Anti-phytopathogenic activity of Syzygium cumini essential oil, hydrocarbon fractions and its novel constituents

Industrial Crops and Products 74 (2015) 327–335

Contents lists available at ScienceDirect

Industrial Crops and Products journal homepage: www.elsevier.com/locate/indcrop

Anti-phytopathogenic activity of Syzygium cumini essential oil, hydrocarbon fractions and its novel constituents Arvind Saroj a , V.S. Pragadheesh b,c , Palanivelu c , Anju Yadav d , S.C. Singh e , A. Samad a , A.S. Negi f , C.S. Chanotiya b,c,d,∗ a

Department of Plant Pathology, Lucknow 226 015, India Academy of Scientific and Innovative Research, Lucknow 226 015, India c Laboratory of Aromatic Plants and Chiral Separation, Lucknow 226 015, India d Central Instrument Facility, Lucknow 226 015, India e Botany & Pharmacognosy Department, Lucknow 226 015, India f Medicinal Chemistry, CSIR-Central Institute of Medicinal and Aromatic Plants (CIMAP), Lucknow 226 015, India b

a r t i c l e

i n f o

Article history: Received 15 October 2014 Received in revised form 20 March 2015 Accepted 29 April 2015 Keywords: Syzygium cumini 7-acetoxycalamenene Solid-phase microextraction Antifungal activity Rhizoctonia solani AG 4HG-III

a b s t r a c t Current study aims to explore natural anti-phytopathogenic compounds for plant disease management. Syzygium cumini essential oil and its isolated compounds were screened for their antifungal assay against two phytopathogenic fungi, Rhizoctonia solani AG 4HG-III and Choanephora cucurbitarum. The chemical composition of oil the isolated oil was identified by gas chromatography and gas chromatography/mass spectrometry. Compounds such as 7-hydroxycalamenene, 7-acetoxycalamenene, 1-epi-cubenol, and ␣-terpineol showed an inhibition, ca. 95%, 80%, 76%, and 82%, respectively, against R. solani whereas 95%, 70%, 92%, and 100% against C. cucurbitarum in contact phase. In addition, high ocimene rich column fractions showed 70% and 87% inhibition against R. solani and C. cucurbitarum, respectively, in volatile phase. The findings of the present study suggest that the isolated 7-hydroxycalamenene, 7acetoxycalamenene, 1-epi-cubenol, ␣-terpineol, and (Z)-␤- & (E)-␤-ocimene have a potential to be used as antifungal agents for the effective control of fungal diseases in medicinal plants. We report 7-acetoxycalamenene as novel compound from natural source for first time. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Since last many decades, synthetic fungicides have been used to protect plants from fungal diseases and their fatal/ hazardous effect to ecosystem has been realized now. The use of synthetic fungicides may also leads to the development of resistant phytopathogens (Johnson et al., 1994; Ishii, 2006). Therefore, it is utmost requirement to explore and identify new natural substances, which possessed potential antifungal capabilities. Recently, several studies have shown essential oils as possible antifungal agents (Dutta et al., 2007; Chang et al., 2008; Vila et al., 2010; Pragadheesh et al., 2013a,b). Essential oils also have wide range of therapeutic use and applications in the field of cosmetic, pharmaceutical industry and

∗ Corresponding author at: Laboratory of Aromatic Plants and Chiral Separation, CSIR-Central Institute of Medicinal and Aromatic Plants, Lucknow 226 015, India. Tel.: +91 522 2718507; fax: +91 522 2716141. http://dx.doi.org/10.1016/j.indcrop.2015.04.065 0926-6690/© 2015 Elsevier B.V. All rights reserved.

agriculture. The source of the essential oils such as trees, shrubs and herbs are distributed globally and provides a solid platform for flavor and fragrance research. Syzygium cumini L. Skeels, (common name: Jamun) is mediumsized tree belongs to the family Myrtaceae. The medicinal properties of powdered seeds and stem-bark of S. cumini have been reported in the treatment of diabetes (Singh and Khanuja, 2006; Ayyanar et al., 2013). Previous studies have demonstrated that S. cumini essential oil has antioxidant (Elansary et al., 2012; Mohamed et al., 2013), antibacterial (Shafi et al., 2002), antifungal activity (Jabeen and Javaid, 2010; Badawy and Abdelgaleil, 2014), anti-ulcerogenic, anti-allergic, antiplasmodic, antitumor (Machado et al., 2013) and molluscicidal and leishmanicidal (Dias et al., 2013) properties. In addition, anti-Leishmania activity due to S. cumini essential oil and its major constituent ␣-pinene has been a recent addition in existing knowledge on its biological action (Rodrigues et al., 2015).

328

A. Saroj et al. / Industrial Crops and Products 74 (2015) 327–335

Essential oil of S. cumini leaves (Brazilian origin) contained ␣pinene (31.85%), (Z)-␤-ocimene (28.98%), (E)-␤-ocimene (11.71%) and literature revealed the presence of only monoterpenoids rich compositions (ca. 92.5%) so far in it (Dias et al., 2013). The Egyptian S. cumini plant contained ␣-pinene (17.26%), ␣-terpineol (13.88%) and ␤-pinene (11.28%) (Badawy and Abdelgaleil, 2014). In India, S. cumini leaves from south Indian habitat contained pinocarveol (15.1%), ␣-terpineol (8.9%), myrtenol (8.3%), eucarvone (6.6%), muurolol (6.4%), myrtenal (5.8%), geranyl acetone (5.6%), ␣-cadinol, and pinocarvone (4.4%) (Jirovetz et al., 1999) whereas fruits oil possessed cis-ocimene (29.95%), trans-ocimene (23.03%), ␤-myrcene (6.99%), and ␣-terpineol (6.46%) (Vijayanand et al., 2001). Furthermore, the north Indian leaves were dominated by ␣humulene (12.30%), ␤-caryophyllene (6.34%), ␣-terpineol (5.71%), cis-farnesol (5.04%) calacorene (4.43%), ␣-muurolol (4.28%), ␤selinene (4.19%), and ␣-santalol (3.55%) (Kumar et al., 2004). In contrary, the present work showed that S. cumini essential oil of Indian origin is not only a source for novel calamenene type sesquiterpenoids but also possesses good anti-fungal potential. Rhizoctonia solani Kühn (teleomorph: Thanatephorus cucumeris) is a destructive soil borne plant pathogen and affecting many agricultural crops throughout the world (Parmeter et al., 1969; Ogoshi, 1987). The fungus is well known to cause damping off, root rot, crown rot, and leaf blight to many economically important crops. In particular, it causes severe damping off of seedlings. In addition, R. solani AG 4 has also been known to cause Pyrethrum root rot (Alam et al., 2004), potato stem canker (Muzhinji et al., 2014), opium poppy collar rot (Sattar et al., 1999), and many more diseases on different crops. Another important and devastative fungal pathogen, Choanephora cucurbitarum has been reported as a causal agent for many serious diseases in Withania somnifera (Saroj et al., 2012), several members of Cucurbitaceae and Boerhavia diffusa (Babadoost and Zitter, 2009; Singh et al., 2011). Synthetic fungicides such as Blitox 50, Bavistin etc. are generally in use for the diseases management. The present study deals with the following objectives; (a) composition of S. cumini essential oil, (b) isolation and characterization of novel compounds, (c) isolation and characterization of causal organism of opium poppy collar rot, (d) comparison of antifungal potential of essential oil and its isolated compound in contact and volatile phase. 2. Materials and methods 2.1. Plant material S. cumini leaves were collected from the experimental farm of CSIR-CIMAP, Lucknow in the month of November, 2013. The specimens were submitted in the Taxonomy department of CSIR-CIMAP (Voucher No.: CIMAP, LKo.12926). 2.2. Phytopathogens 2.2.1. Isolation and characterization of plant pathogen R. solani During winter season of 2010, diseased opium poppy plants were observed with symptoms similar to collar rot (Sattar et al., 1999) at the experimental farm, CSIR-CIMAP, Lucknow, India. The infected plant parts were cut into small pieces; surface sterilized with 1% sodium hypochlorite, rinsed thrice with sterile distilled water and placed onto potato dextrose agar (PDA) plates. The plates were incubated at 25 ◦ C for 3 days. The isolation yielded only single type of fungal colony. Initially, fungal culture was brown that later turned into tan brown. Aniline blue stain was used for the microscopic studies of the fungus. However, to check the number of nuclei of fungal cell, which is important characterization

criteria for the identification of R. solani, bisbenzamide (Hoechst 33258; Chemical abstracts no. 23491-45-4) was used as fluorescent dye for the staining of nuclei. Anastomosis grouping of the fungus was determined by anastomosis reaction according to Hyakumachi (Hyakumachi et al., 2005). Agar disks of 5 mm diameter were cut from the periphery of 2–3 days old cultures of isolate on PDA and placed on sterilized glass slides coated with a very thin layer of 2% water agar. These disks were paired with tester strains of R. solani, AG 1 through AG 10. Slides were incubated at 25 ◦ C in the dark conditions. When the hyphae from the two disks were overlapping approx. after 48 h, they were stained with 0.5% aniline blue in lactophenol and examined microscopically to determine anastomosis reactions. Reactions were placed into one of four categories as per previous reports (Carling and Leiner, 1986; Carling, 1996). The identity of the fungus was also confirmed on molecular basis by the analysis of rDNA internal transcribed spacer region. The fungal culture was grown on PDA for 14 days at 27 ◦ C and scraped with a sterile spatula and crushed with the help of liquid nitrogen. DNA extraction procedure accorded to the instructions, which was given in the kit user’s manual DNeasy Plant Mini Kit (Qiagen)/NucleoSpin® DNA extraction Kit (MachereyNagel, Düren, Germany). The extracted DNA pellet was kept at −20 ◦ C. Two primers [ITS-1 (TCCGTAGGTGAACCTGCGG) (Qiagen) and ITS-4 (TCCTCCGCTTATTGATATGC) (Qiagen)] were used for the PCR amplification of the DNA region encoding 18S, ITS-1, 5.8S, ITS-2, and 28S rDNA (Saroj et al., 2013). Amplification was carried out in a 25 ␮l reaction mixture containing 2.5 ␮l Taq buffer, 1 ␮l dNTP, 0.8 ␮l primers IST1-forward and ITS4-reverse, 3 ␮l fungal genomic DNA, 0.5 ␮l Taq and 16.4 ␮l mili-q water. The PCR setting were, an initial denaturation at 94 ◦ C for 5 min followed by 30 cycles of 94 ◦ C for 1 min, 50 ◦ C for 2 min, and 72 ◦ C for 3 min, and a final extension at 72 ◦ C for 7 min. The PCR product was electrophoresed in a 1.2% agarose gel along with ␭ DNA ladder marker (Invitrogen, Barcelona, Spain) and visualized under UV light. The amplified product was cloned in pGEM-T vector (Promega) as per manufacturer instructions. The selection of right insert with correct orientation was done via restriction enzyme EcoRI giving amplicons of approximately 700 bp. The sample was sequenced at CSIR-CIMAP with ABI sequencer model 3730 (PerkinElmer) using the universal primers ITS1F/ITS4R. Phylogeny studies have shown that species with similar morphological characteristics may consider in variation in evolutionary relationship (Crouch et al., 2009). For phylogenetic analysis, the sequence data of the rDNA ITS of known R. solani AG 1 (KF907718), AG 2 (HQ404662), AG 3 (KC590579), AG 4 (HQ185374) AG 4 (JQ669932), AG 5 (KC997795), AG 6 (AF354103), AG 7 (AF354100), AG 8 (AF354069), and AG 9 (AF354109) were used. A multiple sequence alignment of all sequences were initially carried out by Clustal W algorithm in MEGA version 6 (Tamura et al., 2013). Study of sequence divergence was done using Kimura-2 parameter (K2P) distance (Kimura, 1980). Phylogenetic tree was generated by neighbor-joining (NJ) method (Saitou and Nei, 1987) using MEGA 6. The reliability of the inferred tree was estimated by bootstrap analysis (Felsenstein, 1985). Pathogenicity test was performed with isolated pathogen to confirm Koch’s postulate. The inoculum of the fungus was prepared on sterile maize seeds in Erlen Mayer flasks by inoculating seeds with 3 disks (1 mm) of 7-days old culture and kept at 27 ± 2 ◦ C for 14 days in dark condition. The healthy, 25–30 days old plants were inoculated with 10 artificially infested maize seeds per pot. The uninoculated plants served as control. Both inoculated and un-inoculated plants were kept at 28 ±2 ◦ C under 95% humidity for 3 days and thereafter placed in the glasshouse at 28± 2 ◦ C for development of disease symptoms.

A. Saroj et al. / Industrial Crops and Products 74 (2015) 327–335

2.2.2. Choanephora cucurbitarum C. cucurbitarum, casual organism of Withania wet rot was isolated from diseased W. somnifera plant (Saroj et al., 2012). 2.3. Isolation of essential oils The fresh leaves of S. cumini (1 kg) were washed with water and hydrodistilled with 5 liters of distilled water in a Clevenger-type apparatus for 4 h. The essential oils were dried over anhydrous Na2 SO4 and stored at 4 ◦ C prior to analysis. The yield of the essential oil was 0.05% (w/w).

329

2.7. Specific rotation and FT-IR measurement Specific rotation of isolated compounds was measured on Horiba Sepa-300 high sensitive digital polarimeter at 589 nm. About 1 mg of the liquid sample was dissolved in CCl4 and spreaded over KBr plate as a thin film whereas approx. 3 mg of solid sample added to spectroscopy grade KBr powder for making a pellet. The spectrum was recorded at room temperature in the wavelength between 4000 cm−1 and 650 cm−1 using PerkinElmer spectrum BX FT-IR spectrophotometer. 2.8. Antifungal assay

2.4. GC and GC/MS analysis of essential oil and its column fractions GC analysis was done using Equity-5 capillary column (60 m × 0.32 mm i.d., film thickness is 0.25 ␮m) on PerkinElmer AutoSystem XL gas chromatograph. The column oven was programmed from 70 ◦ C with initial hold time of 2 min to 250 ◦ C for 2 min. at the rate of 3 ◦ C/min; to 290 ◦ C at rate of 6 ◦ C/min with final hold time of 5 min. H2 gas was used as a carrier gas at 10 psi constant pressure with the split ratio of 1:35. S/SL Injector and the detector (FID) temperatures were 290 ◦ C and 280 ◦ C, respectively. GC–MS utilized a PerkinElmer Clarus 680 GC interfaced with a Clarus SQ 8C mass spectrometer fitted with an Elite-5MS fused silica capillary column (30 m × 0.25 mm i.d., film thickness 0.25 ␮m; PerkinElmer Life and Analytical Sciences, Shelton, CT, USA). The oven temperature program ranged from 60 ◦ C to 200 ◦ C, at the rate of 3 ◦ C/min and upto 300 ◦ C at the rate of 7 ◦ C/min with final hold time of 9 min. Carrier gas used was He at 1 mL/min constant flow with split ratio of 1:50; injector, transfer line and source temperatures were 250 ◦ C; ionization energy was 70 eV; mass scan range 40–450 amu. Characterization was achieved on the basis of retention time, elution order, relative retention index using a homologous series of n-alkanes (C8 –C25 hydrocarbons, Polyscience Corp., Niles, IL), co-injection with standards in a GC-FID capillary column supplied from Aldrich and Fluka, mass spectra library search (NIST/EPA/NIH version 2.1 and Wiley registry of mass spectral data 7th edition) and by comparing with mass spectral literature data (Adams, 2006). The presence of 7-acetoxycalamanene in the essential oils was identified by mass spectral fragmentation, retention time and retention index value and confirmed by extensive NMR experiments of an acetylated product of 7hydroxycalamenene. 2.5. Isolation of compounds The oil was first fractionated by column chromatography (CC) on silica gel 230–400 mesh (Merck) with hexane/ethyl acetate. Further, isolation and purification of the CC fractions was based on their thin layer chromatography pattern. The least polar fractions (1–3) consisting mostly of the hydrocarbons were subjected to GCFID analysis followed by antifungal activity test. The polar column fractions, primarily consisting of the alcohols, were resolved with hexane: ethyl acetate 80:20 as solvent system. 2.6. NMR experiment Bruker Avance-300 Instrument was utilized for 1 H (300 MHz), NMR (75 MHz), DEPT 90/135, COSY, HBQC, HMBC experiments using Tetramethylsilane (TMS) as an internal standard. About 30 mg each of 7-hydroxycalamenene, 7-acetoxycalamenene, and 1-epi-cubenol were dissolved in CDCl3 and spectral data were recorded. Chemical shifts are reported in ppm units (multicipility: s-singlet; d-doublet; q-quartet; m-multiplet; br-broad). 13 C

2.8.1. Drop diffusion assay (volatile phase) In the present study, drop diffusion method was used instead of well known agar disk diffusion technique to assay essential oils for antimicrobial activity (Pragadheesh et al., 2013a). A 15 ml PDA was poured in 90 mm glass Petri-plate. The 5 mm disc of 5 days old culture of phytopathogens was placed in the center of PDA plate. Thereafter, a known amount (2, 5, 10, and 15 ␮l) of S. cumini essential oil, its monoterpene rich column fractions no.1-3, 7-hydroxycalamenene, 7-acetoxycalamenene, 1epi-cubenol, ␣-terpineol, and standard compounds like ␣-pinene, limonene, p-cymene were introduced onto the inner side of each Petri-plate cover and sealed by parafilm immediately. Plates were incubated at 25 ◦ C. The growth of the fungus was monitored and measured at an interval of three hours up to 24 h for C. cucurbitarum and up to 48 h in case of R. solani. Experiment was repeated twice in triplicates. 2.8.2. Poison food technique (Contact phase) In general, the antifungal activity through contact phase is determined by poisoned food technique (PFT) (Grover and Moore, 1962; Knobloch et al., 1989; Nene and Thapliyal, 2002). A 5 mm disc of each fungus (C. cucurbitarum and R. solani) was centered on the PDA plates. The agar plates have been prepared by adding different concentrations (0.2, 0.5, 1.0, 1.5, and 2.0 mg/mL) of essential oil, its fractions 1–3, ␣-terpineol, 1-epi-cubenol, 7-hydroxycalamenene, 7-acetoxycalamenene, and standards such as limonene, ␣-pinene, para-cymene into the PDA at 40–45 ◦ C. In order to ensure proper mixing of essential oil with media, 0.05% Tween-80 was used. Thereafter, all Petri-plates were incubated at 25 ◦ C for 24 h in case of C. cucurbitarum and 48 h for R. solani. Plates without essential oil/ fractions/standards served as a control. Percentage growth inhibition of each fungus was evaluated by the comparison of culture diameter in between poisoned and non poisoned Petri-plates. Experiment was repeated twice in triplicates. Minimum inhibitory concentration (MIC) was calculated using PFT. Percentage of the colony inhibition was calculated by the formula given as under: % of the growth inhibition =

(Growth in control − growth intreatment) × 100 (Growth in control)

2.9. SPME-GC-FID analysis of headspace of Petri-plate To assess the volatility pattern of constituents in volatile assay, the headspace of each Petri-plate containing essential oil and fractions 1–3 was studied through solid-phase microextraction technique coupled with GC i.e., SPME-GC-FID (Pragadheesh et al., 2013a). The emitted volatiles in the headspace of experimental Petri-plate were extracted using a 50/30 ␮m divinylbenzene/carboxen/polydimethylsiloxane SPME fiber (Supelco, USA) followed by desorption in heated injector of gas chromatographic system. For GC/MS, analysis was carried out as per the conditions mentioned in Section 2.4.

330

A. Saroj et al. / Industrial Crops and Products 74 (2015) 327–335

OH

3.4. Characterization of 1-epi-cubenol (1)

AcO

HO

7

7

H

1

OH

2

3

4

Fig. 1. Compounds (1) 1-epi-cubenol, (2) 7-Hydroxycalamenene, (3) 7acetoxycalamenene and (4) ␣-terpineol characterized in Syzygium cumini essential oil.

[˛]D 20 = −120.604◦ (c 0.0080, CHCl3 ); MS m/z (%BPI): 222[M+] (0.1), 207 (2.5), 204 (30.6), 179 (20.7), 161 (72.2), 119 (100), 105(66.6), 95 (28.7), 93 (32.2), 91 (32.1), 82 (46.6), 81 (44.2), 79 (38.4), 77 (27.7), 69 (32.1), 55 (26), 43(32.7), 41 (40.7). 1 H NMR (300 MHz, CDCl3 ): ı 0.81, 0.88, 0.97, 1.70 (each 3H, s, Me x 4), 5.45 (1H, br s). 13 C NMR (75 MHz, CDCl3 ): ı 72.67 (C-1), 26.73 (C-2), 31.19 (C-3), 133.84 (C-4), 122.16 (C-5), 41.96 (C-6), 49.29 (C-7), 22.06 (C-8), 24.11 (C-9), 48.14 (C-10), 26.94 (C-11), 21.61 (C-12), 15.24 (C-13), 15.15 (C-14), 23.58 (C-15). 1 H NMR and 13 C NMR spectral data were identical to those of published work for 1-epi-cubenol (Weyerstahl et al., 1998).

3. Results and discussion 3.5. Characterization of 7-hydroxycalamenene (2) 3.1. Essential oil composition of S. cumini leaf The identified essential oil constituents have been listed in Table 1. A total of 93.6% of identified constituents attributed to 69.8% mono- and 23.8% sesquiterpenoids class. Constituents such as ␣-pinene (17.2%), ␤-pinene (8.6%), ␤-myrcene (5.4%), limonene (4.3%), (Z)-␤-ocimene (10.9%), (E)-␤-ocimene (9.6%) and ␣-terpineol (3.9%; 4) were identified as major monoterpenoids. The sesquiterpenoids recorded were ␣-copaene (3.2%), ı-cadinene (7.5%), 1-epi-cubenol (1.5%; 1) and 7-hydroxycalamenene (1.4%; 2). 7-Acetoxycalamenene (0.1%; 3) has not been reported from natural source so far (Fig. 1). Further, the structure was confirmed by derivatization of 7-hydroxycalamenene, extensive NMR experiments and comparison of mass spectral pattern of compound 2 and 3 at 70 eV under electron ionization. Chemical investigation on diseased mature specimen of Tilia europea (Burden and Kemp, 1983), Heritiera ornithocephala (Cambie et al., 1990), cultured cell of liverworts Heteroscyphus planus (Nabeta et al., 1993), S. cumini seed extracts (Sikder et al., 2012) and Croton cajucara essential oil (Azevedo et al., 2013) have revealed the presence of 7-hydroxycalamenene as a natural constituents. In contrary to the work of Sikder et al. (2012) we report herein the correct molecular weight of 7-hydroxycalamenene (2). Further, our finding has been well supported by a previous work (Nabeta et al., 1993).

3.2. Composition of S. cumini essential oil column fractions Terpene fractions (Fr#1 to Fr#3) of S. cumini essential oil, eluted in 100% hexane as a solvent system in column chromatography were investigated. Fraction 1 was marked by high pinene proportions: ␣-pinene (31.9%) and ␤-pinene (14%) (Table 1), whereas fractions 2 and 3 contained highest ocimene content of 21% and 36.9%, respectively.

3.3. Isolation of 7-hydroxycalamenene, 1-epi-cubenol, and ˛-terpineol 7-Hydroxycalamenene, 1-epi-cubenol, and ␣-terpineol were isolated and characterized from S. cumini leaf essential oil. About 5.242 g of S. cumini essential oil was subjected to column chromatographic separation using 230–400 mesh silica gels in hexane/ethyl acetate solvent system. Initially, column was eluted with 100% hexane and the concentration of ethyl acetate was increased up to 10% in hexane. 1-epi-Cubenol was eluted at 4% ethyl acetate in hexane followed by 7-hydroxycalamanene, which eluted in 5% ethyl acetate. The purity percentage of isolated compounds viz., 1-epicubenol, 7-hydroxycalamenene, and ␣-terpineol in GC-FID was 85, 96, and 86%, respectively.

[˛]D 20 = −22.727◦ (c 0.0055, CHCl3 ). IR ( max, cm−1 , CCl4 ): 3393, 1618, 1503, 1459, 1411, 1260, 1183, 886. MS m/z (%BPI): 218[M+] (5.6), 199(3.1), 175(100), 160(12.4), 147(8.6), 128(5.5), 121(5.4), 115(8.7), 105(3.8), 91(6.9), 77(5.1), 65(2.5), 53(2.2), 43(8.2). The structure was confirmed by extensive 1 H NMR, 13 C NMR, and DEPT, COSY, HMBC, HSQC, and MS (Table 2). The 1 H NMR and 13 C NMR data were identical to those of published work (Nabeta et al., 1993). 3.6. Acetylation of 7-hydroxycalamenene Compound 7-hydroxycalamenene (2, 10 mg, 0.046 mmol) was stirred in dry chloroform (5 ml). To this mixture, 4-N,Ndimethylaminopyridine (10 mg) and acetic anhydride (0.1 ml) were added and was stirred for 3 h. Thin layer chromatography was used to check completion of reaction. On reaction completion, water (10 ml) was added to this reaction mixture. Organic layer was acidified with 1 ml of 10% HCl. Chloroform layer was washed with water, dried over anhydrous sodium sulphate and evaporated in rotary evaporator. The acetylated product 7-acetoxycalamenene (3) was obtained as liquid with 92% purity in GC-FID. 3.7. Characterization of 7-acetoxycalamenene (3) [˛]D 24 = −69.791◦ (c 0.0032, CHCl3 ). IR ( max, cm−1 , CCl4 ): 1761(ester C O), 1577, 1498, 1460, 1369, 1213, 1089, 910, 802. MS m/z (%BPI): 217(4.4), 175(100), 160(4.1), 147(2.4), 131(2.5), 128(2.3), 121(2.6), 115(3.7), 105(2.1), 91(2.5), 77(1.3), 65(1.0), 53(1.0), 43(5.6). The structure was confirmed by extensive 1 H NMR, 13 C NMR, DEPT, COSY, HMBC, HSQC experiments (Table 2). 3.8. Characterization of ˛-terpineol (4) [˛]D 24 = −62.21◦ (c 0.045, CHCl3 ). IR ( max, cm−1 , CCl4 ): 3394, 2964, 2926, 1654, 1458, 1448, 1438, 1376, 1364, 1157, 1133, 922. MS m/z (%BPI): 154[M+], 139 (4.1), 136 (25.2), 121 (39.2), 107(7.3), 95 (9.1), 93 (39.5), 92 (11.3), 91 (8.4), 81 (21.9), 79 (11.2), 68 (16), 67 (19.7), 59 (100), 55 (12), 43(19.7), 41 (11). The compound was confirmed by its elution order in equity-5 capillary column, retention index and mass spectral comparison with standard ␣-terpineol (Adams, 2006). 3.9. Characterization of opium poppy collar rot pathogen Microscopic study revealed that the isolated pathogen possessed peculiar characteristic features of R. solani such as tendency of mycelium to branch at right angles with basal constriction and multinucleate. Anastamosis testing with known R. solani tester strains revealed that fungus belongs to R. solani AG 4.

A. Saroj et al. / Industrial Crops and Products 74 (2015) 327–335

331

Table 1 Relative compositions of S. cumini essential oil and its hydrocarbon fractions. RI(obs)

RI(rep)

917 924 932 927 942 945 944 946 974 981 988 992 1002 1009 1014 1020 1027 1020 1032 1024 1032 1025 1032 1038 1044 1048 1052 1061 1092 1086 1095 1094 1114 1118 1128 1130 1145 1154 1165 1171 1182 1174 1186 1185 1218 1214 1287 1280 1374 1382 1415 1409 1417 1425 1444 1437 1445 1439 1455 1452 1466 1458 1474 1471 1477 1475 1480 1478 1484 1483 1496 1491 1496 1494 1500 1498 1502 1501 1504 1500 1513 1518 1528 1521 1531 1528 1539 – 1544 1544 1582 1591 1599 1590 1592 1601 1600 1608 1602 1611 1608 1617 – 1630 1627 1634 1638 1649 1644 1652 1652 1658 1658 1662 – 1793 – 1863 – 2100 Monoterpene hydrocarbons Oxygenated monoterpenes Sesquiterpene hydrocarbons Oxygenated sesquiterpenes Unidentified Others Total

Compound

EO

F#1

F#2

F#3

Othera

␣-Thujene ␣-Pinene ␣-Fenchene Camphene ␤-Pinene ␤-Myrcene ␣-Phellandrene ␣-Terpinene p-Cymene Limonene ␤-Phellandrene (Z)-␤-Ocimene (E)-␤-Ocimene -Terpinene Terpinolene Linalool endo-Fenchol Allo-ocimene Camphene hydrate Borneol Terpinen-4-ol ␣-Terpineol (4) endo-Fenchyl acetate Bornyl acetate ␣-Copaene ␣-Gurjunene ␤-Caryophyllene ␣-Guaiene Aromadendrene ␣-Humulene allo-Aromadendrene 4,5-di-epi-Aristochene trans-Cadina-1(6)-4-diene - Muurolene ␣-Amorphene Viridiflorene Valencene ␣-Selinene Epizonarene ␣-Muurolene -Cadinene d-Cadinene cis-Calamenene + trans-Cadina-1,4-diene 10␤H-Cadin-1,4-diene ␣-Calarorene Caryophyllene oxide Globulol Viridiflorol Guaiol C15 H26 Oc Humulene epoxide II C15 H26 Oc 1-epi-cubenol (1) epi-␣-cadinol + epi-␣-muurolol Torreyol (␣-muurolol) ␣-Cadinol Selin-11-en-4-␣-ol 7-Hydroxycalamenene (2) 7-Acetoxycalamenene (3) Phytol acetate

t 17.2 0.2 0.7 8.6 5.4 0.2 t 0.9 4.3 t 10.9 9.6 0.1 0.6 0.8 0.1 3.8 0.1 0.3 0.2 3.9 0.6 1.3 3.2 0.5 0.8 t t 0.8 0.4 t t 0.3 0.1 t 0.2 0.4 t 0.2 t 7.5 1.4 2.4 0.2 0.1 0.1 0.3 0.2 1.5 t 0.3 1.5 1.1 0.1 0.1 0.4 1.4 0.1 0.4 62.5 7.3 18.4 5.4 1.8 0.4 93.6

t 13.9 0.4 1.5 14.0 3.0 t t 0.2 4.6 t 4.4 3.4 0.8 1.4 – – 1.5 – – – – – – 8.4 1.2 0.6 0.1 0.1 t 1.3 0.1 1.2 0.5 0.1 0.3 0.6 0.8 0.1 0.6 0.1 3.8 2.5 9.1 – – – – – – – – – – – – – – – – 67.1 – 31.5 0

– 9.5 0.2 0.9 8.9 6.7 t t 1.0 8.1 t 10.3 10.7 0.9 2.1 – – 3.7 – – – – –

– 0.5 t 0.1 1.8 8.3 0.1 1.0 0.1 6.2 t 15.4 21.5 0.9 2.1 – – 5.0 – – – – –

2.7 0.4 1.1 t t

0.2

1.0 0.1 0.5 0.6 0.1 0.7 0.5 0.7 – 0.6 0.2 9.9 2.4 11.4 – 0.3 – – – – – – – – – – – – – – 63.0 – 32.9 0.3

1.5 – t 1.5 0.3 0.1 0.2 0.3 0.1 0.5 0.2 0.7 0.1 0.5 0.2 13.0 1.9 10.0 – – – – – – 0.4 – – – – – – – – – 63.0 – 31.3 0.4

B,C A,B,C B,C A,B,C A,B,C B,C B,C A,B,C A,B,C A,B,C B,C B,C B,C A,B,C B,C A,B,C B,C B,C B,C A,B,C A,B,C A,B,C B,C A,B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C B,C A,B,C B,C B,C B,C B,C A,B,C,D A,B,C,D A,B,C

98.6

96.2

94.7

RI(obs) : Retention index observed on DB-5 capillary column using homogeneous series of n-alkanes (C6–C28 hydrocarbons, polyscience corp., Niles, IL), RI(rep) : Retention index reported as per Adams 2006, EO: essential oil, F#1: CC fraction 1, F#2: CC fraction 2, and F#3: CC fraction 3; (–): absent; nd – not detected. a A = GC co-injection with authentic sample. B = GC/MS data matched with reported spectra in reference: RP Adams, 1995. C = GC/MS. D = IR. ’H- and 13 C-NMR data. c mass spectral pattern of C15 H26 O: MS m/z (%BPI); 222[M+] (0.1), 207 (1.2), 204 (8.7), 189 (14.8), 179 (2.7), 175 (4.3), 161 (62.8), 147 (30), 133 (27.7), 122 (60.5), 121 (39.5), 119 (43.9), 111 (46.4), 107 (100), 105(84.6), 95 (53.6), 93 (67.6), 91 (50.4), 82 (20.3), 81 (38.8), 79 (37.9), 69 (63.1), 67 (52.9), 55 (66.7), 43(65.8), 41 (53.4).

332

A. Saroj et al. / Industrial Crops and Products 74 (2015) 327–335

Table 2 NMR spectral data of compounds 2 and 3 (1 H 300 MHz, CDCl3 , ref. ı = 7.26 & 13 C 75 MHz, ref. ı = 77 ppm).

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 COOCH3 COOCH3

7-Hydroxycalamenene (2) 13 C 32.60 30.81 – 21.58 – 43.07 130.47 120.84 151.42 113.01 142.04 132.13 31.84 17.21 21.17 22.21 15.51 – – –

1

H NMR (in ppm) 2.70–2.72 (1H, m) 1.89–1.96 (1H, m, H-2␣) 1.27–1.37 (1H, m, H-2␤) 1.72–1.83 (1H, m, H-3␣) 1.52–1.61 (1H, m, H-3␤) 2.63–2.67 (1H, m) 6.95 (1H, s) – 6.65 (1H, s) – – 2.23 (1H, m) 0.71 (3H, d, J = 6.9 Hz) 0.99 (3H, d, J = 6.9 Hz) 1.23 (3H, d, J = 6.9 Hz) 2.21 (3H, s) 4.79 (1H, br s, 7-OH) – –

7-Acetoxycalamenene (3) 13 C 32.60 30.68 – 21.50 – 43.45 130.53 126.46 147.08 119.72 142.09 137.77 31.82 17.27 21.21 22.02 15.90 – 169.46 20.84

1

H NMR (in ppm) 2.73–2.77 (1H, m) 1.89–1.98 (1H, m, H-2␣) 1.30–1.35 (1H, m, H-2␤) 1.77–1.87 (1H, m, H-3␣) 1.59–1.63 (1H, m, H-3␤) 2.64–2.70 (1H, m) 7.04 (1H, s) – – 6.84 (1H, s) – – 2.17–2.21 (1H, m) 0.70–0.72 (3H, d, J = 6.9 Hz) 0.98–1.00 (3H, d, J = 6.9 Hz) 1.23–1.25 (3H, d, J = 6.9 Hz) 2.11 (3H, s) – – 2.3 (3H, s, Me)

symptoms appeared after 10–15 days of inoculation. While uninoculated plants were free from infection. The fungus was re-isolated from the artificially infected plants on PDA, which fulfilled the Koch’s postulate. 3.10. Anti-phytopathogenic activity against soil borne phytopathogen (R. solani) 3.10.1. Drop diffusion assay (Volatile phase) Comparative antifungal activity of essential oil, its terpene fractions and standard components against R. solani has been reported in Table 3. Essential oil exhibited ca. 75% inhibition against R. solani after 24 h. Further, a total of 65% inhibition was recorded after 48 h. Apart from this, fractions 1 and 2 possessed weak activity as compared to fraction 3 (ca. 80%). Among standard compounds, only para-cymene showed ca. 81% inhibition after 24 h.

Fig. 2. Neighbor-joining tree obtained with 11 aligned ITS1-5.8S-ITS2 sequences illustrating the relationship of isolates of R. solani from opium poppy and available sequences in NCBI data bank.

NCBI-BLASTn of sequence showed 99% similarity with R. solani AG 4HG-III (JQ669932), sequence of rDNA ITS region of poppy collar rot pathogen was deposited in Genbank with accession number KF881897. Phylogenetic tree suggests that the causal organism showed close relatedness with R. solani AG 4HG-III (Fig. 2). Earlier, R. solani was reported as causal organism of opium poppy collar rot (Sattar et al., 1999). Furthermore, this is the first report of its molecular identification up to strain and sub strain level as R. solani AG 4HG-III. The numbers at branches designate the percentage of 1000 bootstrap replications. Pathogenicity test results showed that initial symptoms developed as water soaked lesions after 4–5 days, while typical disease

3.10.2. Poison food technique (Contact phase) Essential oil of S. cumini showed similar growth inhibition behavior (76%) in contact phase against R. solani in comparison to drop diffusion method. Antifungal activities of ␣-pinene and limonene were 28% at a concentration of 1000 ppm against R. solani. However, prominent antifungal nature of the isolated compounds viz., 7-hydroxycalamenene, 7-acetoxycalamenene and 1-epi-cubenol (inhibition ca. 95%, 80%, and 76%) were recorded. MIC value for essential oil was recorded ca. 1200 ppm while 1400 ppm was recorded for fractions 1–3 due to their similar chemical makeup (enriched with monoterpene hydrocarbons). MIC of 7-acetoxycalamenene and 1-epi-cubenol showed 800 and 700 ppm, respectively. The least amount of MIC value was recorded for 7-hydroxycalamenene and ␣-terpineol as 500 and 600 ppm, respectively. The effectiveness of isolated compounds and oil fractions is ranked in terms of their antifungal activity at 1000 ppm in the decreasing order: 7-hydroxycalamenene > ␣-terpineol > 7oil > 1-epi-cubenol > fraction acetoxycalamenene > essential 2 > fraction 1 > fraction 3. 3.11. Anti-phytopathogenic activity against air borne phytopathogen (Choanephora cucurbitarum) 3.11.1. Drop diffusion assay (Volatile phase) Anti-phytopathogenic activity of essential oil and its constituent was carried out against air borne phytopathogen Choanephora cucurbitarum and the results were listed in Table 4. The standard

A. Saroj et al. / Industrial Crops and Products 74 (2015) 327–335

333

Table 3 Anti-phytopathogenic potential of S. cumini essential oil and its constituent against R. solani. Hrs

Assay type

Volatile Contacta Volatile 21 Contacta Volatile 24 Contacta Volatile 48 Contacta MIC value (ppm) 18

Different samples with observed inhibition (in %) EO

Fr#1

Fr#2

Fr#3

7-OH

7-Ac

Cub

␣OH

␣-Pin

Lim

p-Cym

82 (1.9) 100 (0) 78 (2.3) 100 (0.5) 75 (2.3) 95 (1.8) 65 (2.8) 76 (1.6) 1200

60 (2.4) 75 (1.9) 65 (3.1) 71 (1.7) 64 (3.4) 60 (1.2) 56 (1.1) 52 (1.4) 1400

80 (1.5) 75 (1.5) 75 (1.8) 80 (1.6) 64 (2.3) 80 (2.1) 62 (2.5) 65 (1.8) 1400

92 (1.5) 70 (1.5) 80 (1.1) 72 (1.7) 80 (1.2) 57 (1.9) 70 (1.7) 48 (1.1) 1400

0 100(0) 0 100(0) 0 100(0) (0) 95 (0.4) 500

– 94 (1.1) – 91(1.0) – 93(1.1) – 80 (2.1) 800

50 (2.6) 100 (0.5) 58 (3.0) 87 (1.1) 26 (0.8) 90 (0.4) 22 (1.3) 76 (1.1) 700

87 (1.5) 100 (0.5) 90 (1.5) 100 (0.5) 85 (1.5) 93 (1.8) 90 (2.7) 82 (1.5) 600

50 (1.8) 33 (2.1) 55 (2.3) 25 (1.7) 40 (2.4) 20 (2.1) 23 (1.3) 25 (1.6) –

87 (1.9) 33 (1.7) 77 (1.9) 25 (3.3) 63 (1.9) 0 (0) 25 (1.2) 0(0) –

100 (0.9) 33 (1.5) 100 (0.9) 25 (0.9) 81 (1.6) 0 (0) 42 (2.7) 0(0) –

EO: Essential oil, Fr#1-3: column chromatography fractions of essential oil, 7-OH: 7-hydroxycalamenene, 7-Ac: 7-acetoxycalamene, Cub: 1-epi-cubenol, ␣OH: ␣-terpineol, ␣-Pin: ␣-Pinene; Lim: limonene, p-Cym: para-cymene, (–) not tested. Standard deviation reported in parentheses. a Activity recorded at 1000 ppm.

Fig. 3. Comparative volatility pattern of terpene compounds against R. solani in the experimental Petri-plate by solid-phase microextraction technique: A: fr#1; B: fr#2; C: fr#3; D: S. cumini essential oil.

Table 4 Anti-phytopathogenic potential of S. cumini essential oil and its constituent against C. cucurbitarum. Hours

Assay type

Volatile Contacta Volatile 21 Contacta Volatile 24 Contacta MIC value (ppm) 18

Different samples with observed inhibition (in %) EO

Fr#1

Fr#2

Fr#3

7-OH

7-Ac

Cub

␣OH

␣-Pin

Lim

p-Cym

74 (1.1) 95 (1.5) 70 (2.2) 90 (1.5) 67 (1.6) 92 (1.5) 1200

69 (1.8) 70 (1.6) 55 (1.9) 71 (2.2) 40 (1.8) 50 (1.1) 1400

75 (0.8) 80 (2.5) 70 (1.1) 71 (1.3) 65 (1.1) 70 (1.5) 1200

95 (1.2) 60 (1.5) 93 (2.1) 65 (0.8) 87 (1.5) 60 (1.1) 1400

0 (0) 100(0) 0 (0) 93 (1.3) 0 (0) 95 (1.5) 500

– 75 (1.5) – 68 (1.1) – 70 (2.7) 1000

0(0) 88 (1.1) 0(0) 90 (1.5) 0(0) 92 (1.5) 700

90 (1.5) 100 (0) 92 (1.1) 100(0) 95 (1.5) 100 (0.5) 400

65 (3.0) 50 (2.4) 60 (3.8) 38 (3.8) 28 (1.8) 41 (2.4) –

65 (1.1) 0 (0) 50 (1.6) 0 (0) 28 (1.7) 0(0) –

80 (1.8) 62 (1.1) 60 (2.1) 66 (1.1) 49 (2.3) 70 (1.4) –

EO: Essential oil, Fr#1-3: column chromatography fractions of essential oil, 7-OH: 7-hydroxycalamenene, 7-Ac: 7-acetoxycalamene, Cub: 1-epi-cubenol, ␣OH: ␣-terpineol, ␣-Pin: ␣-Pinene; Lim: limonene, p-Cym: para-cymene, (–) not tested. Standard deviation reported in parentheses. a Activity recorded at 1000 ppm.

334

A. Saroj et al. / Industrial Crops and Products 74 (2015) 327–335

monoterpenes showed mild anti-phytopathogenic activity. But the isolated compound ␣-terpineol and ocimene rich column chromatography fraction 3 showed strong antifungal nature. Moreover, ocimene rich fraction 3 has been found to be a promising antifungal composition, which may be imparting similar biological activity to essential oil as well. 3.11.2. Poison food technique (Contact phase) Antifungal activities of essential oil and its component against C. cucurbitarum have been listed in Table 4. Essential oil exhibited 92% inhibition against C. cucurbitarum after 24 h. Further, inhibition pattern shown by fractions 1–3 were recorded as 50%, 70%, and 60%, respectively. Limonene showed zero percent growth inhibition while other standards viz., ␣-pinene and para-cymene possessed antifungal property with 40% and 70% inhibition. 7-Hydroxycalamenene, 7-acetoxycalamenene, and 1-epi-cubenol showed better antifungal activity ca. 95%, 70%, and 92% inhibition, respectively. Similar antifungal nature of (−)-7-hydroxycalamenene against Cladosporium cucumerinum has been reported (Burden and Kemp, 1983). ␣-Terpineol was the sole chemical entity, which showed complete inhibition (100%). MIC of 500 ppm was recorded for 7-hydroxycalamenene whereas ␣-terpineol showed 400 ppm. The antifungal activity in decreasing order at 1000 ppm shall be: ␣-terpineol > 7hydroxycalamenene > essential oil > 1-epi-cubenol > fraction 2 > 7acetoxycalamenene > fraction 3 > fraction 1. Since, antifungal activity of 7-hydroxycalamenene against air borne pathogens such as Rhizopus oryzae and Mucor circinelloides has already been reported (Azevedo et al., 2013). Therefore, we conclude that compounds possessing hydroxyl- ( OH) groups may act as better antifungal agents against air borne pathogen. Furthermore, our study showed that low molecular weight alcohol like ␣-terpineol (mw 154) showed good inhibition in comparison to 7hydroxycalamenene (mw 218) in volatile phase. This may be due to the fact that lesser the carbon number more will be the tendency to form vapors. 3.12. Headspace analysis of experimental Petri-plate through SPME The fiber response towards Petri-plate headspace at different time intervals is shown against R. solani in a representative Fig. 3. This technique helps in understanding the role of an identified chemical entity with that of observed growth inhibition. It has been proven that monoterpene hydrocarbons such as (Z)-␤- and (E)-␤-ocimene have better antifungal activities in volatile phase. This fact was further supported by the activity of ocimene rich S. cumini column fraction 3 against the test organisms. Similarly, antifungal activity of pinene rich fraction 1 was slightly better than the standard pinene. This difference may be due to the synergistic effect of constituents other than pinene contributing proportions to fraction 1. Importantly, it has been observed that the area counts for monoterpene constituents were drastically changed; almost to half from its initial concentration after six hours of study. Therefore, first six hours exposure of the column fractions and essential oil towards phytopathogens is crucial in ascertaining antifungal activity in volatile phase. There has been no observed antimicrobial activity of p-cymene against R. solani in poison food technique whereas ca. 70% inhibition was evident against C. cucurbitarum. In total, inhibition ranged from 49–63% has been recorded against both the fungi in volatile phase in first 24 h (Tables 3 and 4). 4. Conclusion Composition of Syzygium cumini showed the presence of monoand sesquiterpenoids class of compounds in its essential oil. A new

sesquiterpenoids, 7-acetoxycalamenene was characterized for the first time from natural source. Among the isolated compounds, ␣-terpineol and 1-epi-cubenol were most effective in growth inhibition of a plant pathogen, R. solani AG 4HG III characterized for the first time from opium poppy collar rot and C. cucurbitarum. Furthermore, column fractions enriched with ocimene were most effective antifungal agents in volatile phase. However, antifungal application of S. cumini oil and its constituents under field conditions needs to be further investigated. Acknowledgements The authors are grateful to the Director, CSIR-CIMAP, Lucknow, India for providing necessary facilities during the course of the investigation, to Prof. Hyakumachi, Gifu University, Faculty of Applied Biological Sciences, Japan for providing Rhizoctonia AG strains. This work was funded by Council of Scientific and Industrial Research, CSIR, New Delhi under the project BSC-0203 entitled, “Chemical Biology of Ocimum and other aromatic plants (ChemBio) under Biological Sciences Cluster by CSIR-CIMAP.” Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.indcrop.2015.04. 065 References Adams, R.P., 2006. Identification of Essential Oil Components by Gas Chromatography/Mass Spectroscopy. Allured Publishing Corp, Carol Stream IL, USA. Ayyanar, M., Subash-Babu, P., Ignacimuthu, S., 2013. Syzygium cumini (L.) Skeels: a novel therapeutic agent for diabetes: Folk medicinal and pharmacological evidences. Compl. Ther. Med. 21, 232–243. Alam, M., Sattar, A., Khaliq, A., Samad, A., Khanuja, S.P.S., 2004. A root rot and wilt disease of pyrethrum (Chrysanthemum cineraefolium) caused by Rhizoctonia solani AG 4 in the north Indian plains. New Dis. Rep. 10, 37. Azevedo, M.M.B., Chaves, F.C.M., Almeida, C.A., Bizzo, H.R., Duarte, R.S., Campos-Takaki, G.M., Alviano, C.S., Alviano, D.S., 2013. Antioxidant and antimicrobial activities of 7-hydroxycalamenene rich essential oils from Croton cajucara Benth. Molecules 18, 1128–1137. Babadoost, M., Zitter, T.A., 2009. Fruit rots of pumpkin: a serious threat to pumpkin industry. Plant Dis. 93, 772–782. Badawy, M.E.I., Abdelgaleil, S.A.M., 2014. Composition and antimicrobial activity of essential oils isolated from Egyptian plants against plant pathogenic bacteria and fungi. Ind. Crops Prod. 52, 776–782. Burden, R.S., Kemp, M.S., 1983. (−)-7-Hydroxycalamenene, a phytoalexin from Tilia europea. Phytochemistry 22, 1039–1040. Cambie, R.C., Lal, A.R., Ahmad, F., 1990. Sesquiterpenes from Heritiera ornithocephala. Phytochemistry 29, 2329–2331. Chang, H.T., Cheng, Y.H., Wu, C.L., Chang, S.T., Chang, T.T., Su, Y.C., 2008. Antifungal activity of essential oil and its constituents from Calocedrus macrolepis var: formosana Florin leaf against plant pathogenic fungi. Bioresour. Technol. 99, 6266–6270. Carling, D.E., Leiner, R.H., 1986. Isolation and characterization of Rhizoctonia solani and binucleate Rhizoctonia-like fungi from aerial stems and subterranean organs of potato plants. Phytopathology 76, 725–729. Carling, D.E., 1996. Grouping in Rhizoctonia solani by hyphal anastomosis reaction. In: Sneh, B., Jabaji-Hare, S., Neat, S., Dijst, G., et al. (Eds.), Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, Dordecht, The Netherlands, pp. 37–47. Dias, C.N., Rodrigues, K.A.F., Carvalho, F.A.A., Carneiro, S.M.P., Maia, J.G.S., Andrade, E.H.A., Moraes, D.F.C., 2013. Molluscicidal and Leishmanicidal activity of leaf essential oil of Syzygium cumini (L.) Skeels from Brazil. Chem. Biodivers. 10, 1132–1141. Dutta, B.K., Karmakar, S., Naglot, A., Aich, J.C., Begam, M., 2007. Anticandidal activity of some essential oils of a mega biodiversity hotspot in India. Mycoses 50, 121–124. Elansary, H.O., Salem, M.Z.M., Asmawy, N.A., Yacout, M.M., 2012. Chemical composition: antibacterial and antioxidant activities of leaves essential oils from Syzygium cumini L. Cupressus sempervirens L. and Lantana camara L. from Egypt. J. Agric. Sci. 4, 144–152. Felsenstein, J., 1985. Confidence limits on phylogenies: an approach using the bootstrap. Evolution 39, 783–791. Grover, R.K., Moore, J.D., 1962. Toximetric studies of fungicides against brown rot organisms Sclerotia fructicola and S. laxa. Phytopathology 52, 876–880.

A. Saroj et al. / Industrial Crops and Products 74 (2015) 327–335 Hyakumachi, M., Priyatmojo, A., Kubota, M., Fukui, H., 2005. New anastomosis groups, AG-T and AG-U, of binucleate Rhizoctonia spp. causing root and stem rot of cut-flower and miniature roses. Phytopathology 95, 784–792. Ishii, H., 2006. Impact of fungicide resistance in plant pathogens on crop disease control and agricultural environment. Jpn. Agric. Res. Q. 40, 205–211. Jabeen, K., Javaid, A., 2010. Antifungal activity of Syzygium cumini against Ascochyta rabiei – the cause of chickpea blight. Nat. Prod. Res. 24, 1158–1167. Jirovetz, L., Buchbauer, G., Puschmann, C.H., Fleischhacker, W., Shafi, P.M., Rosamma, M.K., 1999. Analysis of the essential oils of the fresh leaves of Syzygium cumini and Syzygium travancoricum from South-India. J. Essent. Oil-Bearing Plants 2, 68–77. Johnson, K.B., Sawyer, T.L., Powelson, M.L., 1994. Frequency of benzimidazole and dicarboximide resistant strains of Botrytis cinerea in western Oregon small fruit and snap bean plantings. Plant Dis. 78, 572–577. Kimura, M., 1980. A simple method of estimating evolutionary rate of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 16, 111–120. Knobloch, K., Pauli, P., Iberl, B., Weigand, H., Weiss, N., 1989. Antibacterial and antifungal properties of essential oil components. J. Essent. Oil Res. 1, 119–128. Kumar, A., Naqvi, A.A., Kahol, A.P., Tandon, S., 2004. Composition of leaf oil of Syzygium cumini L. from north India. Indian Perfumer 48, 439–441. Machado, R.R.P., Jardim, D.F., Souza, A.R., Scio, E., Fabri, R.L., Carpanez, A.G., Grazul, R.M., Mendonca, J.P.R.F., Lesche, B., Aarestrup, F.M., 2013. The effect of essential oils of S. cumini on the development of granulomatous inflammation in mice. Braz. J. Pharmacognosy 23, 488–496. Mohamed, A.A., Ali, S.I., El-Baz, F.K., 2013. Antioxidant and antibacterial activities of crude extracts and essential oils of Syzygium cumini leaves. PLoS ONE 8, e60269. Muzhinji, N., Woodhall, J.W., Truter, M., van der Waals, J.E., 2014. First report of Rhizoctonia solani AG 4HG-III causing potato stem canker in South Africa. Plant Dis. 98, 853. Nabeta, K., Katayama, K., Nakagawara, S., Katoh, K., 1993. Sesquiterpenes of cadinane type from cultured cells of the liverwort, Heteroscyphus planus. Phytochemistry 32, 117–122. Nene, Y., Thapliyal, L., 2002. Poisoned Food Technique of Fungicides in Plant Disease Control, third ed. Oxford and IBH Publishing Company, New Delhi. Ogoshi, A., 1987. Ecology and pathogenicity of anastamosis and intraspecific groups of Rhizoctonia solani Kühn. Annu. Rev. Phytopathol. 25, 125–143. Parmeter, J.R.J., Sherwood, R.T., Platt, W.D., 1969. Anastomosis grouping among isolates of Thanatephorus cucumeris. Phytopathology 59, 1270–1278. Pragadheesh, V.S., Saroj, A., Yadav, A., Chanotiya, C.S., Alam, M., Samad, A., 2013a. Chemical characterization and antifungal activity of Cinnamomum camphora essential oil. Ind. Crops Prod. 49, 628–633.

335

Pragadheesh, V.S., Saroj, A., Yadav, A., Samad, A., Chanotiya, C.S., 2013b. Compositions: enantiomer characterization and antifungal activity of two Ocimum essential oils. Ind. Crops Prod. 50, 333–337. Rodrigues, K.A.F., Amorim, L.V., Dias, C.N., Moraes, D.F.C., Carneiro, S.M.P., Carvalho, F.A.A., 2015. Syzygium cumini (L.) Skeels essential oil and its major constituent ␣-pinene exhibit anti-Leishmaniaactivity through immunomodulation in vitro. J. Ethnopharmacol. 160, 32–40. Saitou, N., Nei, M., 1987. The neighbor joining method: a new method for re-constructing phylogenetic trees. Mol. Biol. Evol. 4, 406–425. Sattar, A., Dhawan, O.P., Saini, S., Trivedi, M., Shahabuddin, S., Alam, M., 1999. Collar rot a new disease of opium poppy caused by Rhizoctonia solani. Ind. J. Plant Pathol. 17, 99–101. Saroj, A., Kumar, A., Qamar, N., Alam, M., Singh, H.N., Khaliq, A., 2012. First report of wet rot of Withania somnifera caused by Choanephora cucurbitarum in India. Plant Dis. 96, 293. Saroj, A., Kumar, A., Saeed, S.T., Samad, A., Alam, M., 2013. First report of Tagetes erecta damping off caused by Ceratobasidium sp. from India. Plant Dis. 97, 1251. Shafi, P.M., Rosamma, M.K., Jamil, K., Reddy, P.S., 2002. Antibacterial activity of Syzygium cumini and Syzygium travencoricum leaf essential oils. Fitoterapia 73, 414–416. Sikder, M.A.A., Kaisar, M.A., Rahman, M.S., Hasan, C.M., Rehaily, A.J.A., Rashid, M.A., 2012. Secondary metabolites from seed extracts of Syzygium cumini (L.). J. Phys. Sci. 23, 83–87. Singh, N., Sharma, P., Verma, O.P., 2011. First report of Choanephora sp. causing twig blight of Boerhavia diffusa in India. New Dis. Rep. 23, 29. Singh, S.C., Khanuja, S.P.S., 2006. Lucknow Flora – The Plant Wealth of the Region. CSIR-CIMAP, Lucknow, India. Tamura, K., Stecher, G., Peterson, D., Filipski, A., Kumar, S., 2013. MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725–2729. Vila, R., Santana, A.I., Pérez-Rosés, R., Valderrama, A., Castelli, M.V., Mendonca, S., ˜ Zacchino, S., Gupta, M.P., Canigueral, S., 2010. Composition and biological activity of the essential oil from leaves of Plinia cerrocampanensis, a new source of ␣-bisabolol. Bioresour. Technol. 101, 2510–2514. Vijayanand, P., Jagan Mohan Rao, L., Narasimham, P., 2001. Volatile flavor components of jamun fruit (Syzygium cumini L.). Flavour Fragrance J. 16, 47–49. Weyerstahl, P., Marschall, H., Thefeld, K., Subba, G.C., 1998. Constituents of the essential oil from the rhizomes of Hedychium gardnerianum Roscoe. Flavour Fragrance J. 13, 377–388.