Analysis of the vegetative replication origin of broad-host-range plasmid RK2 by transposon mutagenesis

PLASMID

15, 132-146 (1986)

Analysis of the Vegetative Replication Origin of Broad-Host-Range Plasmid RK2 by Transposon Mutagenesis MICHAEL Department

A. CROSS, SIMON R. WARNE,

of Genetics,

University

of Birmingham,

AND CHRISTOPHER

P.O. Box 363, Birmingham

M. THOMAS B15 2TT,

United

Kingdom

Received September 13, 1985 A range of Tn I723 transposon mutants of the oriV region of broad-host-range plasmid RK2 have been isolated, and the internal EcoRI fragment of the transposon has been deleted from each to reduce the insertion size from 9.6 kb (Tn1723) to 35 bp (ATn1723). Sequencing from the ATn 1723-derived EcoRI site has allowed the precise mapping of these insertions to various points dispersed through the origin region. Using these mutants we have determined which regions of oriV,, are of functional importance to plasmid establishment following transformation of the host species Escherichia coli, Pseudomonas putida, and P. aeruginosa. Insertions into an AJTrich region, and a region containing five direct repeat sequencesprevented successfultransformation of each host species tested, but the continuity of sequences adjacent to the five repeats were essential only in E. coli and P. putida. The establishment and maintenance in E. coli of a miniRK2 replicon was found to be inhibited by transcription from an inducible promoter positioned to read into oriV,, against the direction of replication. Assaysof transcription emerging from Tn 1723 demonstrated significant levels from one end of the transposon only. Four mutants with insertions downstream of oriV W were unable to become established in E. co/i, and contained Tn1723 in the orientation which would supply transcription toward the oriVRK2 region. These results demonstrate both that the sequence requirements for oriV,, function differ between host bacterial species, and that origin function may be further influenced by the genetic environment in which it lies. 0 1986 Academic press Inc.

The broad-host-range plasmids of Escherichia coli incompatibility group P (IncP) are able to transfer between and maintain themselves within a wide range of gram-negative bacterial species (Datta and Hedges, 1972; Olsen and Shipley, 1973; Beringer, 1974; Cho et al., 1975). Plasmid RK2 has a molecular size of 60 kb, is present in E. coli at a copy number of 5 to 7 per chromosome equivalent and encodes resistance to penicillin, kanamycin, and tetracycline (for review see Thomas, 198 la). It is one of a group of broad-host-range IncP plasmids including RPl, RP4, R68, and R18 which are indistinguishable (Burkardt et al., 1979; Stokes et al., 198 1) and are considered to be essentially identical. The origin of vegetative replication (oriVRm) lies between coordinates (defined clockwise from the unique EcoRI site and revised according to Lanka et al., 1983) 12.3 and 13.0 kb (Thomas et al., 1980), and is dependent for its function on the polypeptide product(s) of the t&4 gene, located 0 147-6 19X/86 $3.00 Copyright 0 1986 by Academic Press, Inc. All rights of reproduction in any form reserved.

between coordinates 16.0 and 17.3 kb (Thomas et al., 1980; Shingler and Thomas, 1984a). Replication from ori VRKz proceeds unidirectionally anticlockwise with respect to the conventionally drawn genetic map (Meyer and Helinski, 1977). RIS2 also encodes a series of kil genes which are either host-lethal (kilA, B, C) or interfere with plasmid maintenance (kilD) and which are normally regulated by their corresponding kor (kil over ride) genes (Figurski et al., 1982; Smith and Thomas, 1983). Expression of the operon containing t&4 is negatively regulated by korA/D and korB (Shingler and Thomas, 1984b), and while in RK2 these control circuits appear to provide the overriding copy number control mechanism (Thomas and Hussain, 1984), neither the kil nor the kor genes appear to be essential for plasmid replication. Thus it has been shown that oriVand trfA together are sufficient for plasmid maintenance in E. coli (Thomas, 198 1b), and 132

ANALYSIS

133

OF THE oriV REGION OF RK2

retain a wide replicative host range (Schmidhauser et al., 1983; Schmidhauser and Helinski, 1985; our unpublished results). The DNA sequence has been determined for a 617-bp (bp) HaeII to HpaII fragment which was derived from the 12.3- to 13.0-kb region of RK2, and contains oriVRKl (Stalker et al., 1981). More recently, RK2 sequences have been reported which overlap this region and extend into the Tc’ genes (Waters et al., 1983). The most striking features apparent from these sequences are drawn diagrammatically in Fig. 1. They include a 40-bp A/T-rich region, which lies adjacent to a 60-bp G/Crich region, and may constitute a localized area of interstrand destabilization necessary for interaction with an initiation complex; possible transcriptional initiation signals (P) from which synthesis of a primer RNA may proceed; and nine, 17-bp direct repeats arranged in groups of five, three, and one. Groups of repeated sequences are a feature of many replication origins, and have in some cases been shown to bind essential replication proteins (Germino and Bastia, 1983a,b; Vocke and Bastia, 1983; Bastia et al., 1985). The largest open reading frames (ORFs) in the origin region are ORFb2, which coincides with the set of five repeats, and ORFT~, which is located between the single copy and the set of three repeats (Fig. 1). Of these two, only ORFT5 is preceded by concensus sequences both for a promoter and a ribosome binding site. The putative product of ORFT5 would be basic, consistent with a possible role in DNA binding. Although a 393-bp HpaII fragment of the oriVRKZ region carrying the set of five direct repeats is functional in E. coli and Pseudomonas putida, adjacent sequences containing the other repeats have been shown to confer increased stability, tighter regulation of copy number and stronger expression of RK2 incompatibility (Thomas et al., 198 1, 1984; Schmidhauser et al., 1983). In addition, when fragments containing oriV= are cloned under selection for origin function, it is common to isolate only one of the two possible orientations of the fragment relative to the vector or

selectable marker (Thomas et al., 1981). This suggests that the function of ori VR, may well be affected by its environment, possibly by the level of transcriptional activity directed toward it. Finally, the isolation of a Tn7 mutant of R18 which is transfer-proficient and is stably maintained in P. aeruginosa and P. putida, but which cannot be established in a range of enteric bacteria, has indicated that the precise requirements for oriVRKz function may be variable and host species-dependent (Cowan and Krishnapillai, 1982; Krishnapillai et al., 1984). To define more accurately the functions involved in initiation and regulation of RK2 replication, it was decided to extend the analysis of the oriVRU region by transposon mutagenesis and subcloning. In this paper we report the effects of a range of insertion mutants on oriVRu function in E. coli and Pseudomonas species, and examine the dependence of plasmid maintenance in E. coli on the transcriptional environment of the origin region. MATERIALS

AND METHODS

Bacterial strains and plasmids used in this

study are listed in Table 1. Media and growth conditions. For E. coliM56 medium (Carlton and Brown, 1981), supplemented with 0.5% casamino acids, 20 pg ml-’ tryptophan and 0.2% (w/v) glucose was used to grow bacteria for galactokinase assays; all other cultures were grown in L broth (Kahn et al., 1979). Antibiotics were included, where appropriate, at the following concentrations: penicillin G (for Pn’) at 150 Fg ml-’ in liquid media or 300 Fg ml-’ in solid media; kanamycin sulfate (for Km’) at 50 Kg ml-‘; tetracycline (for Tc’) at 20 pg ml-‘; and chloramphenicol (for Cm’) at 25 pg ml-‘. All E. coli strains were grown at 37°C. For Pseudomonas species-cultures were grown in L broth or M9 medium (Kahn et al., 1979) supplemented with 0.5% casamino acids and 0.2% (w/v) glucose. Tc’ was selected at either 80 pg ml-’ (P. aeruginosa PA01 16 1) or 40 pg ml-’ (P. putida 2440). Agar for solidification of all media was added to 1.5% (w/v).

134

CROSS, WARNE, AND THOMAS TABLE I BACTERIAL

STRAINSANDPLASMIDS

Bacterial strains

Description

Reference/source

E. co/i K12 MVlO Ru2537

thr, leu, thi, lacy, supE, trpE5 nalA (nal’), recA56, pro22, met63, F+, Tnl723”

D. R. Helinski P. Bennett

E. coli C C2110 C2l lOCh3/14

polAl, his, rha, P2’ C2110, RK2 trfA and trjB

M. Kahn Thomas et al., 1981.

Pseudomonas putida 2440

Prototroph

F. C. H. Franklin

P. aeruginosa PA0 1161

leu, Res-, Mod+

A. Chakrabarty

Size (kb)

Replicon(s)

Details

pACYC184 pKO6 pCT480 pCT4.3 pCT87 pMYC20 pMYC20.1 pMYC2 pMYC200-2 14

4.0 3.9 15.0 7.1 10.1 16.3 14.4 6.2 15.8

PlSa pMB1 R6K/pMB 1 ColEl/RK2 P15a ColEl/RK2 ColE 1 P15a P15a

pMYC200.1-214.1

6.2

pMYC3 pMYC30 1,303310 pSRW1

12.2 13.4

ColEl/RK2 ColEl/(RK2)

11.3

ColEl/RK2

pSRW2

11.3

ColEl/RK2

pSRW3

12.6

ColEl/RK2

Cm’Tc’ Pn’ galK promoter probe vector Pn’Tc’TrpE+ Km’, RK2 oriV, trfA and trfB Cm’, Tc’, RK2 trfA Pn’, Tc’, RK2 &A, tr$B, oriV Pn’, Tc’, RK2 t$A Cm’, RK2 oriV Cm’, Km’, Tn 1723 mutants of pMYC2 Cm’, ATn1723 mutants of pMYC2 Pn’, Tc’, RK2 oriV trfA Pn’, Tc’, ATn 1723 mutants of pMYC3 Km’, Tc’, pCT4.3 with Tti genes from pCT87 Km’, Tc’ as pSRW 1 with Tc’ genes in opposite orientation Km’, Tc’, spontaneous insertion mutant of pSRW 1

Plasmids

P15a

Chang and Cohen, 1978. McKenney et al., 198 1. C. M. Thomas, unpublished. Thomas et al., 1980. Thomas, 1981b. M. A. Cross, unpublished. This study This study This study This study This study This study This study This study This study

’ Located in chromosome

Preparation of plasmid DNA. DNA for sequencing was prepared by the Triton Xcleared lysate method (Kahn et al., 1979) and purified on a caesium chloride/ethidium bromide density gradient. Plasmid DNA for other purposes was prepared by an adaptation of the method of Birnboim and Doly ( 1979) (Smith and Thomas, 1983). Transformation. E. coli strains were grown to exponential phase in L broth, then transformed by the method of Meyer et al. (1977). Pseudomonas strains were transformed by the method of Bagdasarian et al. ( 198 1), followed by an overnight induction of Tc’ in medium

containing tetracycline at 5 pg ml-’ (P. aeruginosa) or 2 pg ml-’ (P. putida). In vitro manipulations of plasmid DNA. Restriction enzymes and T4 DNA ligase were purchased from Bethesda Research Laboratories or NBL enzymes Ltd., and used under conditions similar to those recommended by the suppliers. The size of DNA fragments was estimated by electrophoresis on O&2.3% agarose vertical gels, cast, and run in TBE buffer (Kahn et al., 1979). Transposon mutagenesis ofpMYC2. E. coli strain Ru2537 was transformed with pMYC2 under selection for Cm’ and Km’. Transfor-

ANALYSIS

OF THE oriV

mant colonies were left at room temperature for lo- 14 days, alter which time plasmid DNA was prepared from whole colonies grown up overnight in 1 ml L broth containing antibiotics. Half of each preparation of plasmid DNA was then used to transform E. coli MVlO, selecting Cm’ and Km’. Each transformation commonly yielded one to six colonies, one of which was restreaked and used as a source of plasmid DNA, which was analyzed by restriction enzyme digestion and electrophoresis. Following identification of transposon mutants, the bulk of the transposon was deleted by EcoRI digestion and ligation to leave a 35-bp insertion (ATn1723) containing an EcoRI site. Sequence determinations. The sequence of one DNA strand in each direction from the EcoRI site in ATn1723 insertions was determined. Following EcoRI digestion, 5’ end labeling and redigestion at flanking sites with BglII or SalI, and BamHI or HindIII, fragments were separated on, and electroeluted from, agarose gels. Sequencing reactions and electrophoresis were by the method of Maxam and Gilbert (1980), with the inclusion of the hot alkali A > C reaction in addition to the C-, C + T-, A + G-, and G-specific reactions, to confirm A/G assignments. Galactokinase assays. These were carried out essentially according to the method of McKenney et al. (198 l), but using E. coli MV 10 as the host strain, and growing cultures in media containing 0.4% glucose to repress expression of the chromosomal galK gene. Galactokinase activities were calculated in relation to that of a culture of MVlO carrying the vector plasmid, pKO6. RESULTS

Transposon Mutagenesis of the ori V,, Region Tn1723 (Fig. 1) is a derivative of the Tn3like transposon Tn 1722 (Schmitt et al., 1979) with a gene conferring Km’ inserted on a 3.9kb PstI fragment. Within each of the 38-bp inverted repeats at the termini of the transposon is an EcoRI site, which can be used both for mapping points of insertion, and for dele-

REGION OF RK2

135

tion of all but 35 bp of the original 9.6-kb insert. The remaining insertion (ATn1723) consists of 15 bp from each end of the transposon plus a 5-bp target sequence repeated during transposition. Hence, two families of mutants may be generated: one with insertion of the whole transposon, which is known to disrupt both transcriptional and translational information, as well as the spatial arrangement of DNA; and the other with a 35-bp insertion at the same point, which would disrupt translational information (since 35 is not a multiple of 3), but which would be unlikely to disrupt a transcriptional unit unless inserted into the promoter or terminator itself, and may interfere less with the local structure of the target DNA. The target plasmid used for mutagenesis was pMYC2 (Fig. 1) in which a BamHI to Sal1 fragment of pACYC 184 has been replaced by a BamHI to Sal1 fragment carrying the oriV, region and part of the adjacent RK2 Tc’ genes. Transposon mutants of pMYC2, isolated as described under Materials and Methods, were mapped by agarose gel electrophoresis of the fragments produced by EcoRI digests of plasmid DNA, and then of EcoRI plus Hind111 double digests, to determine the approximate points of transposon insertion. No hot spots for transposition were observed. A range of mutants carrying Tn1723 in or around the oriVR= region were selected and designated pMYC200-214. The orientation of the transposon insertion was found in each case by determining the distance between the pMYC2and Tn 1723-Hind111 sites, and is shown in Fig. 1. The Tn 1723 EcoRI fragment was then deleted from each mutant to yield the corresponding plasmids pMYC200.1-2 14.1. Using this second range of plasmids, the insertion sites were accurately mapped by determining the size of the small fragments produced by either BglII plus EcoRI, or SstII plus EcoRI digests. In conjunction with BumHI plus EcoRI, or Sal1 plus EcoRI digests, this mapping procedure also revealed that no obvious rearrangements other than transposon insertion had occurred within the oriVRK2 DNA of any of the mutants.

136

CROSS, WARNE, AND THOMAS EcoRI

FIG. 1. The structure of insertion mutants used to test oriV am function in E. coli. a. The shaded area represents DNA originally derived from RK2. Designations pMYC200-2 14 refer to mutants carrying Tn1723 at the position shown. The position of the IfpaIl fragment previously defining minimal ori is indicated, as are the setsof direct repeat sequences (-) and the A/T- and G/C-rich regions referred to in the text. ORFr5 and ORF63 are the longest open reading frames apparent from the sequencing data, and P marks a position of homology with E. coli promoter sequences. (Yand fl denote the orientation of each transposon insert, the (Yorientation being shown below. b. The 9.6-kb transposon Tn 1723 in the LYorientation showing the position of the transposition genes derived from Tn1722, the Km’ gene, and the restriction sites used to map the position and orientation of insertion. The near-terminal EcoRI sites were used in the deletion of Tn1723 inserts to the corresponding 35-bp ATn 1723 inserts.

In order to confirm the integrity of sequences adjacent to insertions, and to define the exact point of transposon insertion, the oriVn~z sequence was determined for one strand in each direction from the Tn 1723-derived EcoRI site of each of the plasmids pMYC200.1-2 14.1. The sites of insertion in these mutants are shown in Figs. 1 and 2. Although no extra plasmid-specific mutations were detected, it appeared that the sequence of the oriVRKZ region in pMYC2 and all its derivatives differed from that previously published at two points. The first (an A/T bp in place of the reported T/A at position 309) would constitute a conservative mutation in ORFT5. The second substitutes a C/G bp for the reported A/T at position 59 1 between the third and fourth of the set of five repeats. Although it is not known whether these represent true differences between pMYC2 and those

plasmids sequenced previously, the latter base substitution at least is also evident in an earlier derivative of RK2, pCT4.3 (Thomas ef al., 1980; C. A. Smith, personal communication).

Mapping Minimal ori V,, in E. coli Previous studies have shown that a single 393 bp HpuII fragment (HpaII ori) from the oriVRKZregion is capable of initiating replication when the t&A gene is present in trans, while all further deletions to restriction sites within this fragment eliminated oril/,, activity, at least in E. coli (Thomas et al., 1981; Stalker et al., 1981). We examined in more detail the requirement for specific regions of oriVRKZby attempting to transform pMYC2, pMYC200-2 14, and pMYC200.1-2 14.1 into E. coli C2 1 lOCh3/14. This strain supports ori Vru&irected replication (by virtue of having essential truns-acting genes of RK2 inte-

ANALYSIS

137

OF THE oriV REGION OF RK2

Bgl II ~~TACCGTGGACTCAACCCTCTC6CfiAATCCCTCGCGTTGGAAACTT

50

TCATTGACACTTCAGGGCCACCECA66GAAATTCTCGTCCTT6C6AGAAC / C66CTAT6TCET6CTCCCACTCEACCCTEC6CCCTT66CTTETCTC6CCC

150

100

CTCTCC6C6TC6CTAC66GGCTTCCA6C6CCTTTCC6AC6CTCACC666C

200

TGGTTCCCCTCGCCCCTEGGCTEECECCC

250

6&&CCCTGCAAACGCC

CCAGAAACGCC6TCGAA6CC6T6T6C6AGACA~CCGCCG6C6TT6 202 CA6ATCA6666CGEACG

T6GATAdC6C6GAAAACTT66CCCT~

300 .

ECECCEACTCACCCEfC6C66CGTT6ACA6AT6AGGG6

350 400

CCECCEAC6T6GA6CTG6CCAGCCTCCCAAAATCG6

450

P

ACECCCCCAC ACATTTCA6G66CTETCCACACECACAAAATCCA , CCATTTGCAA66GTTTCCCCCC6TTTTTCGCTAACCT 202 TAACCTSmACCAATATTTATAAACCTTGTTTTTAACCAGGGCT6

650 c&f&l

700 750

CGCCCT66CGC6TGACC6C~ACGCCGAAGGG66GTGCCCCCCCTTCTCG

800

AACC&&G

811

3’

FIG. 2. The precise positions of Tn 1723 insertion in the oriV RKzregion. The sequence of one strand only of the oriV,a region is shown running 5’ to 3’ from the BgfiI site of RK2 coordinate 13.1 kb, to a HpuII site at coordinate 12.3 kb. Arrows below the sequence represent direct repeat sequences, and boxes indicate the 5 bases duplicated by Tn1723 insertion in each of the corresponding mutants pMYC201-210. P refers to a sequence with close homology to an E. coli promoter -10 sequence. Differences from the published sequence of Stalker ef al. (198 1) are marked with an *.

grated into the chromosome), but will not permit the PO&-dependent replication from the P 15a origin. Preparations of plasmid DNA of pMYC2 and of each of the insertion mutants described were used first to transform E. coli strain MV 10, which allows P 1Sa-directed replication and hence provided a comparison of the relative transforming units in each preparation, and secondly to attempt transformation of the test strain, C2 1 lOCh3/ 14. Transformants in each case were selected for Cm’. The results of these experiments are shown in Table 2. Using either pMYC2, which contains the wildtype oriVRK2 region, or 14 of the 30 insertion mutants tested, transformation of C2 1 lOCh3/ 14 regularly occurred at an approximately 1Ofold lower frequency than that of MVlO. One further mutant (pMYC204) which carries Tn 1723 inserted between the three repeats and a putative promoter sequence (Fig. 2) showed

a slightly decreased ability to transform the test strain, resulting in a frequency approximately lOO-fold lower than that of MV 10 transformation. Only one of these permissive mutations lies within the previously defined HpaII origin, and that by only 2 bp of the G/ C-rich region. All other mutants carrying either the full Tn 1723, or the residual 35-bp insert, at any of several dispersed points within H&II ori failed, despite repeated attempts, to yield transformants of the test strain. Of special interest are those points at which the full Tn1723 insertion, but not the 35-bp insertion, inhibits oriVm function. Five pairs of mutants of this type were observed. All have insertions into the same region of the plasmid, near to the end of oriVRKz from which the replication fork would emerge; all are downstream of the A/T-rich and G/C-rich regions proposed as sites for initiation complex binding; and indeed three of the insertions are in DNA not

138

CROSS, WARNE, AND THOMAS TABLE 2

EFFECTOF Tn 1723 AND ATn 1723 INSERTIONS oriV, FUNCTION IN E. co/i No. of transformants in C21 lOCh3/14 / Plasmid pMYC2 Transposon mutants pMYC200 pMYC20 1 pMYC202 pMYC203 pMYC204 pMYC205 pMYC206 pMYC207 pMYC208 pMYC209 pMYC2 10 pMYC2 11 pMYC212 pMYC213 pMYC214

ON

No. of transformants in MVlO

(0.076)” 1.OOb (Tn1723 insertion) 0.92’ 1.55 1.06 0.84 0.17 0 0 0 0 0 0 0 0 0 0

(35-bp insertion) 0.97b 0.84 1.52 0.69 0.47 0 0 0 0 0 0.66 1.30 2.13 1.18 I .47

Note. Each plasmid was transformed into MVlO, in which the p 15a replicon is functional, and into C2 1 lOCh3/ 14 in which the pl5a replicon is nonfunctional and establishment of the plasmid depends on replication from oriV,. The results shown are from a typical experiment. Negative results were recorded only aher repeated attempts to transform the test strains had failed. The tmnsfotmation frequency of MVlO was approximately 2 X lo5 rg-‘. ’ Absolute level. b Relative to pMYC2 level.

derived from RK2. The possible causes of oriVR= disability in these mutants will be considered below. Mapping Minimal ori VRK2in Pseudomonas Species

It has been reported (Cowan and Krishnapillai, 1982; Krishnapillai et al., 1984) that a Tn7 insertion which is in or around the first of the five repeats in the oriV region of Rl8 prevents the establishment of the plasmid in a range of enteric bacteria via conjugal transfer from P. aeruginosa, while transfer and estab-

lishment between some Pseudomonasspecies remains largely unaffected. In addition, minireplicons based on the HpaII ori fragment of RK2 are more unstable in P. putidu than in E. coli (Schmidhauser et al., 1983). This suggests that the requirements for minimal oril/,,, differ between gram-negative host bacteria, so that at least some of the determinants of broad host range may be found in this region. Therefore the requirements for ori VRKZfunction in two Pseudomonasspecies were compared directly with the requirements in E. coli defined in the previous section, by constructing minireplicons dependent on mutated oriVRK2regions, and examining their ability to transform P. aeruginosa and P. putida.

pMYC3 is a hybrid ColEl/mini RK2 replicon, carrying t&4 under control of the trp promoter, and specifying resistance to penicillin and tetracycline (Fig. 3). The plasmids pMYC301 and pMYC303-3 10 carry the mutated oriVRK2 region of pMYC201.1 and pMYC203.1-2 10.1, respectively, in place of the wild-type oriVRKZregion of pMYC3. This range of plasmids was used in the attempted transformation of both P. aeruginosa PAO116 1 and P. putidu 2440 to tetracycline resistance. Transformants were selected in the absence of tryptophan to maximize production of TrfA proteins. Each plasmid preparation was also used to transform E. coli MVlO, in which the ColE 1 replicon is functional, so that variations in the concentration of transforming units between preparations could be corrected for. Because transformation of Pseudomonas strains was inefficient compared to that of the E. coli strains used previously, an overnight incubation in broth containing a sublethal concentration of tetracycline was included before plating on selective medium. Despite the low efficiency of transformation all observations proved highly repeatable. A typical set of results is shown in Table 3. While the overall pattern of insertions defining functional oriVRK2 in each host was similar, one mutation resulting from a 35bp insertion between the set of five direct repeats and a putative promoter sequence

ANALYSIS

139

OF THE oriV REGION OF RR2

a.

Hind

III

’ Barn ‘HI &l

I Em

Hind

RI

III

b. 1’ /I

3 Kg1

II

\

ori VRK2

trfA

f

sst

II

FIG. 3. The construction of plasmids to test oriV aW function in Pseudomonas species.a. Plasmid pMYC20 is a hybrid ColEl/RK2 replicon which carries the RK2 trfA gene under the control of the E. coli trp promoter. The 2.9-kb EcoRI fragment carrying the trfB and oriV regions of RK2 was deleted from pMYC20 to leave plasmid pMYC20.1. b. The large BamHI to Sa/l fragment of pMYC20.1 was ligated to the oriVak++zmtaining BamHI to San fragment of either pMYC2 (see Fig. 2) or of pMYC20 1.1 and 203.1-2 10.1, to give the corresponding “wild type” (pMYC3), or ATn1723-mutated (pMYC301 and 303-310) mini-RR2 replicons.

(pMYC205.1, Fig. 1; pMYC305, Fig. 3) blocked plasmid establishment in E. coli C2 11OCh3/ 14 and P. putida 2440, but did not prevent transformation of P. aeruginosa PA0 116 1. This plasmid was still affected in its function in P. aeruginosa, however, since it transformed the strain with a five- to sixfold decreased frequency compared to that of the wild-type plasmid, pMYC3, and gave rise to

small colonies on selective plates. In addition, electrophoretic comparison of plasmid DNA from stationary phase cultures of transformed P. aeruginosa showed the yields of pMYC305 to be approximately half of those of the other mutants, or of pMYC3 (results not shown). Yields of plasmid DNA from all transformant strains of P. putida 2440 were indistinguishable by electrophoresis.

140

CROSS, TABLE

WARNE,

3

EFFECT OF AT111723 INSERTIONS ON ori V,, IN Pseudomonas SPECIES

FUNCTION

No. of transformants in Pseudomonas sp./No. of transformants in E. coli MV 10

Plasmid pMYC3 pMYC30 1 pMYC303 pMYC304 pMYC305 pMYC306 pMYC307 pMYC308 pMYC309 pMYC3 10

P. putida

2440

(5.10)”

1.006 0.89 0.66 0.62 0 0 0 0 0 1.61

P. aeruginosa PA0 1161 (4.79)”

1 .OOb 0.84 0.63 0.74 0.14’ 0 0 0 0 2.03

D Absolute levels. b Relative to levels of pMYC3. ’ Small colonies.

So, while oriF’=* function in each strain tested requires continuity of the A/T-rich and five direct repeat regions, only in E. coli C2110 Ch3/ 14 and P. putida 2440 were sequences upstream of the five repeats proved to be necessary. The defined limit of functional oriF’, in this case lies within the 110 bp between the sites of insertion in mutants pMYC204.1 and pMYC205.1 (Fig. 2). In P. aeruginosu PA0 116 1 the defined limit lies within a lobp sequence between the sites of insertion in pMYC205.1 and pMYC206.1, the latter being into the first of the five direct repeats. Transcription in E. coli

Emerging from Tnl723

In the construction of trfA-dependent plasmids containing ori VW, it has been common to obtain only one of the two possible orientations of the origin-containing fragment relative to the surrounding DNA (Thomas et al., 198 1). This may be due to limitations imposed by transcriptional signals entering the ori Vregion being either necessary for, or inhibitory to, replication of these plasmids. The observation that Tn1723 can interfere with repli-

AND

THOMAS

cation even when inserted well downstream of ori vR= in pMYC2 1 l-2 14 (this paper) suggested that this may similarly be a result of changing the transcriptional environment. In order to determine the ways in which Tn 1723 insertion is likely to affect transcription in these mutants, we measured the strength of transcription emerging from each end of the transposon. In the promoter probe vector pKO6 (McKenney et al., 198 l), expression of the E. coli galK gene is dependent on transcription emerging from fragments inserted 5’ to the gene, the strength of such transcription being quantifiable by measuring the level of galactokinase enzyme activity produced. The EcoRI fragment of Tn1723 (i.e., Tn1723 minus 15 bp from each end) was inserted into pK06 in either orientation, immediately upstream of the gulK gene. Assays of galactokinase production from cells carrying these plasmids relative to cells carrying pKO6 revealed negligible transcription (-0.3 units) emerging from the end of the transposon carrying the transposition genes, but significant transcription (6.4 units) emerging from the end carrying the Km’ gene. In the mutants pMYC2 11-2 14 this would correspond to transcription reading towards ori&= in a direction opposite to that of replication. This observation, along with preliminary experiments that reveal no detectable transcription reading back through oriVRkZ in pMYC2 (M. A. Cross, unpublished results), is consistent with the suggestion that such transcription may be responsible for blocking replication in pMYC211-214. The Eflects on a Minireplicon Transcription into ori VR,

of Directing

To test more directly the inhibitory effect of transcription back through oriVRW, we constructed a plasmid (pSRW1, Fig. 4) in which an EcoRI fragment carrying the Tc’ genes from a Tn 1723 mutant of pCT87 (Thomas, 198 lb; Shingler and Thomas, 1984a), was inserted at a point about 300 bp downstream of ori VR,, in the hybrid ColE 1/mini

ANALYSIS

OF THE oriV REGION OF RK2

141

b

HIndI

FIG. 4. Plasmids used in experiments to determine the effects of transcription reading into the oriV, region on minireplicon establishment in E. coli, and the effect of inducing this transcription on subsequent yields of plasmid DNA from cultures of transformed cells. a. In pSRW1, the Tc’ genes from a Tn1723 mutant of pCT87 (Thomas, 1981b, Shingler and Thomas, 1984) were inserted into the EcoRI site of the hybrid ColEl/mini-RK2 replicon pCT4.3, such that induction with tetracycline would repress the teti promoter and result in transcription reading into the end of oriV RK~from which the replication fork emerges, Plasmid pSRW2 contains the same Tti genes inserted in the opposite orientation. The arrow indicates the point of insertion of an IS IO-like element into pSRW 1, resulting in plasmid pSRW3. b. Plasmid pCT480 is an EcoRI hybrid of the mini-R6K replicon pRK353 and the pMBl-replicon pAT153, with an EcoRI fragment carrying the pnr locus of pSClO1 inserted at the EcoRI site between the pAT153 Tc’ genes and the pRK353 trpE gene. This plasmid specifies resistance to penicillin and tetracycline, and is compatible with RK2. c. The yield of plasmid DNA from overnight cultures of E. coli C2 110 containing pSRW 1 and/ or pCT480 inoculated into L broth containing various concentrations of tetracycline. Lanes 1 and 2 show EcoRI digested DNA of pSRW 1 and pCT480 respectively, for reference purposes. The remaining samples are from overnight cultures of cells which initially contained both plasmids, grown in broth with tetracycline included at 4 X 10m6g ml-‘, lane 3; 2 X 10e6 g ml-i, lane 4; 1 X low6 g ml-i, lane 5; 7 X IO-’ g ml-‘, lane 6; 5 x IO-’ g ml-‘, lane 7; 2.5 X lo-’ g ml-‘, lane 8; 1 X IO-’ g ml-‘, lane 9: 5 X lo-* g ml-‘, lane 10; 2.5 X lo-* g ml-‘, lane 11; and no tetracycline, lane 12.

replicon pCT4.3 (Thomas et al., 1980), such that induction with low concentrations of tetracycline should promote transcription reading towards the origin region. A second plasmid (pSRW2) carried this same EcoRI fragment in the opposite orientation.

RK2

When these plasmids were transformed separately into E. coli C2110 (which is incapable of supporting ColE 1-directed replication) selecting Km’ only, both pSRW1 and pSRW2 were established at a frequency of approximately 2 X 1O4transformants per micro-

142

CROSS, WARNE, AND THOMAS

gram DNA (Table 4). The same transformation procedure followed instead by selection for Tc’ yielded the same efficiency of establishment of pSRW2, but an approximately 103-fold decrease in establishment of pSRW 1, which produced only a few small colonies (eight in total) after prolonged incubation. Two of these appeared to revertents of the host strain to PolA+. Examination of plasmid DNA from the other six colonies showed the resident plasmid to consist of pSRW 1 with a small insertion between oriVRKz and the Tc’ genes. In the clone which was characterized further the extra DNA consists of 1350 bp and contains a HincII site, both characteristics of the IS10 element (Foster et al., 198 1). This new plasmid (pSRW3) was found to transform E. coli C2110 to either Km’ or Tc’ at a frequency comparable to that obtained using pSRW2, most probably as a result of the inserted sequence blocking the previous disabling effect of Tc’ induction on oriVRK2 function. The observation that pSRW3 transformants of C2 110 grown under selection for Tc’ resulted in small colonies suggests that this blocking of inhibition was not complete. In further experiments, pSRW1 was cotransformed with a compatible plasmid (pCT480; Fig. 4b), which also carried Tc’ genes, into the poL4- E. cofi strain C2110. Since the maintenance of pCT480 is not affected by low levels of tetracycline, the growth rate of cotransformed cells should not vary TABLE 4 TRANSFORMATION FREQUENC~OF WITH pSRW 1, pSRW2, AND SELECIIONFORK~~ORTC'

E.coliC2 110 pSRW3 UNDER

Selection

Plasmid

Km’

Tc’

pSRW 1 pSRW2 pSRW3

2 x lo4 2x lo4 2 x lo4

Ob 2x IO4 2x lo&

a Colonies per wg DNA. b After prolonged incubation small colonies appeared at a frequency of approximately 10 pg-‘. c Small colonies.

with the concentration of tetracycline added to the medium. Cultures of E. coli C2 110 carrying both pSRW 1 and pCT480 were grown to stationary phase in broth containing tetracycline at various concentrations between 0 and 4.0 X 10e6 g ml-‘. Plasmid DNA was then prepared from these cultures, EcoRI digested and examined by electrophoresis on a 1% agarose gel. It can be seen from Fig. 4c that while the yield of pCT480 was independent of the concentration of tetracycline included in the growth medium, the yield of pSRW 1 was noticeably affected by the inclusion of tetracycline at concentrations greater than 2.5 X lo-’ g ml-‘, and was almost negligible from cultures containing 1.0 X 10e6 g ml-‘. This direct dependence of pSRW1 yield on tetracycline concentration provides further evidence that the inhibitory effect of the Tc’ genes on maintenance of pSRW 1 is a consequence of transcription reading back through the oriVm region. It also demonstrates that such transcription does not only prevent plasmid establishment following transformation, but will also cause rapid loss of a previously established plasmid from a cell line. DISCUSSION

In this study we have employed transposon mutagenesis of the oriVRK2 region using the 9.6kb transposon Tn 1723, followed by deletion of the inserted transposon to just 35 bp (ATn 1723), to generate two families of mutants which have enabled us to look in detail at the fUnCtiOna CkmentS of OriVRm in E. coli and Pseudomonas species. Whereas insertion of either Tn 1723 or ATn 1723 elements upstream of the previously defined HpaII ori (Fig. 1), or insertion of ATn1723 downstream of the G/C-rich region permits plasmid replication in E. coli C21 lOCh3/14, insertion of either element into or around the set of five direct repeats or into the A/T-rich region disrupts oriV& function. One possible role of the A/T-rich region may be to provide an area of weak interstrand association as a site for recruitment of DNA replication factors. The insertion into this region of ATn 1723, which

ANALYSIS

OF

THE

is 70% G/C-rich and highly pallindromic, may prevent strand dissociation. Alternatively, inhibition may be due to the imposition of unfavorable secondary structures at the DNA or RNA level. Direct repeat sequences of 17 to 22 bp are a common feature of the replication origins of many plasmids, including R6K (Stalker et al., 1979; 1982), F (Morotsu et al., 1981), pSClO1 (Churchward et al., 1983), Rtsl (Kamio et al., 1984), Xdv (Scherer, 1978; Grosschedl and Hobom, 1979), RI 162 (Meyer et al., 1985), and RK2 (Stalker et al., 1981; Waters et al., 1983). We report here that insertion of ATn 1723 into one, or between two of the five direct repeats, or just outside one end of this set of repeats completely abolishes detectable origin function in E. coli. It has recently been demonstrated that direct repeat sequences within the origin regions of R6K and pSC 10 1 are sites for the binding of plasmid-encoded replication proteins (Germino and Bastia, 1983; Vocke and Bastia, 1983; Bastia et al., 1985). Furthermore, point mutations within the direct repeats of R6K simultaneously decrease the binding of replication protein and inhibit replication, while point mutations close to the repeats result in a greatly reduced copy number (Filutowitz et al., 1985; McEachem et al., 1985). The inhibition of ori V,,, function by ATn 1723 insertion in and around the set of five direct repeats may then be a consequence of an inability of TrfA protein to interact successfully with repeat sequences that are altered internally, or in their relationship either to each other or to surrounding sequences. It remains to be seen whether origin function may be restored in RK2, as in R6K, by deletion of altered repeat sequences (McEachem et al., 1985). Some plasmids with Tn 1723 inserted outside the previously defined HpaII ori were also affected in their oriVn,&irected replication. The low frequency of E. coli C2 1 lOCh3/14 transformation by pMYC204 may reflect structural or transcriptional interference with intact HpaII ori sequences by the nearby Tn1723 insertion, or may imply a direct role in origin function of sequences between HpaII

oriV

REGION

OF

RK2

143

ori and the set of three repeats. At the opposite end of oriVRKz,the inhibition of origin function by Tn 1723 inserted up to 300 bp downstream was probably a consequence of the transcription reading from the transposon back toward the origin region. We have shown that such transcription supplied from the tetA promoter adversely affects the establishment and maintenance in E. coli of plasmids dependent on ori VR, function (this paper). This inhibition may result from disruption of interactions between DNA and replication factors; overproduction of a specific negative regulatory element comparable to the RNA1 or Rop protein of ColE 1 (Tomizawa et al., 198 1; Cesareni et al., 1982); or production of an RNA molecule complementary to a primer RNA which, while not being a normal regulatory factor, could nonetheless associate with the primer and disrupt a processing step. A similar inhibition of plasmid replication by transcription reading towards the origin region of oriC plasmids has been described (Tanaka and Higara, 1985). The fact that a single oriVRKzsegment is sufficient to direct replication in a variety of Gram negative bacteria (Schmidhauser and Helinski, 1985) indicates that RK2 does not need distinct loci for initiation of replication in different hosts. However, oriVRKZdoes not seem to function identically in all hosts: previous data, and more precise data presented here, show that the sequence determinants of origin function can differ between E. coli and Pseudomonasspecies. The difference is defined here by a ATn1723 insertion just upstream from the first of the set of five direct repeats, which abolished detectable establishment of the plasmid following transformation into E. coli C2 11OCh3/ 14, but permitted establishment at a reduced efficiency in P. aeruginosu PA01 16 1. This indicates that the function fulfilled in E. coli by sequences in this region is either dispensable to origin function in P. aeruginosu, or is not completely inactivated by the ATn1723 insertion in this host. The nature of this function is unknown. It is possible that transcription of a primer RNA may start in, or read through this region, and that

144

CROSS. WARNE. AND THOMAS

the requirements for transcription in P. aeruginosa are sufficiently different to those in E. coli to allow some transcriptional activity in the former species. However, the ATn1723 insertion in pMYC205.1 appears to have neither interrupted nor created any Pseudomonas promoter, or E. coli promoter or terminatorlike sequences. A second possibility is that the ATn 1723 insertion adversely affects a product of this region, perhaps by interfering with the secondary structure of a primer RNA such that subsequent processing steps are blocked in E. coli but not in P. aeruginosa. One final possibility concerns the suggested role of the repeat sequences as binding sites for replication proteins. If host factors required for replication are also involved in this complex, then the ATn 1723 insertion near to the five direct repeats may interfere strongly with the association of certain replication factors of E. coli, but to a lesser extent with the analogous factors of P. aeruginosa. Whatever the explanation for the host range characteristics of plasmids carrying this mutation, it is interesting to note that the attempted transformation of P. putidu 2440 using pMYC305 was unsuccessful under these conditions, suggesting a difference between the plasmid replication systems in P. aeruginosa and P. putidu species. Similar results have been noted for a Tn7 insertion mutant of the oriV region of R 18 (Cowan and Krishnapillai, 1982; Krishnapillai et al., 1984) which resulted in a plasmid unaffected in its ability to transform P. aeruginosa PA08, while being almost incapable of establishment in E. coli CW2438, and yielding only small transformant colonies of P. putida PPN 102 1. In this case however, although the Tn7 insertion appears to be in the same region as the ATn1723 insertion in pMYC305, the exact site of insertion is unclear, and the possible effects of transposonderived transcription can not be ruled out. The range of ATn 1723 insertion mutations reported here, and the additional EcoRI restriction sites associated with them, should now enable further dissection of the elements involved in oriVRK2 function and regulation both in E. coli and other species.

ACKNOWLEDGMENTS We thank Dr. H. Howell and Mrs. C. Price for media preparation, Mrs. E. Badger for typing the manuscript, and Mr. B. S. Price for help in preparing the figures. M. A. Cross is the recipient of an SERC studentship award, and S. R. Warne of an SERC/CASE award in collaboration with G. D. Searle. This work was financed in part by MRC project Grants G80/0374/9CB and G83/0983/8CB awarded to C. M. Thomas.

REFERENCES BAODASARIAN, M., LUIZ, R., R&KERT, B., FRANKLIN, F. C. H., BAGDASARIAN, M. M., FREY,J., ANDTIMMIS, K. N. ( 198 1). Specific-purpose plasmid cloning vectors. II. Broad host range, high copy number, RSFlOlO-derived vectors, and a host vector system for gene cloning in Pseudomonas. Gene 16,237-247. BASTIA, D., VOCKE, C., GERMINO, J., AND GRAY, J. (1985). DNA-protein interactions at the replication origins ofplasmid chromosome. In “Plasmids in Baetetia” (D. R. Helinski, S. N. Cohen, D. B. Clewell, D. A. Jackson, and A. Hollaender, eds.), pp. 397-414. Plenum, New York/London. BERINGER, J. E. (1974). R factor transfer in Rhizobium leguminosarum. J. Gen. Microbial. 84, 188-198. BIRNBOIM, H. C., AND DOLY, J. (1979). A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res. I, 15 13- 1523. BURKARDT, H. J., RIESS, G., AND ~~HLER, A. (1979). Relationship of group PI plasmids revealed by heteroduplex experiments: RPl , RP4, R68 and RK2 are identical. J. Gen. Microbial. 114, 341-348. CARLTON, B. C., AND BROWN, B. J. (198 1). Gene mutation. In “Manual of methods for general bacteriology” (P. Gerhardt, R. G. E. Murray, R. N. CostiIow, E. W. Nester, W. A. Wood, N. R. Krieg, and G. B. Philips, eds.). Amer. Sot. for Microbiology, Washington, D.C. CESARENI,G., MUESING, M. A., AND POLISKY, P. (1982). Control of ColE 1 DNA replication: The rap gene product negatively affectstranscription from the replication primer promoter. Proc. Natl. Acad. Sci. USA 79,63 136317. CHANG, A. C. Y ., AND COHEN, S. N. ( 1978). Construction and characterisation of amplifiable multicopy DNA cloning vehicles derived from the PlSa cryptic miniplasmid. J. Bacterial. 134, 1141-l 156. CHO, J. J., PANOPOULOS, N. J., AND %HROTH, M. N. (1975). Genetic transfer of Pseudomonas aeruginosa R factors to plant pathogenic Etwina species.J. Bacterial. 112, 192-198. CHURCHWARD, G., LINDER, P., AND CARO, L. (1983). The nucleotide sequence of replication and maintenance functions encoded by plasmid pSClO1. Nucleic Acids Res. 11,5645-5659. COWAN, P., AND KRISHNAPUAI, V. (1982). Tn7 insertion mutations affecting the host range of the promiscuous IncP-1 plasmid R18. Plasmid8, 164-174.

ANALYSIS

OF THE oriV REGION OF RK2

DATTA, N., AND HEDGES, R. W. (1972). Host range of R factors. J. Gen. Microbial. 70,453-460. FIGURSKI, D. H., POHLMAN, R. F., BECHHOFER,D. H., PRINCE, A. S., AND KELTON, C. A. (1982). The broad host range plasmid RK2 encodes multiple kil genes potentially lethal to E. coli host cells. Proc. Nat/ Acad. Sci. USA 79, 1935-1939. FILUTOWITZ, M., MCEACHERN, M., GREENER, A., MuKHOPADHAY, P., UHLENHOPP, E., DURLAND, R., AND HELINSKI, D. (1985). Role of the rr initiation protein and direct nucleotide sequence repeats in the regulation of plasmid R6K replication. In “Plasmids in Bacteria” (D. R. Helinski, S. N. Cohen, D. B. Clewell, D. A. Jackson, A. Hollaender, eds.), pp. 125-140. Plenum, New York/London. FOSTER, T., DAVIS, M. A., TAKESHITA, K., ROBERTS, D. E., AND KLECKNER, N. (198 1). Genetic organisation of transposon Tn 10. Cell 23,2 15-2 17. GERMINO, J., AND BASTIA, D. (1983a). The replication initiator protein of plasmid R6K tagged with &galactosidase shows sequence-specific DNA-binding. Cell 32, 131-140. GERMINO, J., AND BASTIA, D. (1983b). Interaction of the plasmid R6Kencoded replication initiator protein with its binding site on DNA. Cell 34, 125-134. GROSSCHEDL, R., AND HOF~OM, G. (1979). DNA sequences and structural homologies of the replication origins of lambdoid bacteriophages. Nature (London) 277,62

l-627.

ITOH, T., AND TOMIZAWA, J. (1980). Formation of an RNA primer for initiation of replication of ColEl DNA by ribonuclease H. Proc. Natl. Acad. Sci. USA 77,24502454.

KAHN, M., KOLTER, R., THOMAS, C., FIGuRSKI, D., MEYER, R., RENAUT, E., AND HELINSKI, D. R. (1979). Plasmid cloning vehicles derived from plasmids ColE 1, F, R6K and RK2. In “Methods in Enzymology” Vol. 68, pp. 268-280. Academic Press, Orlando, Fla. KAMIO, Y., TABUCHI, A., ITOH, Y., KATAGIFU, H., AND TERAWAKI, Y. (1984). Complete nucleotide sequence of mini Rtsl and its copy mutant. J. Bacterial. 158, 307-3

12.

KRISHNAPILLAI, V., NASH, J., AND LANKA, E. (I 984). Insertion mutants in the promiscuous IncP- 1 plasmid R18 which a&t its host range between Pseudomonas species. Plasmid 12, 170- 180. LANKA, E., Luaz, R., AND ~RSTE, J. P. ( 1983). Molecular cloning and mapping of SphI restriction fragments of RP4. Plasmid 10,303-307. MAXAM, A. M., AND GILBERT, W. (1980). Sequencing end-lab&d DNA with base-specific chemical cleavage. In “Methods in Enzymology” (L. Grossman and K. Moldave, eds.), Vol. 65, pp. 449-560. Academic Press, Orlando, Fla. MCEACHERN, M. J., FILUTOWITZ, M., AND HELINSKI, D. R. (1985). Mutations in direct repeat sequences and in a conserved sequence adjacent to the repeats result in a defective replication origin in plasmid R6K. Proc. Natl. Acad. Sci. USA 82, 1480-1484.

145

MCKENNEY, K., SHIMATAKE, H., COURT, D., SCHMEISNER, U., BRADY, C., AND ROSENBERG,M. (1981). A systemto study promoter and terminator signals recognised by Escherichia co/i RNA polyermase. In “Gene Amplification and Analysis,” Vol. II, “Analysis of Nucleic Acids by Enzymatic Methods” (J. C. Chirikjian, and T. S. Papas, eds.), pp. 383-415. Elsevier/NorthHolland, Amsterdam. MEYER, R. J., F~GURSKI,D., AND HELINSKI, D. R. ( 1977). Physical and genetic studies with restriction endonucleaseson the broad host range plasmid RK2. Mol. Gen. Genet. 152, 129-135. MEYER, R. J., ANDHELINSKI, D. R. (1977). Unidirectional replication of the P group plasmid RK2. Biochim. Biophys. Acta 478, 109- 113. MEYER, R. J., LIN, L., KIM, K., AND BRASCH, M. A. (1985). Broad host range plasmid Rl162: replication, incompatibility and copy number control. In “Plasmids in Bacteria” (D. R. Helinski, S. N. Cohen, D. B. Clewell, D. A. Jackson, and A. Hollaender, eds.), pp. 173-188. Plenum, New York/London. MUROTSU, T., MATSUBARA, K., SUGISAKI, H., ANDTAKANAMI, M. (198 1). Nine unique repeating sequences in a region essential for replication and incompatibility of the mini F plasmid. Gene 15,257-271. OLSEN, R. H., AND SHIPLEY, P. (1973). Host range and properties of the Pseudomonas aentginosa R factor R1822. J. Bacterial. 113, 772-780. SCHERER,G. (1978). Nucleotide sequence of the 0 gene and of the origin of replication in bacteriophage X DNA. Nucleic Acids Res. 5, 3 14 l-3 156. SCHMIDHAUSER,T. J., AND HELINSKI, D. R. (1985). Host range replication and maintenance determinants of IncP plasmid RK2. In “Plasmids in Bacteria” (D. R. Helinski, S. N. Cohen, D. B. Clewell, D. A. Jackson, and A. Hollaender, eds.), p. 874. Plenum, New York/London. SZHMIDHAUSER,

T. J., FILUTOWITZ,

M., AND HELINSKI,

D. R. (1983). Replication of derivatives of the broad host range plasmid RK2 in two distantly related bacteria. Pfasmid 9,235-330. SCHMITT, R., BERNHARDT, E., AND MATTES, R. (1979). Characterisation of Tn 172 1, a new transposon containing tetracycline resistance genes capable of amplification. Mol. Gen. Genet. 172, 53-65. SHINGLER, V., AND THOMAS, C. M. (1984a). Analysis of the trfA region of broad host range plasmid RK2 by transposon mutagenesis and identification of polypep tide products. J. Mol. Biol. 175,229-249. SHINGLER,V., AND THOMAS, C. M. (1984b). Transcription in the trfA region of broad host range plasmid RK2 is regulated by tr$B and korB. Mol. Gen. Genet. 195,523529. SMITH, C.

A., ANDTHOMAS, C. M. (1983). Deletion mapping of kiland kor functions in the trfA and trfB regions of broad host range plasmid RK2. Mol. Gen. Gener. 190,245-254.

STALKER, D. M., KOLTER, R., AND HELINSKI, D. R. (1979). Nucleotide sequence of the region of an origin

146

CROSS,

WARNE,

of replication of the antibiotic resistance plasmid R6K. Proc. Nat!. Acad. Sci. USA 76, 1150-l 154. STALKER, D. M., THOMAS, C. M., AND HELINSIU, D. R. (198 1). Nucleotide sequence of the region of the origin of replication of the broad host range plasmid RK2. Mol.

Gen. Genet. 181, 8-12.

STALKER, D. M., KOLTER, R., AND HELINSKI, D. R. (1982). Plasmid R6K DNA replication. I. Complete nucleotide sequence analysis of an autonomously replicating segment. J. Mol. Biol. 161, 33-43. TANAKA, M., AND HIGARA, S. (1985). Negative control of oriC plasmid replication by transcription of the oriC region.

Mol.

Gen. Genet. 200,2

l-26.

THOMAS, C. M. (198 la). Molecular genetics of broad host range plasmid RK2. Plasmid 5, 10-19. THOMAS, C. M. (198 1b). Complementation analysis of replication and maintenance functions of broad host range plasmid RK2 and RPl. Plasmid 5, 277-29 I. THOMAS, C. M., CROSS,M. A., HUSSAIN, A. A. K., AND SMITH, C. A. (1984). Analysis of copy number control elements in the region of the vegetative replication origin of the broad host range plasmid RK2. EMBO J. 3,5763.

AND THOMAS THOMAS, C. M., AND HUSSAIN,A. A. K. (1984). The korB gene of broad host range plasmid RK2 is a major copy number control element which may act together with trfB by limiting tr$4expression. EMBO J. 3, 15 13-I 5 19. THOMAS, C. M., MEYER, R., AND HELINSKI, D. R. (1980). Regions of the broad host range plasmid RK2 essential for replication and maintenance. J. Bacterial. 141,2 13222.

THOMAS, C. M., STALKER, D. M., AND HELINSKI, D. R. (198 1). Replication and incompatibility properties of segments of the origin region of replication of the broad host range plasmid RK2. Mol. Gen. Genet. 181, l-7. TOMIZAWA, J., ITOH, T., SELZER,G., AND SOM, T. ( 198 1). Inhibition of ColEl primer formation by a plasmid specified small RNA. Proc. Natl. Acad. Sci. USA 78, 1421-1425. VOCKE, C., AND BASTIA, D. (1983). DNA-protein interaction at the origin of DNA replication of the plasmid pSCIO1. Cell 35,495-502. WATERS, S. H., ROGOWSKY, P., GRINSTED, J., ALTENBUCHNER,J., AND SCHMITT, R. (1983). The tetracycline resistance determinants of RP 1 and Tn 172 1: nucleotide sequence analysis. Nucleic Acids Res. l&6089-6 105.