Analysis of Genetic Diversity and Relationships of Seven Chinese Indigenous Pig Breeds and Three Exotic Pig Breeds Using the DNA Differential Display Technique

Available online at www.sciencedirect.com

Agricultural Sciences in China 2006, 5(9): 713-717

September 2006

Analysis of Genetic Diversity and Relationshipsof Seven Chinese Indigenous Pig Breeds and Three Exotic Pig Breeds Using the DNA Differential Display Technique LIU Yong-gang’,*, XIONG Yuan-zhu’ and DENG Chang-yanl 1 2

Key Laboratory of Swine Genetics and Breeding of Ministry of Agriculture, Huazhong Agricultural University, Wuhan 430070, RR.China Key L a b o r a t o v of Animal Nutrition and Feed of Yunnun Province, Yunnan Agricultural University, Kunming 650201, RR.China

Abstract The genetic diversity and relationships of seven Chinese indigenous pig breeds (Meishan, Erhualian, Hezuo, Bamei, Qingping, Tongcheng, and Huainan) and three exotic pig breeds (Large White, Landrace, and Duroc) were analyzed using the DNA differential display technique by means of eight primer combinations. A total of 123 reproducible bands were used to calculate mean Nei’s gene diversity, and mean Shannon’s information index for each pig population. Based on these the Nei’s standard genetic identity and distance were estimated, which was used to construct a dendrogram tree for the 10 pig breeds. The experimental results obtained and the method used in this study for evaluating the genetic diversity and relationships of pigs were also discussed.

Key words: Chinese indigenous pigs, exotic pigs, genetic diversity and relationship, DNA differential display

INTRODUCTION Chinese indigenous pig breeds often have valuable traits such as disease resistance, high fertility, good maternal qualities, unique product qualities, longevity, and adaptation to harsh conditions. Exotic pig breeds such as Large White, Landrace, and Duroc possess good growth rate and high lean rate. So detecting the genetic differences between Chinese indigenous pig breeds and exotic pig breeds or their relationships are very important to pig breeders. Arbitrarily primed polymerase chain reaction (APPCR) is a useful tool to produce specific DNA fingerprints by PCR amplification using arbitrary oligonucleotides to prime DNA synthesis from genomic sites that fortuitously match or almost match (Welsh and McClelland 1990). Generally, two cycles of PCR are

performed under low stringent conditions with a single random primer, followed by PCR at high stringent conditions with specific primers. This technique is usually used to study tumor-specific genetic changes and genotype of the bacteria or distinguish different kinds of bacteria, but is never used to detect the diversity and relationships of different pig breeds. The mRNA differentialdisplay first describedby Liang and Pardee (1992) was a fast, efficient method for detecting the differences of gene expression in different cell types and had experienced several improvements. This technique possessed the following advantages over other similar techniques: more than two samples could be compared simultaneously, and only a small amount of starting material was needed (Yamazaki and Saito 2002). In the present study, a new technique was applied, DNA differential display technique, which was modi-

Received 11 January, 2005 Accepted 22 September, 2005 LIU Yong-gang. Ph D; Correspondence XIONG Yuan-zhu, Tel: +86-27-87287390, E-mail: liuyg45670 163.com

92006.CAAS.All rights men@. Publishedby ElsevierLtd.

LIU Yong-gang et ul.

714

fied from the improved mRNA differential display technique and AP-PCR technique, to evaluate the genetic diversity and relationships of seven Chinese indigenous pig breeds, Meishan pig, Erhualian pig, Hezuo pig, Bamei pig, Qingping pig, Tongcheng pig, Huainan pig, and three typical exotic pig breeds, Large White, Landrace, and Duroc.

DNA differential display DNA differential display PCR was performed using eight primer sets presented in Table 2. DNA was used as a template to perform differential display PCR (DD-PCR). The 25 pL reaction system contained 2.0 pL DNA, 2.5 pL 2 mM mixed dNTPs, 2.5 yL 10 x Taq DNA polymerase buffer, 2.5 pL 2.5 mM MgCl,, 2.0 pL 20 pM anchored primer, 2.0 pL 20 pM arbitrary primer, 2.0 units of Taq DNA polymerase (1 U pL I), and 7.5 pL sterile water. PCR was run as follows: 94°C for 5 min, 40°C for 5 min, 72°C for 5 min, 3 cycles, followed by 30 cycles of 94°C for 1 min, 60°C for 1 min, 72°C for 2 min, then 72°C extension for 10 min, and finally 4°C to terminate the reaction. PCR products were separated on an 8% nondenaturing polyacrylamide gel and bands were visualized by silver staining following the method of Liu et u2. (2004a, b; 2005a, b).

MATERIALS AND METHODS Sample collection Blood samples of the 10 pig breeds were collected from 550 unrelated animals belonging to 10 swine populations presented in Table 1. Genomic DNA was isolated from blood white cells and DNA extraction procedure described by Sambrook et al. (1 989) was carried out.

Table 1 Pig blood samples information

_____ Brced

_

_

_

I x g z White

I .andrace

Meishan He zii o llmei tirhualian Ihroc

Qwping Tongcheng Huainan

_

_

_

_

.

-

Sampling location

~

~

Hiibei Jingping Pig Breeding Farm Hubei Jingping Pig Breeding Farm Hubei Jingping Pig Breeding Farm Hezuo City, Gansu Province Longdong Region, Gansu Province Jiangsu Province Hubei Jingping Pig Breeding Farm Hubei Ymgxin Pig Conservation Farm Hubei Tongcheng Pig Conservation Farm Guahi County, Henan Province

Table 2 DD-PCR primer sets Primer sct 1 Anchored primer 1 : 5 ’-CAlTATGCTGAGTCATATCAAAAAAAAAC(‘-1’ Arhitrary primer 1 : 5’-AITAACCCTCACTAAAGATCTGACTG-3’ Primer set 2 Anchored primer 2: 5‘-CAlTATGCTGAGTGATATCAAAAAAAAACG-3 ‘ Arbitrary primer 2: 5’-ATTAACCCTCACTAAATGCTGGGTG-3’ Primer set 3 Anchored primer 3: 5’-CATTATGCTGAGTGATATCAAAAAAAAAGA-3 ‘ Arbitrary primer 3: 5’-AlTAACCCTCACTAAATGCTGTATG-3’ Primer set 4 Anchored primer 4: 5 ’-CAlTATCCTGAGTGATATCAAAAAAAAAGC-3’ Arhilrary primer 4: 5‘-AlTAACCCTCACTAAATGGAGCTGG-3‘ Primer set 5 Anchored primer 5: 5‘-CATTATGCTGAGTGATATCTTTI7?TITGG-3’ Arbitrary primer 5 : 5 ’-AlTAACCCTCACTAAATGTGGCAGG3’ Primer set 6 Anchored primer 6: 5 ’-CNTATGCTGAGTGATATC7TITITI7TAA-3 ’ Arbitrary primer 6: 5’-ATTAACCCTCACTAAAGCACCGTCC-3’ Primer set 7 Anchored primer 7: 5 ’ - C A T r A T G C T G A G T G A T A T C m A C - 3 ‘ Arbitrary primer 7: 5 ’-AlTAACCCTCACTAAATGCTGGGGA-3’ Primer set 8 Anchored primer 8: 5 ’ - C A l T A T G C T G A G T G A T A T C m C A - 3 ’ Arbitrary primer 8: 5’-ATTAACCCTCACTAAATGCTGGTAG-3‘

Sample size rota1 ~

~

~

Mde

-~

~~

80

30 72 58 60 48 34 34

40

29 30 24

29 30

17 17 26

53 71

Female ~~~

40 19 36

35

II 36

23 17 15 27 36

Statistical analysis The “0” was used to represent “band absence” and “1” to represent “band presence”, so that every band was divided into two types, and then the gel image data were entered into the computer and genetic analysis was performed. The mean gene diversity, standard genetic identity, and distance of each population were estimated by the methods of Nei (1978). Mean Shannon’s information index of each population was estimated by the method of Lewontin (1972). A dendrogram tree was constructed based on the Nei’s genetic distanceusing the software PopGen32 version 1.31 (Yeh et al. 1999).

82006, CAAS. All nghts resewed. Published by ElsevierLtd

Analysis of Genetic Diversity and Relationships of Seven Chinese Indigenous Pig Breeds and Three Exotic Pig Breeds Using

RESULTS

1

2

3

715

4 5 6 7 8 9 1 0

DD-PCR and silver stain display A total of 123 alleles were used to perform genetic analysis by DD-PCR and silver stain display. An example of DNA differential display result is shown in Fig. 1.

Intra-populationgenetic variability The mean Nei’s gene diversity and mean Shannon’s information index for each population were calculated using the software PopGen32. The results are presented in Table 3. As shown in Table 3, the mean Nei’s gene diversity for the 10 pig populations was between 0.0478 and 1.2217, and the mean Shannon’s information index ranged from 0.0725 to 0.1811. By comparing these indices, it was observed that the level of genetic variation within the Large White population was the highest, whereas the level of genetic variation within the Huainan pig population was the lowest.

Fig. 1 A typical example of DNA differential display for 10 pig breeds. 1-10 represent Large White, Landrace, Meishan pig, Hezuo pig, Bamei pig, Erhualian pig, Duroc, Qingping pig, Tongcheng pig, and Huainan pig, respectively.

Landrace had the largest distance and Erhualian and Hezuo had the smallest. A dendrogram tree was constructed based on the Nei’s standard genetic distances above. The results are shown in Fig.2. As shown in the dendrogram tree based on the Nei’s standard genetic distances, these 10 populations were divided into two branches, the Duroc pig formed one

Inter-populationgenetic relationship Nei’s genetic identity and genetic distance (Liu et al. 2005a) were also calculated. The results are presented in Table 4. As shown in Table 4, Nei’s genetic distances among populations ranged from 0.0677 to 0.2149. Doruc and

Table 3 The mean Nei’s gene diversity and mean Shannon’s information index for ten pig breeds Breed H‘

I’

&Large White 1.2217 0.1811

Landrace 0.0785 0.1 185

Meishan 0.0930 0.1447

Hezuo 0.1168 0.1723

Bamei 0.1506 0.2215

Erhualian 0.0948 0.1424

Duroc 0.0884 0.1412

Qingping 0.0966 0.1495

Tongcheng 0.0855 0.1262

Huainan 0.0478 0.0725

H’, Nei’s (1973) gene diversity; I’. Shannon’s information index (Lewontin 1972)

Table 4 Nei’s genetic identity (above diagonal) and genetic distance (below diagonal) Breed Large White Landrace Meishan Hezuo Bamei Erhualian

Duroc Qingping Tongchcng Huainan

Large White

.*..

Landrace 0.9083

0.0962 0.1161 0.1297 0.1002 0.1492 0.1343 0.1136 0.1698 0.1941

0.1736 0.1264 0.1223 0.1539 0.2149 0.1970 0.1682 0.2090

...a

Meishan 0.8904 0.8406 .I..

0.0709 0.0948 0.1037 0.1192 0.1400 0.1560 0.2027

Hezuo 0.8784 0.8813 0.9316 *.*

0.083 1 0.0677 0.1420 0.0965 0.1125 0.1593

Bamei 0.9046 0.8849 0.9095 0.9202

.*..

0.0680 0.1694 0.1096 0.1281 0.1374

Erhualian 0.8614 0.8573 0.9015 0.9345 0.9342 0.1900 0.1175

0.2129

Qingping 0.8926 0.8212 0.8694 0.9080 0.8962 0.8891 0.8082 .**.

0.1064 0.1343

0.2458 0.2795

0.1823 0.2267

.I..

Duroc 0.8743 0.8066 0.8877 0.8676 0.8442 0.8269

...

t

Tongcheng 0.8438 0.8452 0.8555 0.8936 0.8797 0.8991 0.7820 0.8334 0.0838

....

Huainan 0.8236 0.8114 0.8166 0.8528 0.8716 0.8743 0.7561 0.7971 0.9196

....

02006,CAAS. All rightsreserved. Publishedby Elsevkrltd.

-,

Large White

different pattern of AP-PCR products (Welsh and McClelland 1990). I Landracc On the basis of these results, the DNA differential display technique was set up, which was modified from AP-PCR technique and mRNA differential display technique by using longer anchored “T” or anchored “A” primers in combination with the longer arbitrary primers to perform two-stepped PCR: two cycles of PCR under conditions of low stringency followed by 30 cycles of PCR at high stringency. This technique used the AP-PCR procedure but the primer design was referred to the mRNA differential display technique. The I ’ I>uroc traditional AP-PCR primer design always used the arbitrary primer model, but the DNA differential display Fig. 2 Dendrogram tree of 10 pig breeds based on Nei’s standard technique used one arbitrary primer in combination with genetic distances. one anchored poly “T” or poly “A” primer. Thus, DNA differential display PCR could detect the flanking sebranch and the other nine pig populations formed the quence polymorphism of the genomic DNA poly “T” other branches. Among the nine pig populations, Large or poly “A” regions. From the known DNA sequence White and Landrace grouped closely. Meishan and of NCBI database, it was seen that there were several Hezuo, Bamei and Erhualian clustered first, respectively, poly “T” or poly “A” regions covering the genomic and then with the Qinping formed one close group. DNA for any species. Therefore, the DNA differential Tongcheng and Huainan formed another close group. display technique can be applied for any species whose DNA can be prepared. This technique in combination with high sensitive DISCUSSION silver stain technique made it easier for the researchers to find the difference or diversity of genomic DNA because it was inexpensive, simple and practical comIn recent years, the diversity and relationships of difpared to using fluorescent labels, which required exferent pig breeds were investigated using microsatellite pensive equipment or a complex operation, and was markers (Li et al. 2000; Fan et al. 2002) and mitomore sensitive than ethidium bromide staining (Deng et chondrial DNA amplified polymorphism (Jiang et al. al. 1999). 2001 ; Alves et al. 2003) methods, which were estabFrom the results obtained above by using the DNA lished based on the PCR method. Each of these methdifferential display technique, it was observed that the ods had specific applications and advantages, but beexotic pig breeds Large White and Landrace grouped fore using these methods, the sequence information of closely and Duroc pig was obviously distinguished from studied DNA regions should be known very well and other pig breeds. This was reasonable because the two the primers must be derived from the known DNA pig breeds Large White and Landrace were both introsequences. In this sense, the information obtained from duced into China from Europe and lived in relatively microsatellite markers and mitochondria1 DNA ampliclose geographical areas, whereas Duroc was introfied polymorphism was very limited. Arbitrarily primed duced from North America. The Chinese indigenous PCR (AP-PCR), which was a very rapid and simple pig breeds were traditionally grouped into North-China technique, generated a fingerprint of PCR products type, South-China type, Central-China type. Lower using primers chosen without regard to the sequence Changjiang River Basin type, South-West type, and Plaof the genome to be fingerprinted. Thus, AP-PCR required no prior knowledge of the molecular biology of teau type (Zhang 1986). Meishan, and Erhualian have been previously classified as Lower Changjiang Rwer the organisms to be investigated. Each primer gave a r.----i

0 2006,CAAS. All nghh resewed. Publishedby Elsever Ltd

Analysis of Genetic Diversity and Relationships of Seven Chinese Indigenous Pig Breeds and Three Exotic Pig Breeds Using

Basin type, Qingping and Tongcheng as Central-China type, Hezuo as Plateau type, Huainan and Bamei as North-China type. However, the resulted phylogenies above do not support this ‘type’ classifications. From the results obtained above, it was seen that Meishan and Hezuo, Bamei and Erhualian clustered first, and then with the Qinping formed one close group. The Tongcheng and Huainan formed another close group. In fact this was not the first report that stated that the the molecular level classification was not in agreement with the traditional geographical classification (Li ef al. 2000; Fan et al. 2002), but it still apparently showed that all Chinese indigenous pig breeds clustered to a branch. It was noticed that Large White and Landrace were also in the branch of Chinese indigenous pig breeds. This was in agreement with the results of Jiang et al. (2001) by means of the mitochondrial DNA amplified polymorphism method. The south China pig breeds were introduced into Europe about 2000 years ago and were used to improve the European pig breeds during the early 18th century. This historical reason might elucidate that the Large White and Landrace were closely related to Chinese indigenous pig breeds (Jiang et al. 2001; Zhang 1986). All of the above indicated that the DNA differential display technique used to scan the differences of DNA was a successful method. Of course, as a new technique, much work is needed to consummate this technique.

Acknowledgements This study was supported financially by the National Program on Key Basic Research Projects of China (973) (G200016105).

References Alves E, Ovilo C, Rodriguez M C, Silio L. 2003. Mitochondria1 DNA sequence variation and phylogenetic relationships among Iberian pigs and other domestic and wild pig populations. Animal Genetics, 34,3 19-324. Deng X, Hu Z A, Wang H X. 1999. mRNA differential display visualized by silver staining tested on gene expression in resurrection plant Boea hygrometrica. Plant Molecular Biology Reporter, 17, 1-7. Fan B, Wang Z G, Li Y J, Zhao X L, Liu B, Zhao S H, Yu M, Li M H, Chen S L, Xiong T A, Li K. 2002. Genetic variation analysis within and among Chinese indigenous swine populations using microsatellite markers. Animal Genetics,

717

33,422-427. Jiang S W, Elisabetta G, Leif A, Xiong Y Z. 2001. Molecular phylogenetics relationship between six Chinese pig breeds and three Swedish pig breeds from mitochondrial DNA. Acta Genetica Sinica, 28, 1120-1128. Lewontin R C. 1972. The apportionment of human diversity. Evolutionary Biology, 6,381-398. Li K, Chen Y, Moran C, Fan B, Zhao S, Peng Z. 2000. Analysis of diversity and genetic relationships between four Chinese indigenouspig breeds and one Australiacommercialpig breed. Animal Genetics, 31,322-325. Liang P, Pardee A B. 1992. Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction. Science, 257,967-971. Liu Y G, Xiong Y Z, Deng C Y, Zuo B, Zhang J H. 2004a. Comparison of gene expression patterns in longissimusdorsi of pigs between the high-parent heterosis cross combination LandracexLarge White and the mid-parent heterosis cross combinationLarge WhitexMeishan.Asian-AustralianJournal of Animal Science, 17, 1192-1196. Liu Y G, Xiong Y Z, Deng C Y. 2004b. Isolation, identification and tissue expression profile analysis of one novel differentially expressed sequence tag in the longissimus dorsi muscle from Meishan, MeishanxLarge White Hybrid and Large White pigs. Agricultural Sciences in China, 3, 856861. Liu Y G, Xiong Y Z, Deng C Y. 2005a. Isolation, identification of differentially expressed sequence tags in the backfat tissue from Meishan, Large White and MeishanxLargeWhite cross pigs. Agricultural Sciences in China, 4,5458. Liu Y G, Xiong Y Z, Deng C Y. 2005b. Isolation, sequence analysis and expression profile of a novel swine gene differentially expressed in the longissimus dorsi muscle tissues from LandracexLargeWhite cross-combination.Acta Biochimica et Biophysica Sinica, 37,186-191. Nei M. 1978. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics, 89, 538-590. Sambrook J, Fritsch E F, Maniatis T. 1989. Molecular Cloning: A Laboratory Manual. Vol. 3. 2nded. Cold Spring Harbor Laboratory Press, New York. Welsh J, McClelland M. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nuclear Acids Research, 18, 7213-7218. Yamazaki M, Saito K. 2002. Differential display analysis of gene expression in plants. Cell Molecular Life Sciences, 59, 1246-1255. Yeh F C, Boyle T, Ye Z, Xiyan J M. 1999. POPGENE version 131: Microsoft Window-based freeware for population genetic analysis. In: University of Alberta and Center for International Forestry Research. Zhang 2. 1986. Pig Breeds in China. Shanghai Science and Technical Publishers, Shanghai. p. 235. (in Chinese) (Edited by WANG Lu-han)