Analysis of 50 SNPs in CYP2D6, CYP2C19, CYP2C9, CYP3A4 and CYP1A2 by MALDI-TOF mass spectrometry in Chinese Han population

Forensic Science International 207 (2011) 183–187

Contents lists available at ScienceDirect

Forensic Science International journal homepage: www.elsevier.com/locate/forsciint

Analysis of 50 SNPs in CYP2D6, CYP2C19, CYP2C9, CYP3A4 and CYP1A2 by MALDI-TOF mass spectrometry in Chinese Han population Yan Shi a,b, Ping Xiang b, Li Li b, Min Shen b,* a

Department of Forensic Science, Shanghai Medical College, Fudan University, Shanghai 200032, PR China Department of Forensic Toxicology, Institute of Forensic Sciences, Ministry of Justice, Shanghai Key Laboratory of Forensic Medicine, Guangfu Xi Road 1347, Shanghai 200063, PR China

b

A R T I C L E I N F O

A B S T R A C T

Article history: Received 21 April 2010 Received in revised form 14 September 2010 Accepted 2 October 2010 Available online 10 November 2010

One of the major challenges in the near future is the identification of genes that affect the metabolism of different drugs. Large scale association studies that utilise single nucleotide polymorphisms (SNPs) have been considered a valuable tool for this purpose. CYP2D6, CYP2C19, CYP2C9, CYP3A4 and CYP1A2 were found to be involved in the majority of hepatically cleared drugs. To determine the allele frequencies of some SNPs that may have great potential value in forensic science, we screened 50 SNPs in these 5 CYP genes in Chinese Han people using an accurate, high-throughput, cost-effective method. Primers were designed using the MassARRAY Assay Design software. Genomic DNA was prepared from blood samples obtained from individuals of Chinese Han origin. Multiplex PCR was performed to amplify the relevant gene fragments, and the polymorphisms were analysed by allele-specific primer extension followed by matrix-assisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS). A panel of genomic DNA samples previously genotyped by other methods were analysed simultaneously for quality control, and the results demonstrated that this assay was 100% accurate. A total of 17 of the analysed SNPs were polymorphic. Of these 17 SNPs, 8 (rs16947, rs28371725, rs1800754, rs4244285, rs4986893, rs12248560, rs3758580, rs2242480) had an allele frequency that was significantly different between this Chinese Han population and Caucasians (p < 0.01). In addition, the frequencies of two of these SNPs (rs1800754, rs3758581) in our Chinese Han population differed significantly from the existing Chinese frequency data (p < 0.01). The described method thus provides reliable results and enables the genotyping of up to thousands of samples by taking advantage of the high-throughput MALDI-TOF technology. The results herein are now included as a supplement to the P450 database. ß 2010 Elsevier Ireland Ltd. All rights reserved.

Keywords: SNP Multiple PCR MALDI-TOF MS Allele frequency

1. Introduction In forensic science, drug-related deaths can be difficult to interpret due to the inter-individual variability in the response to drugs. Some causes include environmental and physiological factors and drug–drug interactions. In most cases, however, the response is inherited as a result of polymorphisms in drugmetabolising enzymes (DMEs). Cytochrome P450 (CYP), one of the most important DMEs, has many genetic variations, leading to inter-individual differences in the response to drugs, which may result in adverse side effects [1,2]. The majority (78%) of hepatically cleared drugs are subject to oxidative metabolism via cytochrome P450 families 1, 2 and 3, with major contributions from CYP3A4/5 (37%) followed by CYP2C9 (17%), CYP2D6 (15%), CYP2C19 (10%), CYP1A2 (9%) [3]. An estimated 5–10% of the European population is homozygous for

* Corresponding author. Tel.: +86 021 52369419; fax: +86 021 52369419. E-mail address: [email protected] (M. Shen). 0379-0738/$ – see front matter ß 2010 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.forsciint.2010.10.004

a mutation in the CYP2D6 gene and therefore is considered to be ‘poor metabolisers (PM)’ (i.e., the protein product of this gene has little or no enzymatic activity) [4]. Approximately 2% of Caucasians and 15–20% of Orientals have a *0/*0 genotype in the CYP2C19 gene, which predicts a poor metaboliser (PM phenotype for CYP2C19 substrates [5]. One of the major challenges in the near future is the identification of genes and polymorphisms that affect drug metabolism. Large scale association studies that utilise single nucleotide polymorphisms (SNPs) have been considered to be a valuable tool for this purpose. SNPs have the potential to be an useful tool in forensic toxicology and medical practice because they can be used to genotype the CYP genes [6,7]. Recently, matrixassisted laser desorption/ionisation time-of-flight mass spectrometry (MALDI-TOF MS) has proven to be a superior technology for the detection of SNPs. This method has several advantages over other methods: high accuracy due to the direct measurement of molecular masses, high sensitivity for the detection of both homozygous and heterozygous base changes, high-throughput of samples and cost-effective multiplex capability [8–10].

Y. Shi et al. / Forensic Science International 207 (2011) 183–187

184

Some research has been focused on the relationship between SNPs in the CYP genes and drug metabolism, with an emphasis on CYP2D6 and CYP2C19 [11–14]. In the Chinese population, however, there is still a lack of basic data with respect to the CYP genes, especially for the Han population, which is the largest ethnic group in China. To investigate the CYP allele frequencies in the Chinese Han population, we genotyped 50 SNPs in the CYP2D6, CYP2C19, CYP2C9, CYP3A4 and CYP1A2 genes using a combination of multiplex amplification and MALDI-TOF MS. This study is the first to systematically screen the Chinese Han population for CYP gene polymorphisms.

a single-base extension primer (Table 1). In addition, a tag (50 -ACGTTGGATG) was included in the primer sequence to equalise extreme relative percentage-GC contents [15]. The primers were synthesised by the Shanghai Biological Engineering Technology Corporation. 2.2. DNA extraction To determine the allele frequencies of these 50 SNPs, blood samples were collected from 200 unrelated Chinese Han individuals. DNA was extracted from 0.5 mL of blood using the blood genomic DNA Mini Kit (Sangon Biotech Shanghai Co. Ltd.) following the manufacturer’s protocol, and the final elution volume was 30 mL. The extracted DNA was quantified using UV spectrophotometry, and the concentrations were in the range of 2030 ng/mL. 2.3. Multiplex PCR

2. Materials and methods 2.1. Selection of SNPs and primer design A total of 50 SNPs from 5 CYP genes were selected using the P450 database (http://www.cypalleles.ki.se/index.htm) as a reference. Based on the specific RS number of each SNP locus, 50 groups of primers with a perfect match were designed using the MassARRAY Assay Design software (Sequenom Inc.). To avoid crosshybridisation, no short tandem repeats were included within the hybridisation sequence. There are three primers for each SNP, including a pair of PCR primers and

The primers for the 50 SNPs were divided into 3 multiplex reactions, with one for 18 SNPs and two each for 16 SNPs. PCRs were performed in a total volume of 5 mL, which contained 1 mL DNA, 0.1 mL HotStarTaq polymerase (5 U/mL), 0.325 mL MgCl2 (25 mmol/L), 0.625 mL PCR buffer (10) (Qiagen GmbH), 1 mL dNTPs (2.5 mmol/L) (Tatara Inc.), 0.95 mL H2O and 1 mL of the designed primers at their optimised concentrations. The PCR conditions were the following: 94 8C for 15 min, followed by 45 cycles of 94 8C for 20 s, 56 8C for 30 s, and 72 8C for 1 min and a final step of 72 8C for 3 min. The samples were kept at 4 8C until further analysis.

Table 1 50 groups of primes used for SNP genotyping. SNP_ID

Forward primer (50 ! 30 ) for PCR

Reverse primer (50 ! 30 ) for PCR

Primer for extension reactions

rs5030867 rs28371685 rs55785340 rs58259047 rs9332131 rs28399510 rs28399504 rs28399505 rs28371725 rs4986893 rs41291556 rs16947 rs28371687 rs1041988 rs1057909 rs4986913 rs17861157 rs28371706 rs28399424 rs2256871 rs10250778 rs4986909 rs17878459 rs12248560 rs3758581 rs55752064 rs12721634 rs28399418 rs28371696 rs9332239 rs3208363 rs9325473 rs1800754 rs3758580 rs55640102 rs6413438 rs9332130 rs17861152 rs55901263 rs28371759 rs2740574 rs45486893 rs35796837 rs28371686 rs4244285 rs2242480 rs56324128 rs3091339 rs4646438 rs55961658

ACGTTGGATGCCTGCACTGTTTCCCAGATG ACGTTGGATGATCTGTGTAGGGCATGTGGC ACGTTGGATGGGAAATAGTAGTCCACATAC ACGTTGGATGTGGTAATCACTGCAGCTGAC ACGTTGGATGCCTCAGGACTTTATTGATTGC ACGTTGGATGATCACATTGCAGGGAGCACA ACGTTGGATGGAGAAGCAAACATGAGAGAC ACGTTGGATGCTCAAAAATCTATGGCCCTG ACGTTGGATGGAGCCCATCTGGGAAACAGT ACGTTGGATGGACTGTAAGTGGTTTCTCAG ACGTTGGATGATGAGGGAGAAACGCCGGAT ACGTTGGATGTCACCATCCCGGCAGAGAA ACGTTGGATGCCAGAGATGTTTGACCCTCA ACGTTGGATGTTCTGGGTCCACTTCCAAAG ACGTTGGATGGCAGGCTGGTGGGGAGAAG ACGTTGGATGAGAAAATTGACTAACCTGTG ACGTTGGATGTGACAATCTTCTCCTGTGGG ACGTTGGATGGCTGCTTGCCTTGGGAACG ACGTTGGATGTGTTAATGGCAGTGCCATCG ACGTTGGATGTCCTGAGGGTTGTTCATGTC ACGTTGGATGCCACCATGTCAAGATACTCC ACGTTGGATGAGGGAGGGCTCCCTTCCCA ACGTTGGATGTGAAGTGGTGAAGGAAGCCC ACGTTGGATGTGAGCTGAGGTCTTCTGATG ACGTTGGATGGTCAGCTAAAGTCCAGGAAG ACGTTGGATGTTCCTCTCCCAGAGCTCTGT ACGTTGGATGACTCACAGATAGAGGAGCAC ACGTTGGATGCATCCCACAGGAGAAGATTG ACGTTGGATGCAGTGGCAGGGGGCCTGGT ACGTTGGATGTTTGCCTCTGTGCCGCCCTT ACGTTGGATGGTATCTTCGAGGCGACTTTC ACGTTGGATGCAGTGTCCCTTAAATCCTCC ACGTTGGATGTAGGATCATGAGCAGGAGGC ACGTTGGATGATGTGGCCCCTGTCCTGCAT ACGTTGGATGAATGGATTTGCTTCTGTCCC ACGTTGGATGCACTTTCCATAAAAGCAAGG ACGTTGGATGCAAGCAGTCACATAACTAAG ACGTTGGATGTTGAGCACCCAGAATACCAG ACGTTGGATGGGAAATAGTAGTCCACATAC ACGTTGGATGCCTAAAATGTCTTTCCTCTCC ACGTTGGATGGAAACTCAAGTGGAGCCATT ACGTTGGATGCTTCTCACTCAAGGGCTTGT ACGTTGGATGATCACGGGTGCCCTGTTCAA ACGTTGGATGACAGATGCTGTGGTGCACGA ACGTTGGATGGCAATAATTTTCCCACTATC ACGTTGGATGTAAGGTTTCACCTCCTCCCT ACGTTGGATGCAAATATTATTTTGTTTCTCC ACGTTGGATGTTACCCTCCGGTTTGTGAAG ACGTTGGATGCACCGAGTGGATTTCCTTCA ACGTTGGATGTGCCTTGGATTATCTTAGAG

ACGTTGGATGCCTGGGGCCTCCTGCTCAT ACGTTGGATGCCAGGAAGAGATTGAACGTG ACGTTGGATGGTGGAAAACACCAAGAAGC ACGTTGGATGGAAGGAGAGCATATCTCAGG ACGTTGGATGCAAGCAGTCACATAACTAAG ACGTTGGATGTTTTAAAATTGTTTCCAATC ACGTTGGATGCACGGTTGTCTTAACAAGAG ACGTTGGATGTCACCACTTCATATCCATGC ACGTTGGATGTCCCAGCAAAGTTCATGGGC ACGTTGGATGAACATCAGGATTGTAAGCAC ACGTTGGATGTCTCTTCCTGTTAGGAATCG ACGTTGGATGCCCTGAGAGCAGCTTCAATG ACGTTGGATGCTGCTGAGAAAGGCATGAAG ACGTTGGATGGTGGAACCAGATTCAGCAAG ACGTTGGATGCCACATGCCCTACACAGATG ACGTTGGATGTGCTCTAATCAGAGTCCTTC ACGTTGGATGATCACGGGTGCCCTGTTCAA ACGTTGGATGGCCGACCGCCCGCCTGTG ACGTTGGATGCTCTTGCAGAGAGCTGTGG ACGTTGGATGCGTTGCTTTTATGAAAAGT ACGTTGGATGGTTTCGTTCTTTCCAGGCAC ACGTTGGATGCGTGACCCAAAGTACTGGAC ACGTTGGATGTAGCTCTTTCAGCCAGTGGG ACGTTGGATGCAAATTTGTGTCTTCTGTTC ACGTTGGATGATGTGGCCCCTGTCCTGCAT ACGTTGGATGGGATCCTTTTGTGGTCCTTG ACGTTGGATGTGATGGCTCTCATCCCAGAC ACGTTGGATGAAGGTTCTGGTTCCTACCTG ACGTTGGATGATCTTCCTGCTCCTGGTGG ACGTTGGATGCAGGCCATCTGCTCTTCTTC ACGTTGGATGCTGTGTGTTTCCAAGAGAAG ACGTTGGATGTTTCAGCCTCATTCTCCACC ACGTTGGATGTAGTGGTGGGTAACCTGTTC ACGTTGGATGGTCAGCTAAAGTCCAGGAAG ACGTTGGATGGAGCAGCCAGACCATCTGT ACGTTGGATGGCAATAATTTTCCCACTATC ACGTTGGATGCCTCAGGACTTTATTGATTGC ACGTTGGATGTGTCCCAGTCTGTTCCCTTC ACGTTGGATGGTGGAAAACACCAAGAAGC ACGTTGGATGAGATAATTGATTGGGCCACG ACGTTGGATGGAATGAGGACAGCCATAGAG ACGTTGGATGGGAGGACCCCTCTGAGTTC ACGTTGGATGTGACAATCTTCTCCTGTGGG ACGTTGGATGTGTCACAGGTCACTGCATGG ACGTTGGATGCACTTTCCATAAAAGCAAGG ACGTTGGATGGCAGGAGGAAATTGATGCAG ACGTTGGATGACCCCCACACTTTTCCATAC ACGTTGGATGTGGCTATCACAGATCCTGAC ACGTTGGATGTCTGGTTACCTTTGTGGGAC ACGTTGGATGATGGTAGAATTGCTCTGGCG

CTCCTGCTCATGATCCTAC TTGTGTGATTGGCAGAAAC TTTTTGGATCCATTCTTTCTC AGCATATCTCAGGGTTGTGCTT CCGCTTTTGTTTACATTTTACCT TTAGCTTCACCCTGTGATCCCACT TCTTAACAAGAGGAGAAGGCTTCA CCACTTCATATCCATGCAGCACCACC CCCCCGCCTGTACCCTT ATTGTAAGCACCCCCTG GTCAGCAATGGAAAGAGA CTTCAATGATGAGAACCTG TAAAATTGCCACCTTCATCC GGACAACATAGATCCTTACA TGGTGCACGAGGTCCAGAGAT CCTTCAGAACTTCTCCTTCAAA TCCCTAAGGGGCCTAGAGCCAG CCCCTCGCCCGCCTGTGCCCATCA GACCCCTCTGAGTTCCGGCCTGAG TTATATTTTGGAAAAAGTAAAAGAAC ACCACCCACCTATGATA GCCTGAGAAGTTCCTCC GGCCTCTTCCAGAAAACTC TGTGTCTTCTGTTCTCAAAG GGGGCTCCGGTTTCTGCCAA GTCTCTCATGTTTGCTTCTCC GCCATGGAAACCTGGCTTCTCC CCCCATTCCTACCTGCTCCAAAGA TCCTGGTGGACCTGATGCACCGGC CAGGCCATCTGCTCTTCTTCAGACAG GAGAAGTTACAAATTTTTTAAGAAAA TCCACCATCTTTGACCCT CCGGGATGGTGACCACCT GGAAGAGATTGAACGTGT CCAGACCATCTGTGCTTCT CCCACTATCATTGATTATTTCC GGTTGCTTCCTGATGAAAATGG CGGCCACAGAGCTTCTCCTGGCCT CTTTTAAGATTTGATTTTTTGGATC AGATAATTGATTGGGCCACGAGCTCC CCATAGAGACAAGGGCA TTCCTCACCGCCGATGGCA TACTGTGGGATGAGGTTGC GGCAGGCTGGTGGGGAGAAG AAGTAATTTGTTATGGGTTCC GGAACCAATAAGGTGAGTGGATG CAGGCCATGTCAAACATACAAAAG GACAGGATCAAAACAGTGCTAGTG TTTCTTTTGAATTCTGAGAGT GCGCTGGCGTGGATGAAAAAA

[()TD$FIG]

Y. Shi et al. / Forensic Science International 207 (2011) 183–187

185

2.4. SAP dephosphorylation After the PCRs were performed, the products of three reactions were treated with shrimp alkaline phosphatase (SAP) to remove excess dNTPs. This reaction contained 0.3 mL SAP (1 U/mL), 0.17 mL SAP buffer (10), and 1.53 mL H2O (all from Sequenom Inc.). The reaction conditions were 37 8C for 40 min, followed by 85 8C for 15 min, and the samples were kept at 4 8C until further analysis. 2.5. Primer extension reactions The PCR products were then used as templates for the primer extension reactions using the iPlex1 Gold reagent kit (Sequenom Inc.). The extension reactions were performed in a final volume of 9 mL, which contained 0.2 mL iPlex buffer (10), 0.1 mL iPlex termination mix, 0.0205 mL iPlex enzyme, 0.7395 mL H2O, and 0.94 mL of the extension primers at their optimised concentrations. The extension reaction conditions were at the following: 94 8C for 30 s, followed by 40 cycles of 94 8C for 5 s, followed by 5 cycles of 52 8C for 5 s and 80 8C for 5 s and a final step of 72 8C for 3 min. The final nucleotide extension products were treated with a cationic exchange resin (AG1 50W-X8 Resin; Bio-Rad Laboratories Inc.) for 30 min to remove salts. All reactions, including the PCR amplification, the shrimp alkaline phosphatase treatment, and primer extension, were performed in 384-well microtitre plates (Sequenom Inc.). The PCR amplification and primer extension reaction were performed on a GeneAmp PCR System 9700 (Applied Biosystems, Norwalk, CT), and no-template controls were included in every plate to confirm that there was no contamination.

Fig. 1. Mass spectrum of the 18-plex PCR extension products (1, Negative control; 2, rs28371725 A/G; 3, rs28371686 C/C; 4, rs1041988 T/T; 5, rs28399504 A/A; 6, rs28399505 T/T; 7, rs28399510 T/T; 8, rs5030867 A/A; 9, rs55785340 A/A; 10, rs55961658 G/G; 10, rs58259047 C/C; 11, rs55901623 G/G; 12, rs16947 G/G; 13, rs28371746 C/A; 14, rs18007054 T/T; 15, rs3758581 G/G; 16, rs28399424 C/C; 17, rs28399418 A/A; 18, rs2242480 C/T; 19, rs9332130 A/A).

2.6. MALDI-TOF MS The products were spotted onto the MassARRAY SpectroCHIP with an auto-spot arm (Sequenom Inc.) and air-dried. The target plate was then inserted into the MALDI-TOF mass spectrometer of the MassARRAY Compact System (Sequenom Inc.), and the analysis was performed using 1800 nitrogen laser shots for each sample. The mass range of the MS instrument was set at 3920–12,023 Da. 2.7. Statistical analysis The data were analysed with the SPSS 13.0 software program to obtain basic statistical information including allele frequency and p values (for comparison with the data from Caucasian databases).

3.3. Comparison of Chinese allele frequency with existing data The allele frequencies of the 50 SNPs were then compared with the observed frequencies given in the P450 database using a chisquare test [15]. Of these 17 SNPs, 8 SNPs had an allele frequency that was significantly different between this Chinese Han population and Caucasians (p < 0.01) (Table 3). In addition, the frequency of two of these SNPs (rs1800754, C/T; rs3758581, A/G) in our Chinese Han population was significantly different from the existing Chinese frequency data (p < 0.01).

3. Results 4. Discussion 3.1. Evaluation of the MALDI-TOF MS genotyping assay To evaluate the CYP genotyping assay designed for this study, the genomic DNA from 100 controls was analysed using this method. These samples were from individuals of Chinese origin who had been previously genotyped for some of the SNPs used in this study by other methods, such as TaqMan assay and direct sequence analysis. After genotyping, the results from the MALDITOF MS assay were compared with those from the other methods, revealing an accuracy of 100%. The relative intensities of the mass signals representing to the 18-plex PCR extension products of one DNA sample are shown in Fig. 1, and the corresponding alleles detected by the TaqMan assay are rs28399505 T/T, rs28399510 T/ T, rs28399418 A/A, rs28371686 C/C, rs28399504 A/A, rs28399424 C/C, rs9332130 A/A, rs1041988 T/T, rs5030867 A/A, rs55785340 A/ A, rs55961658 G/G, rs58259047 C/C, rs55901623 G/G, rs16947 G/ G, rs28371746 C/A, rs28371725 A/G, rs18007054 T/T, rs3758581 G/G, and rs2242480 C/T. 3.2. Allele frequency Of the 50 SNPs in the CYP2D6, CYP2C19, CYP2C9, CYP3A4 and CYP1A2 genes, only 17 had a minor allele frequency [MAF] above 1%) in this study population. The other 33 SNPs had a MAF of 0.00% and were homozygous in our population. The observed allele frequencies for this Chinese Han population and the known allele frequencies for Chinese (Asian) and Caucasian populations are presented in Table 2 [16]. The data set obtained for this Chinese Han population will be added to the P450 database.

The rate of drug metabolism can differ in individuals from different ethnic or regional backgrounds [17]. There are 56 officially recognised ethnic populations in China. Among them, the Hans constitute the vast majority and are dispersed nearly all over the country. A systematic study of Y chromosome and mtDNA diversity in the Han population revealed that the Hans had a relatively consistent genetic homogeneity [18]. The majority of existing databases focused on the relationship between disease and SNPs lack a broad distribution of information on the frequency of SNP alleles in the Chinese population. For this study, we selected 50 SNPs from the P450 SNP database. Currently employed methods for SNP genotyping include discrimination-by-hybridisation, restriction fragment length polymorphism analysis (RFLP), chemical mismatch detection, denaturing high performance liquid chromatography (DHPLC), TaqMan 50 nuclease-based allelic discrimination, real-time fluorescence PCR, DNA sequence analysis and DNA chip [19–21]. Although most of these available methods provide accurate and reproducible estimations of allele frequencies, high-throughput and costeffective methods should be taken into account for the genotyping of 50 SNP markers in a relatively large group. Both the TaqMan and sequence analyses are relatively expensive and also low-throughput. Although DNA chip is suitable for large-scale screens, it has low multiplexing capabilities, and its genotype assignments are less accurate and reproducible than those of other methods [22]. Therefore, we utilised a method based on multiplex PCR and MALDI-TOF MS, which has the following advantages over other methods: high accuracy, high sensitivity, high-throughput, low cost and convenience.

Y. Shi et al. / Forensic Science International 207 (2011) 183–187

186

Table 2 Allele frequencies for Chinese Han population and Caucasian (N = 200). CYP

Reference dbSNP

Allele

Allele frequencies of Chinese

Known allele frequencies of Chinese

Known allele frequencies of Caucasian

2D6

rs16947 rs28371706 rs28371725 rs1800754 rs5030867 rs28371696 rs3758581 rs4244285 rs4986893 rs28399504 rs12248560 rs3758580 rs41291556 rs6413438 rs55640102 rs58259047 rs28399510 rs28399505 rs55752064 rs17878459 rs9325473 rs28371686 rs9332131 rs2256871 rs9332130 rs28371685 rs9332239 rs1057909 rs28371687 rs2740574 rs2242480 rs28371759 rs4646438 rs16721634 rs4986909 rs56324128 rs3091339 rs55961658 rs3208363 rs10250778 rs4986913 rs1041988 rs55901263 rs55785340 rs35796837 rs28399424 rs28399418 rs17861152 rs17861157 rs45486893

A/G C/T A/G C/T A/C G/A A/G A/G A/G A/G C/T C/T T/C C/T A/C C/G T/C T/C T/C G/C A/G C/G A/– T/C A/G C/T C/T A/G T/C A/G C/T C/T –/A T/C C/T C/T A/G G/T T/G G/T C/T T/C G/C A/T A/G C/T A/G C/G C/A C/T

0.141/0.859 0.990/0.010 0.025/0.975 0.351/0.649 1.000/0.000 1.000/0.000 0.011/0.989 0.329/0.671 0.080/0.920 0.995/0.005 0.993/0.007 0.672/0.328 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 0.040/0.960 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 0.997/0.003 0.739/0.261 0.008/0.992 0.990/0.010 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 0.801/0.199 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 0.005/0.995 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000

0.169/0.831 1.000/0.000 0.022/0.978 0.200/0.800 – – 0.067/0.933 0.216/0.784 0.033/0.967 0.994/0.006 1.000/0.000 0.711/0.289 0.995/0.005 1.000/0.000 – – – – – 1.000/0.000 0.047/0.953 – – 1.000/0.000 0.991/0.009 1.000/0.000 1.000/0.000 1.000/0.000 – 1.000/0.000 0.792/0.208 – – – 1.000/0.000 – 1.000/0.000 – 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 0.994/0.006 – – – – 1.000/0.000 1.000/0.000 0.972/0.028

0.403/0.597 0.984/0.016 0.097/0.903 0.490/0.510 1.000/0.000 – 0.051/0.949 0.153/0.847 0.000/1.000 1.000/0.000 0.875/0.125 0.919/0.081 1.000/0.000 1.000/0.000 1.000/0.000 – – – 1.000/0.000 0.984/0.016 0.058/0.942 – 0.994/0.006 1.000/0.000 0.994/0.006 1.000/0.000 0.992/0.008 1.000/0.000 – 0.972/0.028 0.932/0.068 – – – 1.000/0.000 – 1.000/0.000 – 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 1.000/0.000 – 0.000/1.000 – – 1.000/0.000 1.000/0.000 1.000/0.000

2C19

2C9

3A4

1A2

–, no available frequency.

This population study provided basic data on the allele frequencies of 50 SNPs in the Chinese Han population, which has been added as a supplement to the P450 database. Of the 50 SNPs in the CYP2D6, CYP2C19, CYP2C9, CYP3A4 and CYP1A2 genes that were analysed, 17 were found to be polymorphic. In addition, Table 3 Frequency distribution between Chinese Han population and Caucasian population.

rs16947 (A/G) rs28371725 (A/G) rs1800754 (C/T) rs4244285 (A/G) rs4986893 (A/G) rs12248560 (C/T) rs3758580 (C/T) rs2242480 (C/T)

Frequencies of Chinese

Frequencies of Caucasian

x2

p

0.141/0.859 0.025/0.975 0.351/0.649 0.329/0.671 0.080/0.920 0.993/0.007 0.672/0.328 0.739/0.261

0.403/0.597 0.097/0.903 0.490/0.510 0.153/0.847 0.000/1.000 0.875/0.125 0.919/0.081 0.932/0.068

34.67 9.05 7.93 16.93 16.67 22.59 37.5 27.1

<0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01 <0.01

there was a significant difference in the frequency distribution of 8 SNPs in the Chinese Han people when compared with Caucasians (Table 3). These data suggest that different ethnic groups might inherit specific genetic information that could lead to different drug metabolism rates. Based on the activity level of the CYP enzyme, individuals can be grouped into four different phenotypes: poor metabolisers (PM), intermediate metabolisers (IM), extensive metabolisers (EM) and ultra-rapid metabolisers (UM) [23]. IM and EM individuals have a normal metabolic phenotype. The PM alleles with the highest frequencies among Caucasians are CYP2D6*2, *3, *5 and *6, in descending order of prevalence, and these four alleles can predict 93–98% of the PM phenotypes in Caucasians. Approximately 7–10% of Caucasians lacks CYP2D6 and is also classified as PMs. In intoxication cases, the frequency of the homozygous CYP2D6*2/*2 genotype is 0.126 [24]. Other studies also shown that some drugrelated deaths can be explained by the presence of the CYP2D6*2 haplotype [4,5,25]. In this study, the frequency of CYP2D6*2

Y. Shi et al. / Forensic Science International 207 (2011) 183–187

(rs16947A ! G and rs28371725A ! G) in Chinese Han individuals was significantly different than that seen in Caucasians, which may result in a different metabolic phenotype. These results also suggest that the rs16947 and rs28371725 SNPs are potential markers that should be studied further. In Caucasians, three haplotypes, *2, *3, and *4, account for 90% of the CYP2C19 PM alleles. Three to five percent of Caucasians lack this enzyme and are thus classified as PMs. Although there are no reports of CYP2C19 gene duplications, a specific polymorphism in the 50 -flanking region, CYP2C19*17, is associated with an increase in enzyme activity due to an increase in gene transcription [5,26]. Our results suggested that CYP2C19*2 (rs3758581A ! G, rs4244285 G ! A, rs3758580C ! T) and *3 (rs4986893G ! A, rs3758581A ! G) were polymorphic in our Chinese Han population, while CYP2C19*17 (rs12248560 C ! T) and *4 (rs28399504 A ! G) were not. Among the SNPs included in these haplotypes, the allele frequency distribution of rs4244285, rs4986893, and rs12248560 is significantly different in Chinese Han individuals when compared with Caucasians. Both CYP2C9*2 and CYP2C9*3 are considered to be important alleles of the CYP2C9 gene because they result in impaired enzymatic activity and therefore predispose individuals to enzyme sensitivity. In Caucasians, the prevalence of the aforementioned SNPs was estimated to be 8–20% and 6–11%, respectively [27,28]. These two deleterious alleles, however, were not present in our Chinese Han population. There is not much data on genetic polymorphisms in the CYP1A2 and CYP3A4 genes to associate with metabolic phenotypes. Our results may supplement the information on CYP1A2 and CYP3A4 in the P450 database. The frequency distribution of rs1800754 and rs3758581 in our Chinese Han population differed significantly from the existing Chinese frequency data (p < 0.01). There are multiple potential explanations for this disparity, including regional differences, gender, living background, and sample size. A larger sample size will be required to obtain a more accurate estimation of the allele frequencies for these two SNPs in the Chinese Han population. 5. Conclusion This is the first study that systematically screened polymorphisms in the CYP genes in a Chinese Han population using a highthroughput and cost-effective method based on multiplex PCR and MALDI-TOF MS. The results indicated that 8 out of 50 loci showed significantly different allele frequencies between the Chinese Han and Caucasian populations, while the remaining 33 had similar allele frequencies in both populations. Therefore, our data provides important information on polymorphisms within the CYP2D6, CYP2C19, CYP2C9, CYP3A4 and CYP1A2 genes in the Chinese Han population, which has been added as a supplement to the P450 database. In the future, these results could be used in forensic science to interpret drug-related deaths and to help develop personalised medicine studies in the general Chinese population. Acknowledgements This work was supported by grants from the National Natural Science Foundation and the National Institute Scientific Program (Nos. 20975070 and GY0903, respectively).

187

References [1] U.A. Meyer, U.M. Zanger, Molecular mechanisms of genetic polymorphisms of drug metabolism, Annu. Rev. Pharmacol. Toxicol. 37 (1997) 269–296. [2] M. Ingelman-Sundberg, M. Oscarson, R.A. McLellan, Polymorphic human cytochrome P450 enzymes: an opportunity for individualized drug treatment, Trends Pharmacol. Sci. 20 (8) (1999) 342–349. [3] U.M. Zanger, M. Turpeinen, K. Klein, et al., Functional pharmacogenetics/genomics of human cytochromes P450 involved in drug biotransformation, Anal. Bioanal. Chem. 392 (2008) 1093–1108. [4] A. Levo, A. Koski, I. Ojanpera, et al., Post-mortem SNP analysis of CYP2D6 gene reveals correlation between genotype and opioid drug (tramadol) metabolite ratios in blood, Forensic Sci. Int. 135 (2003) 9–15. [5] A. Koski, J. Sistonen, I. Ojanpera, et al., CYP2D6 and CYP2C19 genotypes and amitriptyline metabolite ratios in a series of medicolegal autopsies, Forensic Sci. Int. 158 (2006) 177–183. [6] M. Krawczak, Informativity assessment for biallelic single nucleotide polymorphisms, Electrophoresis 20 (1999) 1676–1681. [7] L. Li, C.T. Li, R.Y. Li, et al., SNP genotyping by multiplex amplification and microarrays assay for forensic application, Forensic Sci. Int. 162 (2006) 74–79. [8] W. Pusch, J.H. Wurmbach, H. Thiele, et al., MALDI-TOF mass spectrometry-based SNP genotyping, Pharmacogenomics 3 (2002) 537–548. [9] J. Tost, I.G. Gut, Genotyping single nucleotide polymorphisms by MALDI mass spectrometry in clinical applications, Clin. Biochem. 38 (2005) 335–350. [10] J.K. Blievernicht, E. Schaeffeler, K. Klein, et al., MALDI-TOF Mass spectrometry for multiplex genotyping of CYP2B6 single-nucleotide polymorphisms, Clin. Chem. 53 (1) (2007) 24–33. [11] C. Sachse, J. Brockmo¨ller, S. Bauer, et al., Cytochrome P450 2D6 variants in a Caucasian population: allele frequencies and phenotypic consequences, Am. J. Hum. Genet. 60 (2) (1997) 284–295. [12] R. Løvlie, A.K. Daly, A. Molven, et al., Ultrarapid metabolizers of debrisoquine: characterization and PCR-based detection of alleles with duplication of the CYP2D6 gene, FEBS Lett. 392 (1) (1996) 30–34. [13] V.M. Steen, O.A. Anreassen, A.K. Daly, et al., Detection of the poor metabolizerassociated CYP2D6(D) gene deletion allele by long-PCR technology, Pharmacogenetics 5 (4) (1995) 215–223. [14] L. Chen, S. Qin, J. Xie, et al., Genetic polymorphism analysis of CYP 2C19 in Chinese Han population from different geographic areas of mainland China, Pharmacogenomics 9 (6) (2008) 691–702. [15] N. Ghebranious, L. Ivacic, J. Mallum, et al., Detection of ApoE E2, E3 and E4 alleles using MALDI-TOF mass spectrometry and the homogeneous mass-extend technology, Nucleic Acids Res. 33 (2005) 149. [16] http://www.ncbi.nlm.nih.gov/. [17] J.F. Wilson, M.E. Weale, A.C. Smith, et al., Population genetic structure of variable drug response, Nat. Genet. 29 (2001) 265–269. [18] B. Wen, H. Li, D. Lu, et al., Genetic evidence supports demic diffusion of Han culture, Nature 431 (2004) 302–305. [19] P.M. Vallone, A.E. Decker, J.M. Butler, Allele frequencies for 70 autosomal SNP loci with U.S. Caucasian, African-American, and Hispanic samples, Forensic Sci. Int. 149 (2005) 279–286. [20] R.B. Wallace, J. Shaffer, R.F. Murphy, J. Bonner, T. Hirose, K. Itakura, Hybridization of synthetic oligodeoxyribonucleotides to phi 174 DNA: the effect of single base pair mismatch, Nucleic Acids Res. 6 (1979) 3543–3557. [21] S. Inagaki, Y. Yamamoto, Y. Doi, T. Takata, T. Ishikawa, K. Imabayashi, K. Yoshitome, S. Miyaishi, H. Ishizu, A new 39-plex analysis method for SNPs including 15 blood group loci, Forensic Sci. Int. 144 (2004) 45–57. [22] J.A. Isler, O.E. Vesterqvist, M.E. Burczynski, Analytical validation of genotyping assays in the biomarker laboratory, Pharmacogenomics 8 (4) (2007) 353–368. [23] R. Weinshiboum, Inheritance and drug response, N. Engl. J. Med. 348 (6) (2003) 529–537. [24] A.L. Zackrisson, B. Lindblom, J. Ahlner, High frequency of occurrence of CYP2D6 gene duplication/multiduplication indicating ultrarapid metabolism among suicide cases, Clin. Pharmacol. Ther. (Nov 11) (2009), doi:10.1038/clpt.2009.216 (Epub ahead of print). [25] A. Matsusue, K. Hara, M. Kageura, et al., An autopsy case of rhabdomyolysis related to vegetamin and genetic analysis of the rhabdomyolysis-associated genes, J. Forensic Legal Med. 17 (2010) 46–49. [26] S.C. Sim, C. Risinger, M.L. Aahl, et al., A common novel CYP2C19 gene variant causes ultrarapid drug metabolism relevant for the drug response to proton pump inhibitors and antidepressants, Clin. Pharmacol. Ther. 79 (2006) 103– 113. [27] A.H. Wu, P. Wang, A. Smith, et al., Dosing algorithm for warfarin using CYP2C9 and VKORC1 genotyping from a multi-ethnic population: comparison with other equations, Pharmacogenomics 9 (2008) 169–178. [28] A. Gialeraki, C. Markatos, E. Grouzi, et al., Evaluation of a reverse-hybridization StripAssay for the detection of genetic polymorphisms leading to acenocoumarol sensitivity, Mol. Biol. Rep. 37 (2010) 1693–1697.