Influences of cytochrome b5 expression and its genetic variant on the activity of CYP2C9, CYP2C19 and CYP3A4

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54

DMPK259_proof ■ 5 April 2019 ■ 1/8

Drug Metabolism and Pharmacokinetics xxx (xxxx) xxx

Contents lists available at ScienceDirect

Drug Metabolism and Pharmacokinetics journal homepage: http://www.journals.elsevier.com/drug-metabolism-andpharmacokinetics

Regular Article

Influences of cytochrome b5 expression and its genetic variant on the activity of CYP2C9, CYP2C19 and CYP3A4 Q5

Sung-Eun Yoo a, MyeongJin Yi a, Woo-Young Kim a, Sun-Ah Cho a, Sang Seop Lee a, Su-Jun Lee a, *, Jae-Gook Shin a, b, ** a b

Department of Pharmacology and PharmacoGenomics Research Center, Inje University College of Medicine, Busan, Republic of Korea Department of Clinical Pharmacology, Inje University Busan Paik Hospital, Busan, Republic of Korea

a r t i c l e i n f o

a b s t r a c t

Article history: Received 17 April 2018 Received in revised form 15 March 2019 Accepted 27 March 2019 Available online xxx

The objective of the present study was to investigate the effects of cytochrome b5 (cytb5) on the drug metabolism catalyzed by CYP2C9, CYP2C19 and CYP3A4. Activities of CYP2C9, CYP2C19, and CYP3A4 were determined by using the prototypical substrates tolbutamide, omeprazole and midazolam, respectively. Cytb5 protein and mRNA contents showed large inter-individual variations with 11- and 6fold range, respectively. All of three P450s showed an increased activity in proportion to the amount of cytb5 expression. Particularly, CYP3A4 showed the strongest correlation between cytb5 protein amount and the activity, followed by CYP2C9 and CYP2C19. The putative splicing variant, c.288G>A (rs7238987) was identified and was screened in 36 liver tissues by direct DNA sequencing. Liver tissues having a splicing variant exhibited unexpected sizes of cytb5 mRNA and a decreased expression tendency of cytb5 protein compared to the wild-type. A decreased activity in the metabolism of the CYP2C19 substrate omeprazole was observed in liver tissues carrying the splicing variant when compared to the wild-type Cytb5 (P < 0.05). The present results propose that different expression of cytb5 can cause variations in CYP mediated drug metabolism, which may explain, at least in part, the inter-individual difference in drug responses in addition to the CYP genetic polymorphisms.

Keywords: Cytochrome b5 CYP3A4 CYP2C9 CYP2C19 Human liver microsome Metabolism Genetic polymorphism

© 2019 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.

1. Introduction Human cytochrome b5 (Cytb5, gene name; CYB5A) is involved in various biological metabolic pathways as an electron transfer component. The function of cytb5 includes CYP-catalyzed drug metabolism, fatty acid desaturation, methemoglobin/hemoglobin cycling [1e3], as well as steroid hormone biosynthesis [4]. Furthermore, cytb5 plays a role in the reduction of heavy metals, carcinogenic arylhydroxylamines, and in the biosynthesis of glycerol-based phospholipid in heart and neuronal tissues [5e8]. The Cytochrome P450 (CYP) superfamily is involved in the oxidative metabolism of a variety of endogenous and exogenous compounds [9,10]. Human CYPs are mainly expressed in liver and

* Corresponding author. Department of Pharmacology and PharmacoGenomics Research Center, Department of Clinical Pharmacology, Inje University College of Q1,2 Medicine, Gaegum-dong, BusanJin-gu, Busan, Republic of Korea. ** Corresponding author. Department of Pharmacology and PharmacoGenomics Research Center, Inje University College of Medicine, Busan, Republic of Korea. E-mail addresses: [email protected] (S.-J. Lee), [email protected] (J.-G. Shin).

also exist in the lung, kidney and small intestine [11,12]. Most of the CYPs have similar mechanism of action in their metabolism [9,10]. Therefore, it has been suggested that cytb5 may contribute the second electron in some systems and thereby also influence CYP activity. The role of cytb5 in CYPs monooxygenase reaction has been reported in in vitro and in vivo studies. CYP2A6, CYP3A4, CYP3A5, CYP2B6, CYP2C8, CYP2D6 and CYP2E1 showed enhanced activities by presence of cytb5 in both enzyme reconstitution and CYP/NADPH-cytochrome P450 reductase (POR) membrane systems [13,14]. In case of CYP2C9 and CYP2C19, cytb5 was required for catalytic activities in the reconstitution system [13]. In in vivo situations, apparent reduction of CYP-mediated metabolism has been observed in several drugs in the hepatic deletion of cytb5 in the mouse model including midazolam, metoprolol, tolbutamide, phenacetin and chlorzoxazon as well as some anticancer drugs, cyclophosphamide, tamoxifen and anastrozole [4,15]. Moreover, genetic variability in cytb5 has been reported in multiple studies. Nonsynonymous mutations, T60A and S5A, in cytb5 caused the altered affinity for hydroxylamine and expressed the lower levels of cytb5 protein [8].

https://doi.org/10.1016/j.dmpk.2019.03.001 1347-4367/© 2019 The Japanese Society for the Study of Xenobiotics. Published by Elsevier Ltd. All rights reserved.

Please cite this article as: Yoo S-E et al., Influences of cytochrome b5 expression and its genetic variant on the activity of CYP2C9, CYP2C19 and CYP3A4, Drug Metabolism and Pharmacokinetics, https://doi.org/10.1016/j.dmpk.2019.03.001

55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

DMPK259_proof ■ 5 April 2019 ■ 2/8

2

S.-E. Yoo et al. / Drug Metabolism and Pharmacokinetics xxx (xxxx) xxx

Phenotypic outcomes were observed from the decreased function of cytb5 in humans. It is known that 17, 20-lyase activity is modulated by activity of cytb5. Missense mutations (H44L) or nonsense mutations (W27X) in CYB5A revealed significantly impaired 17, 20-lyase activity, resulting in sex steroid deficiency, for example, male with abnormal masculinization, 46, XY disorder of sex development [16]. Furthermore, 16-bp deletion in CYB5A mRNA as an alternative splice site mutation exhibited severe cyanosis 7 days after birth and also in case of certain patient, cytb5 deficiency caused type IV methemoglobinemia, which indicated 12e19% of methemoglobin concentration in total hemoglobin level [17,18]. Multiple studies reported cytb5 contents in African-American, Caucasian-American and also in Chinese by spectral or Western blot analysis [1,5,19], accounting for the large variations in its expression. However, there has been lack of a combined investigation using cytb5 protein contents, cytb5 genetics, and the CYP metabolism in the same human liver tissues. CYP2C9, CYP2C19, and CYP3A4 were investigated as examples of drug metabolizing P450s to estimate the contribution of cytb5 to the P450 activities. Therefore, specific aims in the present study were to investigate the variations in cytb5 expression, to determine the relationship between cytb5 content and major CYP activity (CYP2C9, 2C19, and CYP3A4), and to analyze the influences of genetic polymorphisms in cytb5 gene on the corresponding P450 activities.

2.3. Quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) analysis for cytb5 mRNA expression Extracted RNA (1 ㎍) from human liver tissue using TRIzol® Reagent (Ambion, Life Technologies Corp., Carlsbad, CA) was reverse transcribed to cDNA using TaqMan Reverse transcription Kit (Applied Biosystems, Foster City, CA). Quantitative real-time PCR (qPCR) was conducted using the following specific primers and probe sets: CYB5A (Assay ID: Hs04229876_g1) and Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (Assay ID: Hs03929097_g1). PCR reaction was performed in 384-well plate and each well contained 1 ㎍ cDNA, TaqMan probe, 2X TaqMan Universal PCR Mixture Mix in total volume 20 mL (Applied Biosystems, Foster City, CA). Cycling conditions include a UNG incubation step at 50
C for 2 min, AmpliTaq Gold activation step at 95
C for 10 min, denaturing step at 95
C for 15 s and annealing/ extension step at 60
C for 1 min for 40 cycles. Reactions were run in ABI Prism 7900 Sequence Detector from Applied Biosystems. GAPDH was used a reference gene and the relative mRNA expression of cytb5 was determined using the DCt method [21]. GAPDH Ct values subtracted from CYB5A Ct values and then calculated as the ratio using 2-(DCt). The Ct measurements were performed in triplicates. 2.4. Genotyping for CYP2C19*2, CYP2C19*3 and CYP2C9*3 in liver tissues

2. Materials and methods 2.1. Human liver samples Thirty-six human liver tissues originated from Koreans were obtained, with informed consent, from the Tissue Repository Biobank at Inje Pharmacogenomics Research Center (Inje University College of Medicine, Busan, Korea) as reported previously [20]. Human liver microsomes (HLM) were prepared by institutional guidelines and the study was approved by the Institutional Review Board of Busan Paik Hospital (Busan, Korea). 2.2. Quantification of cytochrome b5 protein level in HLMs Protein contents of cytb5 in human liver were determined by Western blot analysis. Briefly, liver tissue was homogenized and centrifuged at 13,000 rpm for 20 min at 4
C. The supernatant was isolated and spin downed again with ultracentrifuge at 100,000 g for 1 h at 4
C. After that, the pellet was resuspended in buffer MB (5 mM MgCl26H2O, 0.1 M NaH2PO4, 1 mM EDTA). The concentration of microsomal protein was measured by Bradford method using Bio-Rad protein assay reagent (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The denatured microsomal proteins (2 ㎍/lane) were separated by NuPAGE 4e12% Bis-Tris gel (Novex by LifeTechnology, Carlsbad, CA, USA) electrophoresis and then transferred to a polyvinylidenedifluoride (PVDF) membrane (GE Healthcare Life Sciences, Buckinghamshire, UK). The membrane was blocked with 5% skimmed milk (Sigma-Aldrich, St. Louis, MO, USA) in Tris-Buffered Saline (TBS) supplemented with 0.1% Tween 20 solution at room temperature for 1 h 30 min. Polyclonal rabbit anti-cytb5 IgG (Abcam, Cambridge, MA, USA) and monoclonal rabbit anti-b-actin IgG (Cell Signaling Technology, Danvers, MA, USA) were used as primary antibodies overnight at 4
C. All of the primary antibodies were used at a 1:1000 dilution. The immunoreactive proteins were detected with the ECL enhanced chemiluminescence system (GE Healthcare Life Sciences, Buckinghamshire, UK). Band densities for cytb5 and b-actin were quantified using ImageJ (http://rsb.info.nih. gov/ij/). The relative cytb5 levels in the Western blots were normalized to b -actin.

Genotyping was conducted as previously reported [22,23]. Genomic DNA was isolated and detection of CYP2C19*2, CYP2C19*3, and CYP2C9*3 was verified by using pyrosequencing method. Briefly, after amplifying the DNA fragment with specific primers, the reaction mixtures were analyzed on a PSQ 96 MA Pyrosequencer (Pyrosequencing AB, Uppsala, Sweden). The validation on the accuracy of pyrosequencing and amplification was performed by direct DNA sequencing using the same genomic DNA. 2.5. Activity of cytochrome P450 enzyme from microsomal fractions For activity assays, incubation mixture consisted of 0.25 mg/mL of HLMs, substrate drug (100 mM Tolbutamide, 20 mM Omeprazole and 5 mM Midazolam) and a NADPH-generating system (including 1.3 mM NADP, 3.3 mM glucose 6-phosphate, 3.3 mM MgCl2, and 1.0 U/mL glucose-6-phosphate dehydrogenase) in a total volume of 100 mL phosphate buffer (0.1 M, pH 7.4) was used as described previously [24]. After 5 min of pre-incubation, reaction was initiated by the addition of an NADPH-generating system and incubated in a water bath at 37
C for 15 min. The reaction was terminated by the addition of 100 mL of acetonitrile containing chlorpropamide as an internal standard. After vortexing the mix, reaction mixtures were centrifuged at 14,000 rpm for 5 min at 4
C. The supernatant was analyzed directly by liquid chromatography-tandem mass spectrometry (LC-MS/MS). 2.6. LC-MS/MS analysis LC-MS/MS was performed using QTrap 4000 LC-MS/MS system (Applied Biosystems, Foster City, CA, USA), coupled with an Agilent 1100 series high-performance liquid chromatography system (HPLC) (Agilent Technologies, Santa Clara, CA, USA). The separation was carried out on a Luna C18 column (2.0  30 mm, 5 mm, Phenomenex, Torrence, USA) using mobile phase that consists of (A) water containing 0.1% formic acid and (B) acetonitrile containing 0.1% formic acid at a flow rate of 0.2 mL/min. TurboSpray ionization was operated in positive and negative mode at a spray voltage of 5 kV and 4 kV at 400
C, respectively. The operating condition was

Please cite this article as: Yoo S-E et al., Influences of cytochrome b5 expression and its genetic variant on the activity of CYP2C9, CYP2C19 and CYP3A4, Drug Metabolism and Pharmacokinetics, https://doi.org/10.1016/j.dmpk.2019.03.001

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

DMPK259_proof ■ 5 April 2019 ■ 3/8

S.-E. Yoo et al. / Drug Metabolism and Pharmacokinetics xxx (xxxx) xxx

optimized by flow injection of an analyte and determined as follows: nebulizing gas flow, 1.04 L/min; curtain gas flow, 1.44 L/min; auxiliary gas flow, 4.0 L/min; orifice voltage, 80 V; ring voltage, 400 V; collision gas (nitrogen) pressure, 3.3  105 Torr. Multiplereaction-monitoring (MRM) mode using specific precursor/product ion transition was employed for the quantification. Peak areas for all components were automatically integrated using Analyst software (version 1.2). 2.7. DNA sequencing and identification of splicing variants For full direct sequencing of the CYB5A gene, the total 36 genomic DNA samples were obtained from the PharmacoGenomic Research Center (Inje University college of Medicine, Busan, Korea). The CYB5A genomic sequence was amplified by polymerase chain reaction (PCR) by using a specific primer set which was designed by primer3 software (http://bioinfo.ut.ee/primer3/). The primer pair 50 -ATCTCTTGGCACTTAATCTGCT-3’ (forward) and 50 -GCACGTGCTACCATAAAAAGTA-3’ (reverse) yields a 516-bp product which includes exon 3 and intron 2/exon 3/intron 3 junctions of CYB5A. The amplification was initiated by adding 200 ng genomic DNA, 10 mM each of forward and reverse primer, 10X EX Taq buffer, 2.5 mM dNTP and EX-Taq polymerase (TaKaRa Bio., Shiga, Japan) in total volume of 50 mL. The PCR condition was as follows: initial denaturation at 94
C for 2 min, followed by 30 cycles of 94
C for 20 s, 58
C for 30 s, 72
C for 30 s, and a final elongation step at 72
C for 3 min. PCRs were performed with GeneAmp PCR 9700 (Applied Biosystems, Foster City, CA). Amplified products were directly sequenced on an ABI Prism 3730xl Genetic Analyzer (Applied Biosystems, Foster City, CA, USA). Heterozygous or homozygous mutations were identified using the Chromas (Technelysium Pty Ltd., Australia) and BioEdit (Ibis Biosciences., Carlsbad, CA) software.

3

performed with on the three types of CYP2C19 genotype using specific primer sets as reported [25]. After confirming the quality of cDNA, the PCR was performed using specific primers to specifically amplify cytb5 to see the alternatively spliced cytb5 mRNA species. All primers were designed with primer3 software (http://bioinfo.ut. ee/primer3/) and their sequence homology and specificity were checked by using BLAST on NCBI (http://blast.ncbi.nlm.nih.gov/ Blast.cgi). PCRs were conducted in total 50 mL with 100 ng of the liver cDNA, 10 mM primers, 10X EX Taq buffer, 2.5 mM dNTP and EXTaq polymerase (TaKaRa Bio., Shiga, Japan). The conditions of PCR reactions were as follows: 94
C for 3 min as initial denaturation step; 35 cycles of 94
C for 3 min, annealing 63
C for 30 s, and 72
C for 1 min-2 min, and final extension at 72
C for 2 min. The amplified cDNA was separated on a 3% agarose (BIONEER, Korea) gel. All primer sequences and the annealing temperatures are listed in detail in Table 1. 2.9. Data analyses DNA sequences were analyzed with Chromas (Technelysium Pty Ltd., Australia) and BioEdit (Ibis Biosciences., Carlsbad, CA) software. mRNA and protein expression levels were analyzed by ImageJ (http://rsb.info.nih.gov/ij/). The normal distribution of data was confirmed using Kolmogorov-Smirnov test or Shapiro-Wilk normality method. Differences between parameters for wild and mutant types were verified using an unpaired t-test. Pearson's correlation or non-parametric Spearman's rank correlation were used to calculate the correlation coefficient (r) and Pearson's correlation was applied when the normal distribution was satisfied. A P value of less than 0.05 was considered statistically significant (*P < 0.05). All statistical analysis and data management were conducted by using GraphPad Prism software (GraphPad Software Inc., San Diego, CA, USA).

2.8. RT-PCR analysis for alternatively spliced cytb5 mRNA species 3. Results Liver tissues were obtained from the Biobank at Inje Pharmacogenomics Research Center (Inje University College of Medicine, Busan, Korea). Total RNA was prepared from liver tissue using the TRIzol® Reagent (Ambion, Life Technologies Corp., Carlsbad, CA) according to supplier instructions. DNase I was treated to eliminate genomic DNA contamination from isolated RNA before synthesizing cDNA. One microgram of DNase I treated RNA was added to the reaction mixture which contained 2.5 mM dNTP, 100 pmol oligodT and RNase-free water in a total volume of 13 mL. The mixtures were incubated at 72
C for 5 min and in ice for 3 min. Then, 5X first strand buffer and 0.1 M DTT were added and the mixture heated to 42
C for 2 min. Finally, 200 U of M-MLV reverse transcriptase was added and final incubation was initiated at 42
C for 55 min. The reaction was terminated by elevating the temperature to 72
C for 5 min cDNAs for cytb5 were simultaneously synthesized with the liver tissues carrying CYP2C19 *2 splice variant to determine whether cDNA quality is suitable for the detection of splicing patterns for cytb5 mRNA as controls. The liver cDNA which had wild type (*1/*1), heterozygous mutant type (*1/*2) and homozygous mutant (*2/*2) of CYP2C19 were selected respectively and PCR was

3.1. Cytochrome b5 protein expression levels in human liver tissue Protein contents of cytb5 were determined by Western analysis using 36 human liver microsomes and the band densities were normalized to the b -actin protein level. To confirm the cytb5 protein contents in the studies, immunoblottings were conducted twice independently in the same experimental schemes to confirm inter-experimental variations. Firstly measured protein contents of cytb5 were highly correlated with the second measured results, showing high coefficient of correlation (r) value (r ¼ 0.7320, ***P < 0.001) (Fig. 1A), indicating low inter-experimental variations. Cytb5 protein expression levels exhibited an eleven-fold variation among 36 individual human liver microsomes (Fig. 1B). 3.2. The cytochrome b5 mRNA levels in human livers The cytb5 mRNA levels were determined by quantitative realtime PCR using 36 human liver microsomes and normalized to the GAPDH mRNA level. The cytb5 mRNA levels showed about

Table 1 Primer sequences for RT-PCR analysis of CYP2C19 *2 and CYB5A. Primer name a

CYP2C19 *2 F (forward) CYP2C19 *2 R (reverse)a CYB5A FP1 (forward) CYB5A RP1 (reverse)

Gene

PCR primer sequence (50 to 30 )

Size (bp)

CYP2C19

ATTGAATGAAAACATCAGGATTG GTAAGTCAGCTGCAGTGATTA CGGACGAGGCCGTGAAGTACTA TAGATGAATAAAAAGGCACACTCG

284 (wt) or 244 (mt)

CYB5A

609

PCR, polymerase chain reaction; bp, base pair. a The primer set was from de Morais et al., 1994 [25].

Please cite this article as: Yoo S-E et al., Influences of cytochrome b5 expression and its genetic variant on the activity of CYP2C9, CYP2C19 and CYP3A4, Drug Metabolism and Pharmacokinetics, https://doi.org/10.1016/j.dmpk.2019.03.001

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

DMPK259_proof ■ 5 April 2019 ■ 4/8

4

S.-E. Yoo et al. / Drug Metabolism and Pharmacokinetics xxx (xxxx) xxx

Fig. 1. Variations in the expression levels of cytochrome b5 (cytb5) protein and mRNA content in human liver microsomes (n ¼ 36). (A) Correlation between the first and second immunoblot analysis to confirm a low inter-experimental variation in the experimental settings. Western blot analysis was performed independently using the same system twice. Coefficient of correlation (r) and P value are also shown, indicating low inter-experimental variations between two experiments (r ¼ 0.7320, ***P < 0.001). (B) Relative amounts of Cytb5 protein content in human liver microsomes. (C) Cytb5 mRNA expression were measured by qRT-PCR (N ¼ 36). Each data bar represents the mean of triplicate determinations. (D) Relationship between Cytb5 mRNA and Cytb5 protein contents. Values of the Cytb5 mRNA levels were expressed as the ratio of the Cytb5 mRNA to GAPDH mRNA using DCt method. Cytb5 protein contents were normalized by b-actin and details are described under Materials and Method. Spearman's correlation was used for statistics. Each data bar represents the mean of duplicate determinations.

six-fold inter-individual variability (Fig. 1C). The relationship between cytb5 mRNA and protein levels was also analyzed. The microsomal contents of cytb5 mRNA measured by qPCR did not strongly correlate with that of cytb5 protein detected by immunoreactivity in 36 individual human liver microsomes (r ¼ 0.058, P > 0.05) (Fig. 1D). 3.3. Correlation between cytochrome b5 and CYP450 activities Correlation analyses with P450 (CYP2C9, CYP2C19 and CYP3A4) activities and cytb5 contents were performed. CYP activity data were obtained from a microsomal incubation system using 100 mM tolbutamide for CYP2C9, 20 mM omeprazole for CYP2C19 and 5 mM midazolam for CYP3A4 as described under Materials & Methods. The relative protein expression of CYP2C9 and OH-tolbutamide activities showed a positive correlation, indicating protein level dependent increase of tolbutamide metabolism (r ¼ 0.415; P ¼ 0.018; Fig. 2A). Microsomal cytb5 contents were correlated with tolbutamide hydroxylase activity in liver microsomes having CYP2C9 *1/*1 and CYP2C9 *1/*3 genotype (r ¼ 0.450; P ¼ 0.001; Fig. 2B). In case of CYP2C19, there were large variations in CYP2C19 genotypes in liver samples; the largest number of 2C19 genotype was CYP2C19 *1/*2, followed by CYP2C19 *1/*1, *1/*3, *2/*2 and *2/ *3. As shown in Fig. 2C, correlation was found between the CYP2C19 protein amount and 5-OH-omeprazole (r ¼ 0.364; P ¼ 0.048). However, there was a very weak correlation between cytb5 contents and 5-OH-omeprazole (r ¼ 0.138; P ¼ 0.468; Fig. 2D). CYP3A4 protein levels and midazolam hydroxylation exhibited a clear positive correlation (r ¼ 0.436; P ¼ 0.018; Fig. 2E). Furthermore, relationship between cytb5 protein contents and OH-Midazolam activities was significantly correlated with each other (r ¼ 0.468; P ¼ 0.011; Fig. 2F). Among three CYPs tested (CYP2C9, CYP2C19 and

CYP3A4), CYP3A4 activity was most strongly affected by cytb5 expression. 3.4. Analysis of cytb5 splicing variant in human liver tissues To identify the genetic polymorphisms in cytb5 gene which could cause differences in expression level of cytb5 in human liver, genetic reports in the 1000 genome project (http://www. internationalgenome.org) and Korean Reference Genome Database (http://152.99.75.168/KRGDB/menuPages/firstInfo.jsp) were analyzed. From our analysis, a single nucleotide polymorphism (SNP), c.288G>A (rs7238987), was selected for further functional study due to its possible cause in alternative splicing from our software analysis with splicing prediction softwares (http://www. fruitfly.org/seq_tools/splice.html; ASSP, http://wangcomputing. com/assp/index.html; http://www.umd.be/HSF3/index.html). The rs7238987 was found in exon 3 on cytb5. The specific feature of rs7238987 was that the guanine located right before the intron 3 region was converted to adenine, which changed the consensus sequence motif for normal splicing reaction (Fig. 3A), showing decreased splicing strength score in c.288G>A mutant type. The rs7238987 was screened in 36 liver genomic DNA by sequencing analysis. From our DNA sequencing, four individuals were identified as heterozygotes (Fig. 3B). Additionally, ethnic differences in the frequency of rs7238987 are summarized in Supplementary Table S1. To estimate the pattern of splicing in cytb5 mRNA, reversetranscriptase PCR (RT-PCR) was conducted by using wild and heterozygous samples that have a splicing variant, c.288G>A (rs7238987). CYB5A exons 1 to 5 and 30 untranslated region (30 UTR) were amplified from the wild cDNA and variant cDNA (Fig. 3C). Wild-type liver cDNA exhibited a single amplification of the expected size (609 bp). Liver samples having heterozygous

Please cite this article as: Yoo S-E et al., Influences of cytochrome b5 expression and its genetic variant on the activity of CYP2C9, CYP2C19 and CYP3A4, Drug Metabolism and Pharmacokinetics, https://doi.org/10.1016/j.dmpk.2019.03.001

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

DMPK259_proof ■ 5 April 2019 ■ 5/8

S.-E. Yoo et al. / Drug Metabolism and Pharmacokinetics xxx (xxxx) xxx

5

Fig. 2. Influence of different cytochrome b5 protein expressions on the metabolism of CYP2C9, CYP2C19, and CYP3A4 substrates. (A) Relationship of CYP2C9 protein contents and tolbutamide metabolism and (B) effect of cytb5 contents on activity of tolbutamide hydroxylation in human liver tissues. The symbols of CYP2C9 genotype were expressed as CYP2C9 *1/*1 (C), CYP2C9 *1/*3 (B). (C) Relationship between CYP2C19 protein contents and omeprazole metabolism and (D) effect of cytb5 contents on the omeprazole metabolism in human liver tissues. CYP2C19 activity was deduced by omeprazole metabolism and the symbols of CYP2C19 genotype were expressed as CYP2C19 *1/*1 (C), CYP2C19 *1/*2 (:), and CYP2C19 *1/*3 (,). Relationship between CYP2C19 protein and 5-OH-omeprazole metabolite indicates statistical significance (P < 0.05). Each data point indicates the mean of duplicate determinations. (E) Relationship between CYP3A4 protein content and midazolam hydroxylation and (F) effect of Cytb5 contents on the activity of midazolam hydroxylation in human liver tissues. CYP3A4 activity was measured with 5 mM Midazolam and the symbol of CYP3A4 genotype was expressed as CYP3A4 *1/*1 (C). Experimental conditions and details are described under Materials & Methods. Spearman's correlation analysis was used for Fig. 2A, 2C and Pearson's correlation was applied for the Fig. 2B, 2D, 2E, 2F. Coefficient of correlation (r) and P value are also shown with statistically significant values.

mutation for the splicing variant (c.288G>A, GA) yielded two other distinct sized fragments (CYB5A SV.1 and SV.2; both over 1 kb) in addition to the normal sized amplicon (Fig. 3D). Splicing patterns from the human liver cDNA carrying CYP2C19*2 allele were also analyzed as controls to examine the quality of synthesized cDNA for detecting cytb5 splicing transcripts (Fig. 3E). CYP2C19 (*1/*1) cDNA yielded a 284bp band, a 244bp band was obtained from homozygous mutation (*2/*2), and both bands were from the cDNA obtained from liver tissues carrying heterozygous mutation (*1/*2). The three different genotypes showed expected sizes in each transcript. Therefore, it was concluded that liver tissues carrying the c.288G>A variant can generate aberrantly spliced mRNA species of cytb5. To investigate expression level of cytb5 protein in liver tissues having splicing variant (n ¼ 4), immunoblot was conducted and compared to the liver tissues without having the splicing variant (n ¼ 32) (Fig. 4A). Liver tissues having a c.288G>A heterozygous mutation exhibited tendency of expressing less cytb5 compared to the wild type (Fig. 4B).

CYP3A4 were examined using the liver microsomes with the genotype information. Human liver microsomes (0.25 mg/mL) were incubated with 100 mM tolbutamide for CYP2C9, 20 mM omeprazole for CYP2C19 and 5 mM midazolam for CYP3A4 in the incubation mixture containing NADPH-generating system as described under Materials and Method. LC-MS/MS system was utilized for the quantification of substrate drugs and metabolites. Comparative analysis between wild (c.288 GG) and heterozygous mutant type (c.288 GA) of cytb5 on CYP2C9, CYP2C19 and CYP3A4 activities are shown in Fig. 4. Although there was a weak statistical significance, CYP2C9 wild-type exhibited higher tolbutamide metabolism than the splice variant (80.98 ± 73.19 vs 50.48 ± 16.91 pmol/min/mg, P ¼ 0.21) (Fig. 4C). Mean CYP2C19 catalytic activity for omeprazole in the splice variant microsomes exhibited a markedly lower activity than the wild-type (10.58 ± 2.14 pmol/min/mg vs 17.07 ± 6.15 pmol/min/mg; *P < 0.05) (Fig. 4D). Midazolam metabolism was also decreased in the microsome carrying the splice variant, but there was weak statistical significance 627.79 ± 279.18 pmol/min/mg vs 927.42 ± 831.25 pmol/min/mg; P ¼ 0.25) (Fig. 4E).

3.5. Effect of the splicing variant (c.288 GA) on the activities of CYP2C9, CYP2C19 and CYP3A4

4. Discussion

To assess the influence of splicing variant (rs7238987) in cytb5 on CYP activities, prototypical substrates for CYP2C9, CYP2C19, and

In this study, the expression levels of cytb5 protein and mRNA were determined using liver tissues and the effect of cytb5

Please cite this article as: Yoo S-E et al., Influences of cytochrome b5 expression and its genetic variant on the activity of CYP2C9, CYP2C19 and CYP3A4, Drug Metabolism and Pharmacokinetics, https://doi.org/10.1016/j.dmpk.2019.03.001

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

DMPK259_proof ■ 5 April 2019 ■ 6/8

6

S.-E. Yoo et al. / Drug Metabolism and Pharmacokinetics xxx (xxxx) xxx

Fig. 3. Schematic of cytb5 gene (CYB5A) and the discovery of a putative splicing mutation in cytb5. (A) Cytb5 gene map with the location of the c.288G>A (rs7238987) which could cause alternative splicing. Black boxes indicate exons, lines mean introns and white boxes denote 50 - and 30 - untranslated region (UTR). (B) DNA sequence chromatograms for wild-type and heterozygous mutation for c.288G>A. The variant site, c.288G>A (rs7238987), was indicated by the hollow boxes and arrow as a heterozygosity for the allele. (C) Schematic of CYB5A cDNA structure and the location of primers. (D) RT-PCR was performed using the genotyped liver tissues. The targeted fragment was amplified from the cDNA using the FP1 and RP1 primer sets. PCR product for the wild-type (GG) was expected to have 609-bp. All of 4 liver tissues having heterozygous mutations (GA) exhibited multiple splicing variants in addition to the expected size found in the wild-type tissues. Two alternative splicing bands (SV.1 and SV.2) were indicated by arrows. (E) Detection of CYP2C19 splicing variant in human liver cDNA. RT-PCR for the detection of CYP2C19*2 splicing variant in liver tissues was performed as a control for the investigation of CYB5A splicing variant. Details are described under Materials and Methods. All genotype showed its specific band pattern correctly. N.C, negative control, in which reverse transcriptase was omitted in the cDNA synthesis to see any genomic DNA contamination in the PCR.

Fig. 4. Effect of the splicing variant (c.288G>A) on the cytochrome b5 protein expression and on the activities of tolbutamide, omeprazole and midazolam in human liver microsomes. (A) Comparison of Cytb5 protein levels between the microsomes having c.288G>A (rs7238987) variant and the wild type. Horizontal dotted lines indicate mean values in each genotype. (B) Immunoblot analysis of relative Cytb5 protein amount. A set of representative Western blot data was presented with the variant (star mark, *). (C) Scatterplot of activities was obtained from 100 mM tolbutamide for CYP2C9 and (D) 20 mM omeprazole for CYP2C19 and (E) 5 mM midazolam for CYP3A4. Horizontal lines indicated mean CYP activities in each genotype. Experimental conditions, data, genotyping, and other details are described under Materials & Methods. P values for difference between enzyme activities and genotypes were determined by using unpaired t-test. *P < 0.05 indicates statistical significance.

Please cite this article as: Yoo S-E et al., Influences of cytochrome b5 expression and its genetic variant on the activity of CYP2C9, CYP2C19 and CYP3A4, Drug Metabolism and Pharmacokinetics, https://doi.org/10.1016/j.dmpk.2019.03.001

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65

DMPK259_proof ■ 5 April 2019 ■ 7/8

S.-E. Yoo et al. / Drug Metabolism and Pharmacokinetics xxx (xxxx) xxx

contents on CYP2C9, CYP2C19 and CYP3A4 activities were analyzed by using their prototype substrates. Moreover, a splicing variant (c.288G>A, rs7238987) in cytb5 was identified and its influence on cytb5 expression and CYP activities were studied in the liver tissues with the genotyping information. There were large inter-individual variations in cytb5 protein and mRNA contents, indicating 11- and 6-fold differences, respectively, among 36 human liver tissues. The major limitation in the present study was a small sample size which prevented a statistically clear description about the role of cytb5. Further studies using a large number of samples would be needed toward a more conclusive statement. Multiple studies have been reported regarding the variation of cytb5 expression in liver tissues. Briefly, 24 livers of Japanese samples showed 15-fold and 17-fold variation in cytb5 protein and mRNA [26]. Zhang H et al. also reported inter-individual variability on cytb5 protein and mRNA contents, exhibiting 19-fold and 12-fold variation [1]. In others, cytb5 protein expression showed 5-fold variation in 111 liver samples and 9.3-fold in 19 human liver microsomes [5,19]. Therefore, collectively, these data indicate that there are large variations in cytb5 expressions in humans. There was weak correlation between cytb5 mRNA and protein in the present study and another previous study [1]. These results may suggest that cytb5 expression might be modulated with post-transcriptional regulation. It is well known that miR-223 is involved in mRNA degradation or translational repression of cytb5 [26]. Increased number of liver tissues would be helpful for determination of the correlation between mRNA and protein expressions. The role of cytb5 is known to provide an electron to the P450 in the cycle of P450 reaction [15]. Most of reported studies using cytb5 in P450 reaction were from a reconstitution system or coexpression of cytb5 with CYP gene, which are artificial experimental conditions that may lead to unrealistic results. In the present study, we used human liver microsomes and three prototype drugs, tolbutamide, omeprazole and midazolam as substrates of CYP2C9, CYP2C19 and CYP3A4, respectively. As for the effect of cytb5 expression level on CYP activities, CYP3A4 showed the strongest correlation between cytb5 protein contents and P450 activity followed by CYP2C9 and CYP2C19. Similarly, cytb5 also enhanced the drug oxidation of CYP2C9 and CYP3A4 in the reconstitution system [13]. Additionally, it has been reported that CYP2C9 activities with diclofenac, (S)-flurbiprofen and (S)warfarin were altered by different ratios of Cytb5:CYP2C9 [27]. Decreased tolbutamide hydroxylation activity was detected in liver and kidney microsomes in cytb5 knock-out mice (BCN) [6]. In a study on the relationship between CYP3A4 activity and cytb5, a dose-dependent increase in CYP3A4 activity with cytb5 was characterized, showing a maximum of 16-fold increase when compared with the condition in absence of cytb5 in enzyme reconstitution [28]. Co-expression of cytb5 with CYP3A4 and POR increased CYP3A4 activity in a positive cooperativity manner [29,30]. Cytb5 was reported to have a critical role in testosterone 6b-hydroxylation, nifedipine oxidation and pyrene oxidation with CYP3A4 in cytochrome b5 complete null (BCN) mice studies, resulting in significantly reduced metabolites [6,29,31,32]. A weak correlation was observed between omeprazole metabolism and cytb5 protein amount in the present study. In case of reconstitution condition, catalytic activity of CYP2C19 was enhanced by addition of cytb5 [13]. However, in human liver microsomes, multiple factors might impact on the metabolism of omeprazole, such as diverse unknown mutations in CYP2C19, metabolism by different P450s, other pathologic conditions of the liver, and environmental effects. These factors may mask the true effect of cytb5 on the omeprazole metabolism which is mainly metabolized by CYP2C19. Although further studies would be needed to

7

elucidate the correlation between CYP2C19 and cytb5 using large numbers of microsomes, the effect of cytb5 on CYP2C19 activity appears to be weaker than that of CYP3A4. In addition, we analyzed genetic polymorphism in the cytb5 gene. A rs7238987 (c.288G>A) mutation, guanine to adenine change at exon 3 region of cytb5, was predicted to cause alternative splicing patterns. Four liver samples having rs7238987 were identified in total 36 human liver tissues, showing as 5.6% frequency. Allele frequency for this variant from Korean Reference Genome DB (http://52.99.75.168/KRGDB/menuPages/firstInfo.jsp) was shown to be 0.103. In case of other Asian populations, Han Chinese in Beijing (CHB) and Japanese in Tokyo (JPT) showed 0.095 and 0.110 allele frequency (International HapMap Project, http://hapmap. ncbi.nlm.nih.gov/index.html.en). There have been no functional studies for this c.288G>A single nucleotide polymorphism (SNP). In the present study, different sizes in mRNAs of cytb5 were found in the liver tissues carrying this mutation, but not from the liver tissues in the absence of this mutation. PCR amplicon from the mRNA carrying the c.288G>A heterozygous mutation revealed two additional amplicons (>1 kb size) in addition to the 609 bp wild-type amplicon. Two additional transcripts presented longer transcript than wild transcript, suggesting that liver carrying rs7238987 might express different levels of cytb5 protein. Therefore, we determined the cytb5 protein levels using livers carrying wild and c.288G>A mutation. Liver having a c.288G>A genotype appeared to have a lower level cytb5 protein compared to the wild-type (P ¼ 0.34). This result may support that alternatively spliced transcript might be degraded easily through the nonsense mediated degradation pathway, resulting in lower amount of cytb5 protein [33]. However, because of the sample number limitation in the present study, further study using a large number of the variant tissues would be needed for statistical significance. All of three enzyme activities in the present study, indicated by metabolism of tolbutamide, omeprazole, and midazolam, showed a tendency of decreased activity in the presence of c.288G>A mutation. As for the genetic polymorphisms in cytb5, recent studies indicated that variation in cyb5 gene is associated with adiposity and type 2 diabetes [34] and caused altered activity of CYP1A2 [35]. In addition to the genetic polymorphisms in P450 genes, the fundamental mechanism between P450 and cytb5 has been explored extensively to understand the contribution of cytb5 to the variations in P450 activity [35,36]. The role of cytb5 in P450 metabolism could differ, depending on different substrates and different P450s, in the catalytic activity which may require an individualized approach for each substrate. A large number of liver tissues containing homozygous mutation of c.288G>A would be beneficial for understanding the role of this mutation in the metabolism and biological function in the future study. In summary, the present study demonstrated that there were large inter-individual variations in cytb5 mRNA and protein levels and these expression variations affected P450 metabolism. A putative splicing variant, c.288G>A (rs7238987), was identified. This SNP caused low catalytic activity of CYP2C9, CYP2C19, and CYP3A4 when compared with the wild-type cytb5. Influences of cytb5 protein on the metabolism of P450 substrates indicated that a positive correlation between the cytb5 expression level and their enhanced substrate metabolism was present. Although the expression variations of cytb5 was not confirmed in whole liver tissues, higher expression of cytb5 in the microsomal fractions would facilitate more efficient electron transfer to the P450 cycle, resulting in more accelerated metabolism compared to the lower amount of cytb5 protein. The present data suggest that variable functions or expressions of cytb5 would cause variations in P450-mediated drug metabolism in humans.

Please cite this article as: Yoo S-E et al., Influences of cytochrome b5 expression and its genetic variant on the activity of CYP2C9, CYP2C19 and CYP3A4, Drug Metabolism and Pharmacokinetics, https://doi.org/10.1016/j.dmpk.2019.03.001

66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Q4 16 17 18 19 Q3 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64

DMPK259_proof ■ 5 April 2019 ■ 8/8

8

S.-E. Yoo et al. / Drug Metabolism and Pharmacokinetics xxx (xxxx) xxx

Conflicts of interest The authors report no declaration of interest. Authorship contributions Sung-Eun Yoo, Jae-Gook Shin, and Su-Jun Lee are participated in research design. Sung-Eun Yoo, MyeongJin Yi, Woo-Young Kim, Sun-A Cho, and Sang Seop Lee conducted experiments. Data were analyzed by Sung-Eun Yoo, Su-Jun Lee, and Jae-Gook Shin. SungEun Yoo and Su-Jun Lee wrote the manuscript. Uncited reference [37]. Acknowledgements This research was supported by a grant of Korea Health Technology R&D Project through the Korea Health Industry Development Institute, funded by the Ministry of Health & Welfare, Republic of Korea (Grant number: HI15C1537). This work was supported by the National Research Foundation of Korea grant funded by the Korea government (MSIT) (No. 2018R1A5A2021242). Appendix A. Supplementary data Supplementary data to this article can be found online at https://doi.org/10.1016/j.dmpk.2019.03.001. References [1] Zhang H, Gao N, Liu T, Fang Y, Qi B, Wen Q, et al. Effect of cytochrome b5 content on the activity of polymorphic CYP1A2, 2B6, and 2E1 in human liver microsomes. PLoS One 2015;10(6):e0128547. [2] Umbreit J. Methemoglobin–it's not just blue: a concise review. Am J Hematol 2007;82(2):134e44. [3] Jeffcoat R, Brawn PR, Safford R, James AT. Properties of rat liver microsomal stearoyl-coenzyme A desaturase. Biochem J 1977;161(2):431e7. [4] Henderson CJ, McLaughlin LA, Finn RD, Ronseaux S, Kapelyukh Y, Wolf CR. A role for cytochrome b5 in the in vivo disposition of anticancer and cytochrome P450 probe drugs in mice. Drug Metab Dispos 2014;42(1):70e7. [5] Sacco JC, Trepanier LA. Cytochrome b5 and NADH cytochrome b5 reductase: genotype-phenotype correlations for hydroxylamine reduction. Pharmacogenetics Genom 2010;20(1):26e37. [6] McLaughlin LA, Ronseaux S, Finn RD, Henderson CJ, Roland Wolf C. Deletion of microsomal cytochrome b5 profoundly affects hepatic and extrahepatic drug metabolism. Mol Pharmacol 2010;78(2):269e78. [7] Borthiry GR, Antholine WE, Kalyanaraman B, Myers JM, Myers CR. Reduction of hexavalent chromium by human cytochrome b5: generation of hydroxyl radical and superoxide. Free Radic Biol Med 2007;42(6):738e55. Discussion 5-7. [8] Kurian JR, Longlais BJ, Trepanier LA. Discovery and characterization of a cytochrome b5 variant in humans with impaired hydroxylamine reduction capacity. Pharmacogenetics Genom 2007;17(8):597e603. [9] Shimada T, Mernaugh RL, Guengerich FP. Interactions of mammalian cytochrome P450, NADPH-cytochrome P450 reductase, and cytochrome b(5) enzymes. Arch Biochem Biophys 2005;435(1):207e16. [10] Anzenbacher P, Anzenbacherova E. Cytochromes P450 and metabolism of xenobiotics. Cell Mol Life Sci 2001;58(5e6):737e47. [11] Guengerich FP. Characterization of human cytochrome P450 enzymes. FASEB J 1992;6(2):745e8. [12] Lynch T, Price A. The effect of cytochrome P450 metabolism on drug response, interactions, and adverse effects. Am Fam Physician 2007;76(3):391e6. [13] Yamazaki H, Nakamura M, Komatsu T, Ohyama K, Hatanaka N, Asahi S, et al. Roles of NADPH-P450 reductase and apo- and holo-cytochrome b5 on xenobiotic oxidations catalyzed by 12 recombinant human cytochrome P450s expressed in membranes of Escherichia coli. Protein Expr Purif 2002;24(3): 329e37.

[14] Stiborova M, Moserova M, Cerna V, Indra R, Dracinsky M, Sulc M, et al. Cytochrome b5 and epoxide hydrolase contribute to benzo[a]pyrene-DNA adduct formation catalyzed by cytochrome P450 1A1 under low NADPH: P450 oxidoreductase conditions. Toxicology 2014;318:1e12. [15] Finn RD, McLaughlin LA, Ronseaux S, Rosewell I, Houston JB, Henderson CJ, et al. Defining the in Vivo Role for cytochrome b5 in cytochrome P450 function through the conditional hepatic deletion of microsomal cytochrome b5. J Biol Chem 2008;283(46):31385e93. [16] Idkowiak J, Randell T, Dhir V, Patel P, Shackleton CH, Taylor NF, et al. A missense mutation in the human cytochrome b5 gene causes 46,XY disorder of sex development due to true isolated 17,20 lyase deficiency. J Clin Endocrinol Metab 2012;97(3):E465e75. [17] Giordano SJ, Kaftory A, Steggles AW. A splicing mutation in the cytochrome b5 gene from a patient with congenital methemoglobinemia and pseudohermaphroditisms. Hum Genet 1994;93(5):568e70. [18] Hegesh E, Hegesh J, Kaftory A. Congenital methemoglobinemia with a deficiency of cytochrome b5. N Engl J Med 1986;314(12):757e61. [19] Kurian JR, Bajad SU, Miller JL, Chin NA, Trepanier LA. NADH cytochrome b5 reductase and cytochrome b5 catalyze the microsomal reduction of xenobiotic hydroxylamines and amidoximes in humans. J Pharmacol Exp Ther 2004;311(3):1171e8. [20] Lee SJ, Lee SS, Jung HJ, Kim HS, Park SJ, Yeo CW, et al. Discovery of novel functional variants and extensive evaluation of CYP2D6 genetic polymorphisms in Koreans. Drug Metab Dispos 2009;37(7):1464e70. [21] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25(4):402e8. [22] Lee SJ, Kim WY, Kim H, Shon JH, Lee SS, Shin JG. Identification of new CYP2C19 variants exhibiting decreased enzyme activity in the metabolism of Smephenytoin and omeprazole. Drug Metab Dispos 2009;37(11):2262e9. [23] Lee SJ, Jang YJ, Cha EY, Kim HS, Lee SS, Shin JG. A haplotype of CYP2C9 associated with warfarin sensitivity in mechanical heart valve replacement patients. Br J Clin Pharmacol 2010;70(2):213e21. [24] Kim MJ, Kim H, Cha IJ, Park JS, Shon JH, Liu KH, et al. High-throughput screening of inhibitory potential of nine cytochrome P450 enzymes in vitro using liquid chromatography/tandem mass spectrometry. Rapid Commun Mass Spectrom 2005;19(18):2651e8. [25] de Morais SM, Wilkinson GR, Blaisdell J, Nakamura K, Meyer UA, Goldstein JA. The major genetic defect responsible for the polymorphism of S-mephenytoin metabolism in humans. J Biol Chem 1994;269(22):15419e22. [26] Takahashi K, Oda Y, Toyoda Y, Fukami T, Yokoi T, Nakajima M. Regulation of cytochrome b5 expression by miR-223 in human liver: effects on cytochrome P450 activities. Pharm Res 2014;31(3):780e94. [27] Locuson CW, Wienkers LC, Jones JP, Tracy TS. CYP2C9 protein interactions with cytochrome b(5): effects on the coupling of catalysis. Drug Metab Dispos 2007;35(7):1174e81. [28] Lee SJ, Goldstein JA. Comparison of CYP3A4 and CYP3A5: the effects of cytochrome b5 and NADPH-cytochrome P450 reductase on testosterone hydroxylation activities. Drug Metab Pharmacokinet 2012;27(6):663e7. [29] Jushchyshyn MI, Hutzler JM, Schrag ML, Wienkers LC. Catalytic turnover of pyrene by CYP3A4: evidence that cytochrome b5 directly induces positive cooperativity. Arch Biochem Biophys 2005;438(1):21e8. [30] Dong MS, Lee SB, Kim HJ. Co-expression of human cytochrome b5 increases expression of cytochrome P450 3A4 in Escherichia coli by stabilizing mRNA. Protein Expr Purif 2013;89(1):44e50. [31] Peng HM, Auchus RJ. Two surfaces of cytochrome b5 with major and minor contributions to CYP3A4-catalyzed steroid and nifedipine oxygenation chemistries. Arch Biochem Biophys 2014;541:53e60. [32] Yamazaki H, Johnson WW, Ueng YF, Shimada T, Guengerich FP. Lack of electron transfer from cytochrome b5 in stimulation of catalytic activities of cytochrome P450 3A4. Characterization of a reconstituted cytochrome P450 3A4/NADPH-cytochrome P450 reductase system and studies with apocytochrome b5. J Biol Chem 1996;271(44):27438e44. [33] Cuccurese M, Russo G, Russo A, Pietropaolo C. Alternative splicing and nonsense-mediated mRNA decay regulate mammalian ribosomal gene expression. Nucleic Acids Res 2005;33(18):5965e77. [34] Huang K, Nair AK, Muller YL, Piaggi P, Bian L, Del Rosario M, et al. Whole exome sequencing identifies variation in CYB5A and RNF10 associated with adiposity and type 2 diabetes. Obesity 2014;22(4):984e8. [35] Palma BB, Silva E Sousa M, Urban P, Rueff J, Kranendonk M. Functional characterization of eight human CYP1A2 variants: the role of cytochrome b5. Pharmacogenetics Genom 2013;23(2):41e52. [36] Yablokov E, Florinskaya A, Medvedev A, Sergeev G, Strushkevich N, Luschik A, et al. Thermodynamics of interactions between mammalian cytochromes P450 and b5. Arch Biochem Biophys 2017;619:10e5. [37] Gonzalez E, Guengerich FP. Kinetic processivity of the two-step oxidations of progesterone and pregnenolone to androgens by human cytochrome P450 17A1. J Biol Chem 2017;292(32):13168e85.

Please cite this article as: Yoo S-E et al., Influences of cytochrome b5 expression and its genetic variant on the activity of CYP2C9, CYP2C19 and CYP3A4, Drug Metabolism and Pharmacokinetics, https://doi.org/10.1016/j.dmpk.2019.03.001

65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128