fragments and PCR primers were synthesized using standard phosphoramidite chemistry on an ABI 394 DNA synthesizer. 2.2. Construction of tandem-repeated DNA sequence The artificial tandem-repeated DNA sequence, TR48, constructed in this study had 48 repeats of the BU (Table 1). The strategy for the construction of TR48 was shown in Fig. 1. The first step was to construct the four-repeats, 4R, by splicing four fragments that were shown in Fig. 1A using splicing by overlap extension [18]. The 4R was then
R4-P9 R4-P10 TRP1 TRP2 HB-P1a HB-P2a HB-BIO1a HB-BIO2a
a The sequences were derived from HBV complete genome (GeneBank accession no. AB10290).
recovered from the agarose gel, and cloned into phagemid pGEM-3zf(C) (Promega) to generate the recombinant vector pTR4. The second step was to generate seven fragments of the four-repeats with different type of restriction endonuclease sites in terminals using PCR, in which pTR4 was utilized as template, and 4R-P1/4R-P2, 4R-P3/4R-P4, 4R-P5/4R-P6, 4R-P7/4R-P2, 4R-P5/4R-P8, 4R-P9/4R-P2 and 4R-P5/4R-P10 as primers, respectively. The restriction endonuclease sites of each fragment were shown in Fig. 1A. The last step was to construct pTR48 by cloning those seven fragments into pGEM-3zf(C) in the order as shown in Fig. 1B.
X.M. Peng et al. / Molecular and Cellular Probes 18 (2004) 383–388
385
Fig. 1. The strategy for the construction of pTR48. (A) The plan for the construction of seven fragments with four repeats. BU was the basic unit. 1R, 2R and 4R were the fragments contained 1, 2 and 4 repeats, respectively. P1 to P6 were primers that were shown in detail in Table 1. SOE stood for the splicing by overlap extension. Characters, E, S, K, B, X and P stood for restriction endonuclease sites of EcoRI, SacI, KpnI, BamHI, XbaI and PstI, respectively. E/X or E/B indicated that there were sites of EcoRI and XbaI or EcoRI and BamHI in the same terminal. (B) The protocol for the construction of pTR48 by cloning, which showed the adding order of the four repeats. pGEM-3zf(C) was a commercial phagemid. The characters in the parentheses just after the name of the given recombinant vectors indicated the restriction endonuclease sites in pGEM-3zf(C) that the interest sequence has been inserted.
2.3. Preparation of single-stranded DNA of pTR48 JM109 strain of Escherichia coli (Promega) was used as host bacteria of the recombinant phagemid, pTR48. The transformed bacteria were cultivated in Luria–Bertani culture with ampicillin. The cultures were incubated at 37 8C for half an hour before superinfected by helper phage R408 (Promega) with the ratio of 1:10 (bacteria: phage). The cultures were further incubated at 37 8C for 10 h. The single-stranded DNA of pTR48 was extracted from the supernatant of the cultures using M13 single-stranded DNA preparation kits (Omega). 2.4. Evaluation of TR48 The sequence of pTR48 could not be confirmed by DNA sequencing because it contained too much repeats. However, it could be confirmed according to the specific bands when using several restriction endonucleases in the restriction fragment length polymorphism (RFLP) analysis. The single-stranded DNA prepared above was the complement strand of TR48. Thus, it was possible to confirm the sequence of TR48 by the hybridization analysis of the single-stranded DNA with the basic unit. If the sequence
of TR48 was correct, the hybrids would be much bigger since TR48 could combine as many as 48 basic units. 2.5. Reaction components of TRPBA The reaction mixture was 25 ml, and contained 20 mM Tris–HCl (pH 8.8), 10 mM KCl, 10 mM (NH4)2SO4, 4 mM Mg SO4, 0.1% Triton-X100, 0.4 mM dNTPs, 8 U Bst DNA polymerase large fragment (New England Biolabs), 20 pmol of each primers, TRP1 and TRP2 (Table 1), and given amount of the single-stranded DNA of pTR48. The reaction was performed at 61 8C for 1 h. The products were detected either by direct gel electrophoresis or gel electrophoresis after the digestion with restriction endonuclease HincII (Promega). 2.6. Evaluation of TRPBA The copy numbers of the single-stranded DNA of pTR48 were calculated out according to the DNA amount measured by the UV spectrometer. The single-stranded DNA was diluted in a series, and then used to evaluate the specificity and the sensitivity of the TRPBA. The specificity of the TRPBA products was confirmed using RFLP analysis.
386
X.M. Peng et al. / Molecular and Cellular Probes 18 (2004) 383–388
2.7. Detection of HBV DNA using TRPBA A DNA fragment of HBV (position at 1848–2277, GeneBank accession no. AB10290) was obtained from the recombinant plasmid, pTZ19U-HBV [19], which contained complete genome of HBV by PCR using primers of HB-P1 and HB-P2 (Table 1), and cloned into pTR48 between the sites of PstI and HindIII to generate pTR48-HBV. The single-stranded DNA of pTR48-HBV was prepared just as that of pTR48. 107 copies/ml single-stranded DNA and a series of dilutions of pTZ19U-HBV were mixed, boiled for 10 min and quenched quickly on ice. The mixture was added to microtiter wells that coated with the streptavidin and Biotin-labeled probes (Table 1, HB-BIO1 and HB-BIO2). The hybridization reaction and the hybrid immobilization were carried out at 61 8C for 1 h. After washing five times with TBST (50 mM Tris–HCl (pH 7.2), 0.2 M NaCl, 0.05% Tween-20), the TRPBA was performed as mentioned above. Normal saline, pGEM3zf(C) and pTR48 were used as empty or negative controls.
Fig. 2. The gel electrophoresis of the splicing products in 2% agarose with ethidium bromide staining. Lane M1 in (A), (B), (C) was DNA size marker (100, 250, 500, 750, 1000 and 2000 bp upwards). (A) Modified basic units. From lanes 1 to 4 were four fragments (from F1 to F4) of basic unit with overlap region in their terminals obtained by PCR. Their molecular sizes were 84 bp. (B) Two-repeats generated by splicing PCR. Lanes 1 and 2 were products of F1/F2 and F3/F4, respectively. Their molecular sizes were 160 bp. (C) Four-repeat fragment. Lane 1 was the product of four-repeat sequence. Its molecular size was 303 bp.
3.3. Identification of TR48 3. Results 3.1. Constructing the fragment of four repeats
The inserted fragment in pTR48 might be in the right size as comparing with pTR12 and pTR24 directly (Fig. 4A). The interest fragment in TR4, TR8, TR12, TR24 and TR48 were about 303, 595, 886, 1766 and 3517 bp, respectively.
Four modified basic fragments with overlap region in their terminals were obtained by PCR, which were shown in Fig. 2A. They were in the right size. Two fragments of the two-repeats (Fig. 2B) were generated by splicing the modified basic fragments using splicing by overlap extension. Though there were many unexpected bands, the specific bands were obvious and in the size as design. The fragment of the four-repeats (Fig. 2C) was generated through splicing the fragments of two-repeats using splicing by overlap extension again. Though the specific band was not clear, the four-repeat fragment was obtained after extracting the main band using DNA gel extraction kit. 3.2. Construction of pTR48 pTR4 was obtained with the digested fragment that was in same size as the four-repeats obtained by splicing (Fig. 3A). Seven fragments of four-repeats (Fig. 3B) with different types of restriction endonuclease sites were obtained by amplifying the interest fragment in pTR4. Those fragments were cloned in the order that mentioned in the constructing strategy (Fig. 1A). The sizes of the recombinant phagemids, pTR4, pTR8 (with eight repeats) and pTR12 (with 12 repeats) were enlarged as expected (Fig. 3C). Two pTR24 (with 24 repeats) were obtained with correct inserted fragments in RFLP analysis (Fig. 3D). Compared with pTR12 and pTR24, The pTR48 with 48 repeats were in the right size (Fig. 4A).
Fig. 3. The gel electrophoresis in 1% agarose with ethidium bromide staining. Lane M2 in (A) and (D) was DNA size marker (250, 1000, 2500, 5000, 7500, 10,000 and 15000 bp, upwards). Lane M1 in (B) was the same DNA size marker as in Fig. 1. (A) RFLP analysis of the four-repeat construct. Lanes 1 and 2 were the pGEM3zf(C) and candidate pTR4 digested with the restriction endonucleases EcoRI and SacI, respectively. Lane 3 was the purified spliced product of the four-repeat. (B) The fourrepeats with different site of restriction endonuclease. (C) Compared the constructs with different number of repeats. Lane 1 was pGEM3zf(C). Lanes 2 and 3 were the constructs pTR4 and pTR8, respectively. Lanes 4–7 were the constructs of 12-repeat. (D) RFLP analysis of two constructs of 24-repeat. Lanes 1 and 2 were the constructs digested with one restriction endonucleases, and lanes 3 and 4 were the same constructs digested with two restriction endonuclease.
X.M. Peng et al. / Molecular and Cellular Probes 18 (2004) 383–388
Fig. 4. The gel electrophoresis in 1% agarose with ethidium bromide staining. Lane M2 in (B) and (C) was the same DNA size marker that mentioned in Fig. 2. (A) The comparing of the constructs of pTR12, pTR24 and pTR48. (B) RFLP analysis. Lanes 1–3 were pTR12, pTR24 and pTR48 digested with the restriction endonucleases EcoRI and PstI, respectively. (C) RFLP analysis of pTR48. Lane 1 was digested with EcoRI and PstI. Lane 2 was digested with EcoRI and XbaI. Lane 3 was digested with EcoRI and BamHI. Lane 4 was digested with EcoRI and SacI.
The interest fragment of pTR48 was the same as expected since it was a little larger than pGEM3zf(C) that was 3199 bp in length (Fig. 4B, lane 3). The four-repeat fragments in pTR48 might be in the same order as design since the expected bands were obtained in RFLP analysis with restriction endonucleases EcoRI and PstI, XbaI, BamHI or SacI (Fig. 4C). 3.4. Hybridization analysis of TR48 The interest sequence in pTR48 could not be confirmed by DNA sequencing since it had too much repeats. However, the exact order of the basic units in pTR48 could be indirectly demonstrated using hybridization analysis. If it was in the expected order, pTR48 could combine as many as 48 copies of the basic units. The hybridization results of the single-stranded DNA of pTR48 with the basic fragments were shown in Fig. 5A. It was obvious that the pTR48 could combine with much more than one copy of the basic unit. 3.5. TRPBA reaction The typical results of TRPBA were shown in Fig. 5(B) and (C). The products were not a single band when analyzed by gel electrophoresis (Fig. 5B). The size of the digested products was not 50 bp but 67 or 90 bp theoretically since there was 17 or 40 bp linker between each basic unit. The digested products indeed had two bands with expected size (Fig. 5C). It was obvious that the products of TRPBA were specific. Some products could not be digested, even during the prolonged incubation time. Those products might be single-stranded DNA. With the help of HincII, TRPBA could give positive results when the single-stranded pTR48 was as few as 100 copies per test (Fig. 5C).
387
Fig. 5. (A) The hybridization analysis of the single-stranded DNA of pTR48 with the fragment of basic unit. Lane 1 was the single-stranded DNA of p48R alone. Lanes 2 and 3 were the hybrids of the single-stranded pTR48 with different amount of the basic unit. Lane 4 was the basic unit alone. (B) and (C) The gel electrophoresis of the TRPBA products in 2% agarose with ethidium bromide staining. Lane 1 was the product of control, phagemid pGEM-3zf(C) with initial templates of 106 copies per test. Lanes 2–4 were the products of the single-stranded pTR48 with initial templates of 102 copies, 104 copies and 106 copies per test, respectively. Lanes M1 and M2 were the same DNA size markers that were mentioned in Figs. 1 or 3. (B) Direct gel electrophoresis of the TRPBA products. (C) Gel electrophoresis of TRPBA products after digestion with HincII.
3.6. Detection of HBV DNA The DNA fragment of HBV in pTR48-HBV was 430 bp. An expected band was obtained when pTR48-HBV was digested by PstI and HindIII. Its sequence was confirmed by DNA sequence analysis. The single-stranded DNA of pTR48-HBV was successfully obtained, and used to establish TRPBA for detecting HBV DNA. The products were analyzed by gel electrophoresis after the digestion with HincII. About as few as 103 copies of pTZ19U-HBV DNA per test were detected by this method with negative results of all empty and negative controls.
4. Discussion Tandem-repeated DNA sequence is the common structures in genome of human being and other organisms. Its functions are under intensively exploiting nowadays. Some scientists have used it as DNA probes in hybridization. It can enhance the signal of hybridization because of its multiple-sequence binding character [3,7]. The efficacy, however, may be limited since there is tridimensional hindrance when combining with too many secondary probes. It may be a promising way to make the best use of the tandem-repeated sequence by combining with the polymerase-based amplification. The TRPBA, as well as the LAMP and RAM methods, was performed by a DNA polymerase with high strand displacement activity [13,17]. It was just like rolling circle replication of some viruses with circular double-stranded
388
X.M. Peng et al. / Molecular and Cellular Probes 18 (2004) 383–388
DNA genome. The polymerase displaces the DNA strand encountered in its way of extension instead of cutting the nucleotides one by one from the 5 0 terminal like Taq DNA polymerase. In TRPBA, as many as 48 forward primers could simultaneously bind to TR48 in the beginning. These primers extended and displaced the downstream primers and their extended products. The displaced single-stranded sequences could then be bound by the reverse primers to produce more displaced single-stranded sequences for the forward primers again. In this way, large ramifying DNA complexes could be formed within a few circles and in the same temperature. The theoretical amplification capacity of TR48 is 248 times. In actual, as few as 100 copies per test of the single-stranded pTR48 could give positive results, and about 103 copies per test of HBV DNA could be detected in TRSBA with the digestion of HincII. With the assistance of more sensitive techniques, such as fluorescence or luminescence in the future, the TRPBA might be sensitive enough for the purposes of the most clinical practices. The RAM method consists of three steps, generating a circular structure by target-specific ligation, obtaining tandem-repeated sequences and amplifying tandemrepeated sequences with DNA polymerase [15–17]. As comparing with the RAM method, the TRPBA is simple and timesaving. Moreover, TR48 can be easily adapted to the detection of many kinds of gene or microorganisms by splicing it with the DNA fragment of target gene. For these reasons, TRPBA is worth for further investigations. References [1] Niesters HG. Molecular and diagnostic clinical virology in real time. Clin Microbiol Infect 2004;10:5–11. [2] Schutten M, Niesters HG. Clinical utility of viral quantification as a tool for disease monitoring. Expert Rev Mol Diagn 2001;1:153–62. [3] Horn T, Urdea MS. Forks and combs and DNA: the synthesis of branched oligodeoxyribonucleotides. Nucleic Acids Res 1989;17: 6959–67. [4] Niesters HG, Krajden M, Cork L, de Medina M, Hill M, Fries E, Osterhaus AD. A multicenter study evaluation of the digene hybrid capture II signal amplification technique for detection of hepatitis B virus DNA in serum samples and testing of EUROHEP standards. J Clin Microbiol 2000;38:2150–5.
[5] Mullis K, Faloona F, Scharf S, Saiki R, Horn G, Erlich H. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp Quant Biol 1986;51:263–73. [6] Yates S, Penning M, Goudsmit J, Frantzen I, van de Weijer B, van Strijp D, van Gemen B. Quantitative detection of hepatitis B virus DNA by real-time nucleic acid sequence-based amplification with molecular beacon detection. J Clin Microbiol 2001;39: 3656–65. [7] Kawai S, Maekawajiri S, Yamane A. A simple method of detecting amplified DNA with immobilized probes on microtiter wells. Anal Biochem 1993;209:63–9. [8] Grant PR, Garson JA, Tedder RS, Chan PK, Tam JS, Sung JJ. Detection of SARS coronavirus in plasma by real-time RT-PCR. N Engl J Med 2003;349:2468–9. [9] Ginocchio CC, Kemper M, Stellrecht KA, Witt DJ. Multicenter evaluation of the performance characteristics of the NucliSens HIV-1 QT assay used for quantitation of human immunodeficiency virus type 1 RNA. J Clin Microbiol 2003;41:164–73. [10] Pekler VA, Robbins WA, Nyamathi A, Yashina TL, Leak B, Robins TA. Use of versant TMA and bDNA 3.0 assays to detect and quantify hepatitis C virus in semen. J Clin Lab Anal 2003;17: 264–70. [11] Gilbert N, Corden S, Ijaz S, Grant PR, Tedder RS, Boxall EH. Comparison of commercial assays for the quantification of HBV DNA load in health care workers: calibration differences. J Virol Methods 2002;100:37–47. [12] Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 2000;28:E63. [13] Nagamine K, Watanabe K, Ohtsuka K, Hase T, Notomi T. Loopmediated isothermal amplification reaction using a nondenatured template. Clin Chem 2001;47:1742–3. [14] Nagamine K, Hase T, Notomi T. Accelerated reaction by loopmediated isothermal amplification using loop primers. Mol Cell Probes 2002;16:223–9. [15] Zhang DY, Brandwein M, Hsuih TC, Li H. Amplification of target-specific, ligation-dependent circular probe. Gene 1998;211: 277–85. [16] Zhang DY, Zhang W, Li X, Konomi Y. Detection of rare DNA targets by isothermal ramification amplification. Gene 2001;274:209–16. [17] Zhang W, Cohenford M, Lentrichia B, Isenberg HD, Simson E, Li H, Yi J, Zhang DY. Detection of Chlamydia trachomatis by isothermal ramification amplification method: a feasibility study. J Clin Microbiol 2002;40:128–32. [18] Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR. Engineering hybrid genes without the use of restriction enzymes: gene splicing by overlap extension. Gene 1989;77:61–8. [19] Peng XM, Chen XJ, Li JG, Gu L, Huang YS, Gao ZL. Novel assay of competitively differentiated polymerase chain reaction for screening point mutation of hepatitis B virus. World J Gastroenterol 2003;9: 1743–6.