Loop-mediated isothermal amplification test for Trypanosoma vivax based on satellite repeat DNA

Veterinary Parasitology 180 (2011) 358–362

Contents lists available at ScienceDirect

Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar

Short communication

Loop-mediated isothermal amplification test for Trypanosoma vivax based on satellite repeat DNA Z.K. Njiru a,∗ , J.O. Ouma b , R. Bateta b , S.E. Njeru b , K. Ndungu b , P.K. Gitonga b , S. Guya b , R. Traub a a b

School of Veterinary Sciences, University of Queensland, Gatton, QLD 4343, Australia Trypanosomiasis Research Centre, Kenya Agricultural Research Institute, P.O. Box 362-00902, Kikuyu, Kenya

a r t i c l e

i n f o

Article history: Received 15 January 2011 Received in revised form 10 March 2011 Accepted 11 March 2011 Keywords: Loop-mediated isothermal amplification Trypanosoma vivax Nagana Trypanosomiasis PCR

a b s t r a c t Trypanosoma vivax is major cause of animal trypanosomiasis and responsible for enormous economic burden in Africa and South America animal industry. T. vivax infections mostly run low parasitaemia with no apparent clinical symptoms, making diagnosis a challenge. This work reports the design and evaluation of a loop-mediated isothermal amplification (LAMP) test for detecting T. vivax DNA based on the nuclear satellite repeat sequence. The assay is rapid with results obtained within 35 min. The analytical sensitivity is ∼1 trypanosome/ml while that of the classical PCR tests ranged from 10 to 103 trypanosomes/ml. The T. vivax LAMP test reported here is simple, robust and has future potential in diagnosis of animal trypanosomiasis in the field. © 2011 Elsevier B.V. All rights reserved.

1. Introduction Trypanosoma vivax is a widely distributed parasite and a major pathogen of ruminants in sub-Saharan Africa and South America. In Africa, it is predominantly transmitted cyclically by tsetse flies and to a lesser extent by biting flies while in South America it is mechanically transmitted by blood-sucking flies such as tabanids and stable flies (Wells, 1984; Meléndez et al., 1993). T. vivax is economically important because it causes mortality and high morbidity in ruminant livestock. Different patterns of disease occur in Africa and South America; in South America the disease occurs in cattle as epizootics and with rare outbreaks (Osório et al., 2008) while in Africa the disease runs a more severe and acute form (Stephen, 1986). A few East African isolates of T. vivax cause an acute hemorrhagic syn-

∗ Corresponding author at: School of Veterinary Sciences, University of Queensland, Inner Ring Road, Blgd 8114, RM 231, Gatton, QLD 4343, Australia. Tel.: +61 7 5460 1973. E-mail addresses: [email protected], [email protected] (Z.K. Njiru). 0304-4017/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.vetpar.2011.03.021

drome with a mortality rate of 6–35% (Assoku and Gardiner, 1989; Magona et al., 2008). The definition of accurate geographical endemicity of T. vivax has been limited by the ease in which variety of insect vectors (some yet to be identified) transmits the parasite (Masake et al., 1997). As such the most definitive way of verifying the presence of the parasite is through its detection in the host and to a lesser extent in vectors. Detection of T. vivax in animals is a challenging task since infection runs typically a low parasitaemia limiting the use of parasitological techniques such as microscopy in the field diagnosis (Nantulya, 1990). These drawbacks led to development of antibody based techniques such as antibody indirect fluorescent staining technique (Platt and Adams, 1976) and enzyme-linked immunosorbent assays (ELISA) (Luckins, 1977; Nantulya, 1990; Ferenc et al., 1990). The persistence of antibodies in the host after treatment implied that these antibody detecting tests could not differentiate between past and current infection. To overcome the limitation imposed by the antibody assays, an antigen based ELISA was developed (Nantulya et al., 1992) but its diagnostic parameters in the field were not encouraging

Z.K. Njiru et al. / Veterinary Parasitology 180 (2011) 358–362

(Desquesnes, 1996). Molecular based test (PCR) promised better sensitivity and a range of them were developed (Masiga et al., 1992; Masake et al., 1997; Morlais et al., 2001) but the demanding nature of PCR technique has limited its use in routine diagnosis. Nevertheless due to low parasitaemia and difficulties in propagating T. vivax in mice, PCR has remained the most appropriate method for laboratory based diagnosis (Jones and Dávila, 2001). To date a definitive field based assay for T. vivax has been elusive, therefore it is essential to continue evaluating new diagnostic technologies and especially those that offer platforms for developing point of use tests. Loop-mediated isothermal amplification (LAMP) is a novel gene amplification method that amplifies DNA under isothermal conditions (Notomi et al., 2000). The technique uses four to six primers that recognize six to eight regions of the target DNA and relies on Bst DNA polymerase, an enzyme that synthesizes DNA through strand displacement activity. The LAMP method has several advantages over PCR in that: (i) LAMP amplification can be achieved using simple heating device that maintains temperature at isothermal (60–65 ◦ C), (ii) amplification can be achieved using partially or non-processed template (Kaneko et al., 2007; Njiru et al., 2008) therefore DNA extraction may not be necessary, (iii) reactions are rapid and require shorter time (Nagamine et al., 2002), (iv) sensitivity is equal or higher than that of PCR and (v) the technology allows the use of varied product detection formats. These characteristics make LAMP strategy ideal for T. vivax diagnosis in resource poor endemic regions. In this study, we have designed a rapid T. vivax LAMP test based on the satellite repeat DNA. The nuclear satellite repeat sequence is a desired target because it is multicopy gene and widely conserved among T. vivax isolates in Africa and S. America. The test was evaluated and compared with PCR tests using a panel of T. vivax isolates and archived field samples. 2. Materials and methods 2.1. Preparation of template A total of 23 T. vivax samples collected from Kenya, Uganda, Tanzania and Nigeria from bovine and tsetse flies between 1951 and 1991 were used in this study. The samples included three hemorrhagic T. vivax samples from Kenya. The DNA was prepared using the Qiagen DNeasy blood and tissue kit and following the manufacturer instructions. The resulting DNA was stored at −20 ◦ C. 2.2. Polymerase chain reaction The PCR test reactions for satellite repeat DNA (Masiga et al., 1992) and diagnostic antigen gene (Masake et al., 1997) were done using the published conditions. A third PCR for satellite repeat DNA was performed using outer forward (F3) and backward (B3) LAMP primers. The new PCR test was performed using a 25 ␮l reaction consisting of 1× PCR buffer, 200 ␮M of each dNTP, 1.5 mM of MgCl2 , 12.5 pmol of each F3 and B3 primers, 1 U Taq DNA Polymerase (Fisher Biotec, WA, Australia) and 1-␮l of DNA template. The reactions were done in duplicates using a

359

96-Well GeneAmp® PCR System 9700 (Applied Biosystems, Australia) at: 1 cycle 95 ◦ C for 10 min, followed by 40 cycles of 94 ◦ C for 45 s, 63 ◦ C for 30 s and 72 ◦ C for 30 s and a final extension at 72 ◦ C for 10 min. After amplifications, 10-␮l of the PCR products were resolved for 70 min in 2.0% agarose gel stained with SYBR® safe DNA gel stain (Invitrogen, Victoria, Australia). The gel images were documented using Gel- Doc-XR system (Bio-Rad Lab). 2.3. LAMP primers and reaction T. vivax satellite repeat DNA (Accession number J03989) was used for designing six LAMP primers. The primers were forward and backward primers: F3 = TGTTCTGGTGGCCTGTTGC and B3 = GGCCGGAGCGAGAGGTGC, forward and backward inner primers: FIP = GTGGAGCGTGCCAACGTGGCACCCGCTCCCAGACCATA and BIP = TGTCTAGCGTGACGCGATGGAAGAGGGAGTGGGGAAGG and loop forward and backward primers: CACATGGAGCATCAGGAC and LB: CCGTGCACTGTCCCGCAC. The LAMP tests were carried out in 25-␮l reactions consisting of 5 pmol of the outer primers, 20 pmol of loop primers, 40 pmol of the inner primers, 4 mM of extra MgSO4 , 1 M betaine (Sigma–Aldrich, St. Louis, MO, USA) and 2.5 mM deoxynucleotide triphosphates mix (dNTP). The 1× ThermoPol reaction buffer contained 20 mM Tris–HCl (pH 8.8), 10 mM KCl, 10 mM (NH4 )2 SO4 , 2 mM MgSO4 and 0.1% Triton X-100. The Bst DNA polymerase (Large fragment; New England Biolabs, MA, USA) was 1 ␮l (8 units) while SYTO-9 fluorescence dye at 1.5 ␮M (Molecular Probes, OR USA) was used for each real time reaction. The template was 1-␮l (∼1 ng) of T. vivax isolate EATRO 1186. The mixture was incubated at 63 ◦ C in the Rotor-Gene 6000 (Qiagen, Victoria, Australia) and data acquired on HRM channel (460–510 nm) followed by reaction inactivation at 80 ◦ C for 4 min. Later the assay was trialed using a normal water bath. Briefly, water was heated to ∼63–64 ◦ C and the LAMP reaction tubes suspended in water using a floater for 1 h, after which the temperature was raised to approximately 80 ◦ C to stop the reactions. To select an appropriate restriction enzyme for product analysis, the target sequence was analyzed using restriction enzyme mapper in DNAman software (Lynnon Corporation, Quebec, Canada). 2.4. Detection and confirmation of LAMP product The LAMP reactions were monitored in real time through fluorescence of double stranded DNA (dsDNA) in Rotor-Gene 6000. After amplification, the products were further analyzed through electrophoresis in 2.0% agarose gels stained with SYBR® safe DNA gel stain and through addition of 1/10 dilution of SYBR® Green I. Two methods were used to confirm that the T. vivax LAMP amplified the correct target: (i) the melt curves were acquired using 1 ◦ C step, with a hold of 30 s, from 63 ◦ C to 96 ◦ C and (ii) 1–2 ␮l of the amplification product was incubated with restriction enzyme NdeI (New England Biolabs, MA, USA) at 37 ◦ C for 4 h followed by electrophoresis in 3% agarose gel.

360

Z.K. Njiru et al. / Veterinary Parasitology 180 (2011) 358–362

Table 1 The analytical sensitivity of T. vivax LAMP assay compared with PCR tests using templates from 10-fold serial dilution of T. vivax isolate EATRO 1186. Type of test

Target gene

Specificity

10-fold dilutiona −1

Reference −2

−3

−4

−5

−6

−7

−8

Neat

10

10

10

10

10

10

10

10

LAMP PCR

Satellite DNA Satellite DNA

T. vivax ”

+ +

+ +

+ +

+ +

+ +

+ +

+ –

– –

– –

PCR PCR

Satellite DNA Diagnostic antigen

” ”

+ +

+ +

+ +

+ +

+ –

+ –

– –

– –

– –

This study This study (F3/B3 primers) Masiga et al. (1992) Masake et al. (1997)

Neat = approximately 100 ng. a 10−1 (∼1.0 × 105 tryps/ml), 10−2 (∼1.0 × 104 tryps/ml) and 10−8 (∼0.01 tryps/ml).

2.5. LAMP and PCR analytical sensitivities Ten-fold serial dilution of ∼10 ng of T. vivax EATRO 1186 DNA was used to compare and determine the analytical sensitivity of T. vivax LAMP and the PCR tests. The template was 1-␮l for each serial dilution. The specificity of the LAMP test was assessed with DNA prepared from biting flies (stomoxys), Glossina pallidipes, bovine and other pathogenic trypanosomes; T.b. brucei, T.b. gambiense, T.b. evansi, T. congolense savannah, T.c. kilifi, T.c. forest, T. simiae, T.s. tsavo and T. godfreyi. 2.6. Analysis of archived bovine samples A total of 376 archived DNA samples prepared from three tsetse flies, 16 bovine buffy coats collected from Lambwe valley, Kenya and 357 from blood samples collected in Nguruman, Kenya (Njiru et al., 2005) were used (Table 2). The DNA was prepared using Qiagen DNeasy Blood & Tissue Kit. In addition, supernatant was prepared from bovine blood spiked with ∼1–100 pg of T. vivax DNA as previously described (Njiru et al., 2008) and 2-␮l of the template was used. 25-␮l LAMP reactions (Section 2.3) were carried out for the field samples and comprised of runs of 1 and 3-␮l of the purified template. 3. Results The inclusion of loop primers reduced the reaction time by an average of 25 min for each dilution and increased the assay analytical sensitivity by 103 -fold to an equivalent of 1 trypanosome/ml (1 pg). The post amplification analysis of LAMP product showed reproducible melt curves with a melting temperature (Tm ) of ∼90 ◦ C for all T. vivax isolates while restriction enzyme NdeI gave the predicted

sizes of ∼80 bp and 140 bp respectively. T. vivax LAMP test was 10 and 103 -fold more sensitive than satellite repeat PCR (Masiga et al., 1992) and diagnostic antigen PCR test (Masake et al., 1997) respectively (Table 1). The positive reactions showed ladder like pattern after electrophoresis in agarose gel indicating the formation of stem-loops and turned green on addition of 1/10 dilution of SYBR® Green I. On the analysis of the T. vivax samples, the LAMP test detected 20/23, satellite repeat 15/23 and the diagnostic antigen PCR 7/23 (Table 2). The analysis of 357 archived bovine samples revealed a T. vivax prevalence of 7.6% through LAMP test, 5.3% by satellite repeat PCR and 1.7% with diagnostic antigen PCR (Table 2). The use of 3-␮l of template did not improve the detection rate. We recorded a 100% agreement in detection of T. vivax DNA using real time machine and the water bath. In addition, a similar agreement was recorded using the gel electrophoresis and SYBR® Green I fluorescence dye. The LAMP assay was specific and no cross reactivity was recorded with non-target DNA, however the assay failed to amplify three T. vivax samples from Kenya.

4. Discussion LAMP technology represents an innovative strategy that has the potential to offer alternative detection method of pathogen DNA within a range of infectious diseases. The T. vivax satellite DNA based LAMP assay designed here is rapid and shows superior analytical sensitivity to classical PCR tests (Table 2). Moreover amplification is achieved within 35 min for T. vivax DNA concentration ranging from 10 ng to 1 pg (106 –1 trypanosomes/ml) using a real time PCR machine. This reaction time was recorded to increase to 45 min when a normal water bath is used for amplification. Although the use of a normal water bath is alternative

Table 2 The analysis of field samples from Kenya using T. vivax PCR and LAMP assay. Sample type

No of samples

Trypanosoma vivax isolates Tsetse fly (T. vivax positive)c Buffy coata (Trypanosome positive) Bovine samplesb

23 3 16 357

PCR tests DA-PCR

SA-PCR

SA-LAMP

7 (30.3%) – 3 6 (1.7%)

15 (65.2%) 3 7 19 (5.3%)

20 (90%) 3 8 27 (7.6%)

DA = diagnostic antigen gene; SA = satellite repeat DNA. a Samples were collected from Lambwe valley and were confirmed trypanosome positive by microscopy. b Samples collected from Nguruman valley and found to be microscopically positive for trypanosomes (Njiru et al., 2005). c Samples stored at KARI-TRC cryo-bank and confirmed positive for trypanosomes at the time of storage.

Z.K. Njiru et al. / Veterinary Parasitology 180 (2011) 358–362

to a thermal cycler, the need for power to heat water is still a drawback. As such, alternative sources of heat such as exothermal chemicals and battery operated units need to be considered. The recorded analytical sensitivity of 1 trypanosome/ml is a good detection level for T. vivax, noting its low parasitaemia in hosts. However, experience shows that these laboratory based sensitivities may not necessarily be reproducible under field conditions (Njiru et al., 2008). Thus, rigorous T. vivax LAMP field evaluations will be the next major step. The potential usefulness of T. vivax LAMP as a point of use test is demonstrated by the ability of the new assay to amplify target DNA from mixed infections and supernatant prepared from spiked bovine blood, meaning that DNA extraction may not be necessary. We recorded no inhibition of LAMP reaction or formation of non-specific product with the use of up to 3-␮l of supernatant per 25␮l. The possibility of using partially processed templates bypasses extraction, a contamination prone step, shortens the LAMP test and improves detection limit since less DNA is lost. Thus T. vivax LAMP assay reported in this work has a clear advantage over PCR in that the test is robust, simple and requires less instrumentation to make a diagnosis. Further work is required to define the supernatant preparation protocols and analyze various extraction and storage buffers that may help improve supernatant viability. It is crucial to ensure that T. vivax LAMP amplifies the correct product since the LAMP strategy does not offer the chance of confirming the end product unlike in PCR where DNA marker can be used to size the amplicon. In this work the resulting LAMP product was confirmed through restriction enzyme digestion with NdeI which gave the predicted two products of ∼80 bp and 140 bp sizes respectively. In addition, the acquisition and analysis of the melt curves (post LAMP amplification) not only showed reproducible melt curves but revealed consistent Tm of ∼90 ◦ C indicating similar sequence. A combination of these results and three negative controls per each test run increases our confidence in using the non-specific SYBR® Green I to progress the test for further analysis. However absolute detection of the correct LAMP product can be achieved through the use of probes that bind to specific sequence within the LAMP product followed by detection of the resulting probe-LAMP product complex through a simple lateral flow dipstick (LFD) format (Njiru, 2011). This method has downside in that it is expensive compared to non-specific dyes, however the need for absolute diagnosis and the advantages of using supernatant as template merits further research in converting LAMP/LFD into a single amplification and detection system, a device that our research group is working on. The diagnosis of T. vivax is the most challenging among the animal pathogenic trypanosomes. Therefore the development of LAMP test based on a target used to develop the most sensitive PCR test (Masiga et al., 1992) may potentially improve the field diagnosis of this parasite. This perception is supported by the recorded superior sensitivity of LAMP test over PCR tests in the analysis of T. vivax and bovine samples collected from the endemic area (Table 2). The T. vivax LAMP was specific and no cross reactivity was recorded with other trypanosomes, however it failed to detect three

361

samples that were microscopically positive at the time of preservation. Two ideas could be advanced for this observation: (i) that the pathogen DNA concentration in the template was below the LAMP detection level and/or (ii) the possibility that the three samples contained T. vivax that had different satellite repeat DNA sequence. Previous studies have identified isolates from East Africa (albeit few) that are not detected by satellite DNA based PCR test (Adams et al., 2010). It is worth noting that the overall percentage of these isolates is so low and only a handful of them exist in the laboratories. Studies to sequence the satellite DNA of the three isolates will be undertaken to reveal their sequence composition. An initial comprehensive analysis of the bovine field samples showed a trypanosome prevalence of 86/357 (24.1%) consisting of 71 single infections (27 Trypanozoon, 33 Nannomonas and 11 T. vivax) and 15 double infections (7 Tbr/Tcs, 4 Tbr/Tv and 4 Tcs/Tv) (Njiru et al., 2005). Analysis of the same samples with T. vivax LAMP not only confirmed the T. vivax positive samples but picked an extra eight (8) T. vivax infected animals that were previously negative with PCR. Since DNA degradation may have occurred over the years due to sample storage, the prevalence of this parasite could have even be higher than earlier reported. Such undiagnosed cases continue to act as a source of new infection in the field. Since mixed infection is a common occurrence in the field, research on development of a universal LAMP test for pathogenic trypanosomes need to be considered. 5. Conclusion It is a routine procedure for animal blood to be collected from the field and taken to the laboratory for analysis. Moreover, the animals that are treated during the field visits are those that are microscopically positive and/or those that show convincing clinical symptoms as per the opinion of the treating veterinary officer. Once the laboratory analysis are complete, it is not always possible to go back and treat the sick animals due to expenses involved and the migrating nature of the cattle owners. The LAMP technology described here shows potential for field diagnosis and may be a future viable alternative to laboratory diagnosis. However before T. vivax LAMP can be deployed under field conditions as a point of use test, a number of issues will need to be addressed, namely; (i) template preparation protocols, (ii) development of lyophilized reagents that are stable in the endemic areas, (iii) source of power for amplification and (iv) development of accurate visual detection formats. Until these objectives are realized, the T. vivax LAMP test will be a valuable tool in mid-tier laboratories where it may compliment PCR test. Acknowledgements This work was funded through the University of Queensland postgraduate grant to Zablon Njiru and the samples analyzed were contributed by Trypanosomiasis research Center, Kenya. The views expressed by the authors do not necessarily reflect the views of their respective institutes.

362

Z.K. Njiru et al. / Veterinary Parasitology 180 (2011) 358–362

References Adams, E.R., Hamilton, P.B., Rodrigues, A.C., Malele, I.I., Delespaux, V., Teixeira, M.M., Gibson, W., 2010. New Trypanosoma (Duttonella) vivax genotypes from tsetse flies in East Africa. Parasitology 137, 641–650. Assoku, R.K., Gardiner, P.R., 1989. Detection of antibodies to platelets and erythrocytes during infection with haemorrhage-causing Trypanosoma vivax in Ayrshire cattle. Vet. Parasitol. 31, 199– 216. Desquesnes, M., 1996. Evaluation of three antigen detection tests (monoclonal trapping ELISA) for African trypanosomes, with an isolate of Trypanosoma vivax from French Guyana. Ann. N.Y. Acad. Sci. 791, 172–184. Ferenc, S.A., Stopinski, V., Courtney, C.H., 1990. The development of an enzyme-linked immunosorbent assay for Trypanosoma vivax and its use in a sero-epidemiological survey of the Eastern Caribbean Basin. Int. J. Parasitol. 20, 51–56. Jones, T.W., Dávila, A.M., 2001. Trypanosoma vivax-out of Africa. Trends Parasitol. 17, 99–101. Kaneko, H., Kawana, T., Fukushima, E., Suzutani, T., 2007. Tolerance of loop-mediated isothermal amplification to a culture medium and biological substances. J. Biochem. Biophys. Methods 70, 499–501. Luckins, A.G., 1977. Detection of antibodies in trypanosome-infected cattle by means of a micro-plate enzyme-linked immunosorbent assay. Trop. Anim. Health Prod. 9, 53–62. Magona, J.W., Walubengo, J., Odimin, J.T., 2008. Acute haemorrhagic syndrome of bovine trypanosomosis in Uganda. Acta Trop. 107, 186–191. Masake, R.A., Majiwa, P.A., Moloo, S.K., Makau, J.M., Njuguna, J.T., Maina, M., Kabata, J., ole-MoiYoi, O.K., Nantulya, V.M., 1997. Sensitive and specific detection of Trypanosoma vivax using the polymerase chain reaction. Exp. Parasitol. 85, 193–205. Masiga, D.K., Smyth, A.J., Hayes, P., Bromidge, T.J., Gibson, W.C., 1992. Sensitive detection of trypanosomes in tsetse flies by DNA amplification. Int. J. Parasitol. 22, 909–918. Meléndez, R.D., Forlano, M., Figueroa, W., 1993. Perinatal infection with Trypanosoma vivax in a calf in Venezuela. J. Parasitol. 79, 293–294.

Morlais, I., Ravel, S., Grébaut, P., Dumas, V., Cuny, G., 2001. New molecular marker for Trypanosoma (Duttonella) vivax identification. Acta Trop. 80, 207–213. Nantulya, V.M., 1990. Trypanosomiasis in domestic animals: the problems of diagnosis. Rev. Sci. Tech. 9, 357–367. Nantulya, V.M., Lindqvist, K.J., Stevenson, P., Mwangi, E.K., 1992. Application of a monoclonal antibody-based antigen detection enzyme-linked immunosorbent assay (antigen ELISA) for field diagnosis of bovine trypanosomiasis at Nguruman, Kenya. Ann. Trop. Med. Parasitol. 86, 225–230. Njiru, Z.K., 2011. Rapid and sensitive detection of Human African Trypanosomiasis (HAT) by loop-mediated isothermal amplification combined with a lateral-flow dipstick. Diagn. Microbiol. Infect. Dis. 69, 205–209. Njiru, Z.K., Mikosza, A.S., Matovu, E., Enyaru, J.C., Ouma, J.O., Kibona, S.N., Thompson, R.C., Ndung’u, J.M., 2008. African trypanosomiasis: sensitive and rapid detection of the sub-genus Trypanozoon by loopmediated isothermal amplification (LAMP) of parasite DNA. Int. J. Parasitol. 38, 589–599. Njiru, Z.K., Constantine, C.C., Guya, S., Crowther, J., Kiragu, J.M., Thompson, R.C., Dávila, A.M., 2005. The use of ITS1 rDNA PCR in detecting pathogenic African trypanosomes. Parasitol. Res. 95, 186–192. Nagamine, K., Hase, T., Notomi, T., 2002. Accelerated reaction by loopmediated isothermal amplification using loop primers. Mol. Cell. Probes 16, 223–229. Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N., Hase, T., 2000. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28, E63. Osório, A.L., Madruga, C.R., Desquesnes, M., Soares, C.O., Ribeiro, L.R., Costa, S.C., 2008. Trypanosoma (Duttonella) vivax: its biology, epidemiology, pathogenesis, and introduction in the New World—a review. Mem. Inst. Oswaldo Cruz 103, 1–13. Platt, K.B., Adams, L.G., 1976. Evaluation of indirect fluorescent antibody test for detecting Trypanosoma vivax in South American cattle. Res. Vet. Sci. 21, 53–58. Stephen, L.E., 1986. Trypanosomiasis, A Veterinary Perspective. Pergamon Press, Oxford, UK. Wells, E.A., 1984. Animal trypanosomiasis in South America. Prev. Vet. Med. 2, 31–41.