Antigen mimicry by an anti-idiotypic antibody single chain variable fragment

\

Molecular Immunology

PERGAMON

Molecular Immunology 24 "0887# 742Ð752

Antigen mimicry by an anti!idiotypic antibody single chain variable fragment P[ K[ Tripathi\ H[ Qin\ S[ Deng\ C[ Xu\ M[ Bhattacharya!Chatterjee\ K[ A[ Foon\ S[ K[ Chatterjee Department of Internal Medicine\ Division of Hematology and Oncology and The Lucille Parker Markey Cancer Center\ University of Kentucky Medical Center\ Lexington\ KY 39425!9985\ U[S[A[ Received 04 April 0887^ revised 05 July 0887^ accepted 19 July 0887

Abstract For the therapy of cancer patients whose disease is positive for Carcinoembryonic Antigen "CEA#\ we developed an active speci_c immunotherapy based on the idiotypic network[ The anti!idiotype monoclonal antibody "mAb#\ 2H0 was generated by immunization of mice with the anti!CEA mAb\ 7908[ 2H0 mimics CEA both functionally and structurally and acts as a surrogate for CEA[ To de_ne the minimum structural requirements for antigen mimicry by 2H0\ we constructed plasmid vectors for expression of single chain Fv "scFv# variants of 2H0 in Escherichia coli[ Variable heavy "VH# and variable light "VL# chain domains of 2H0 were linked by a 04 amino acid linker "Ln#\ "Gly3Ser#2 in two constructs\ VH!Ln!VL and VL!LnVH[ Ln was omitted in two constructs\ VH!VL and VL!VH[ Each of the scFv constructs has a tag of six His ð"His#5 tagŁ for puri_cation by metal chelate a.nity chromatography and detection by enzyme!linked immunoabsorbent assay "ELISA#[ Comparisons of the binding of 7908 to puri_ed scFv proteins by ELISA and immunoblot experiments showed that only VH!Ln!VL had signi_cant activity[ VH!Ln!VL also showed maximum inhibition of binding of 7908 to CEA[ Immunization of mice with naked VH!Ln!VL and VH!Ln!VL conjugated to keyhole limpet hemocyanin induced anti!CEA antibodies in mouse sera[ Sera from immunized mice inhibited the binding of 7908 to 2H0 as well as CEA[ Induction of anti!CEA antibodies in the immunized mice was con_rmed by ~ow cytometric analysis using CEA positive MC! 27cea cells[ These results demonstrate that for antigen mimicry of 2H0 scFv\ the presence of Ln is necessary and the domain order should be VH followed by VL[ Þ 0887 Elsevier Science Ltd[ All rights reserved[ Keywords] Anti!Idiotypic Antibodies^ Single chain variable fragment^ Carcinoembryonic Antigen

0[ Introduction Antibodies "Ab0# react with selected epitopic deter! minants on an antigen[ While antigenic determinants are primarily found on foreign macromolecules\ structural elements on the variable regions of an Ab0 can also serve as a determinant that is recognized by a second antibody that is referred to as an Ab1 or anti!idiotypic antibody "Mayforth\ 0882#[ Ab1 are classi_ed into three types based on the region of the variable domain of Ab0 they recognize "Bona and Kohler\ 0873#[ Ab1a recognize idiot! opes that are outside of the antigen binding site[ If the target idiotype is close to the binding site and interferes  Corresponding author[ E!mail] skchat99Ýpop[uky[edu Abbreviations*CEA\ carcinoembryonic antigen^ CDR\ comple! mentarity determining region^ scFv\ single chain variable fragment "Fv#^ VH\ variable heavy chain^ VL\ variable light chain^ KLH\ keyhole limpet hemocyanin^ CFA\ complete Freund|s adjuvant^ IFA\ incom! plete Freund|s adjuvant^ Ln\ Linker[ S9050Ð4789:87 ,08[99 Þ 0887 Elsevier Science Ltd[ All rights reserved PII] S 9 0 5 0 Ð 4 7 8 9 " 8 7 # 9 9 9 6 1 Ð 7

with the antigen binding\ it is called Ab1g[ Ab1b reco! gnize the binding site of Ab0 and resemble the epitope recognized by Ab0[ Only Ab1b act as an internal image of the antigen "Bhattacharya!Chatterjee et al[\ 0880#[ Each subgroup is characterized by its ability to block the bind! ing of Ab0 to its antigen[ Antigen binding of Ab0 is not a}ected by Ab1a\ may be blocked by Ab1g and is completely blocked by Ab1b "Bona and Kohler\ 0873#[ Ab1b is predicted to be the internal image of the antigen and if injected into mice or other species\ a polyclonal anti!idiotype antibody or Ab2 is induced[ A subset of Ab2 have a binding site "paratope# similar to Ab0 and called the Ab0? to indicate that it might di}er in its other idiotopes from Ab0 "Bhattacharya!Chatterjee et al[\ 0880#[ Ab0? is the most clinically important Ab2\ since this alone can bind to the target antigen[ One of the tumor associated antigens we chose for the development of an active speci_c immunotherapy of cancer based on the anti!idiotype antibody concept was Carcinoembryonic Antigen\ "CEA#[ CEA is present at

743

P[K[ Tripathi et al[:Molecular Immunology 24 "0887# 742Ð752

high density on a variety of tumor cells including col! orectal "Muraro et al[\ 0874#\ adenocarcinoma of the lungs "Vincent et al[\ 0867# and breast cancer "Steward et al[\ 0863#[ CEA is considered to be an excellent target for cancer immunotherapy "Foon et al[\ 0884\ 0886#[ The anti!idiotype antibody 2H0 mimics a distinct epitope of CEA "Bhattacharya!Chatterjee et al[\ 0889#[ We have previously shown that 2H0 can induce anti!CEA anti! body in small animals "Bhattacharya!Chatterjee et al[\ 0889# and non!human primates "Chakraborty et al[\ 0884a#[ In a phase I clinical trial of patients with advanced colorectal cancer\ we further demonstrated that 2H0 can induce anti!CEA immunity in humans "Foon et al[\ 0884\ 0886#[ In a murine model\ we demonstrated that immun! ity induced by multiple injections of the Ab1b\ 2H0\ can protect mice against a challenge by lethal doses of CEA! positive tumor cells "Pervin et al[\ 0886#[ To further de_ne the system\ we sought to identify the speci_c reactive antibody domain of 2H0[ ScFv con! sisting of a single variable heavy and a light chain domain is the smallest antibody fragment capable of binding an antigen "Bird et al[\ 0877^ Huston et al[\ 0880^ Raag and Whitlow\ 0884#[ To determine whether this type of antibody fragment can mimic the nominal antigen\ CEA\ we constructed plasmid vectors for the expression of vari! ous forms of scFv derived from 2H0 and studied the binding properties of the puri_ed proteins expressed in Escherichia coli[ Variable heavy "VH# and light "VL# chain domains of 2H0 were con_gured with or without a 04 amino acid linker "Ln# in the scFv constructs[ We report in this article that for antigen mimicry of 2H0 by scFv\ the VH should be in the amino terminus of the scFv[ Moreover\ the variable regions should be separated by a linker Ln\ to assume the con_guration\ VH!Ln!VL[ Immunization of mice with this VH!Ln!VL induced anti! CEA antibodies and the antibody titers were higher than those with intact 2H0[

1[ Materials and methods 1[0[ Isolation of VH and VL cDNA fra`ments Total RNA was isolated from 0×096 2H0 hybridoma cells "Bhattacharya!Chatterjee et al[\ 0889# by the pro! cedure of Chomczynski and Sacchi "0876#[ The _rst strand cDNA was synthesized using SuperScript Pre! ampli_cation kit "Life Technologies\ Inc[\ Gaithersburg\ MD\ U[S[A[#[ The DNA fragments encoding the VH and VL domains of 2H0 were then ampli_ed by PCR[ For VH\ the forward primer was 4?!gggaattcatgraat! gsasctgggtywtyctctt and the reverse primer was 4?! cccaagcttccagggrccarkggataracigrtgg\ corresponding to sequences of the leader region −19 to −02 and the g0 C region amino acids 015Ð008 "Kabat et al[\ 0880#[ For VL\ the forward primer was 4?!actagtcga!

catggtrtccwcasctcagttccttg and the reverse primer was 4?! cccaagcttactggatggtgggaagatgga\ corresponding to sequences of the leader −19 to −01 and the k C region amino acids 011Ð005 "i  inosine\ r  a or g\ y  c or t\ k  g or t\ s  c or g\ w  a or t#[ The ampli_ed DNA fragments of VH and VL were subcloned into pT6 plas! mid "Novagen\ Madison\ WI\ U[S[A[# to obtain two star! ting plasmids pT2H0VH and pT2H0VL\ which were used for DNA sequencing[ The DNA sequences were trans! lated into amino acid sequences by IntelliGenetics sof! tware for molecular biology "IG suites# for the identi_cation of the variable region gene family\ leader sequences\ CDR regions and framework sequences from Kabat|s immunologic database "Kabat et al[\ 0880# using the BLAST program "Altschul et al[\ 0889#[ Identi_cation of the 2H0 clones was con_rmed by determination of the sequences of the amino acid of the puri_ed heavy and light chains of 2H0[ The amino acid sequences of 2H0 have been recently published "Chatterjee et al[\ 0887#[ 1[1[ Construction of plasmids expressin` various 2H0 scFv in E[ coli For covalent linking of the variable regions of 2H0\ in VH!Ln!VL and VL!Ln!VH\ a 04 amino acid Ln\ "Gly3Ser#2\ was used "Huston et al[\ 0880#[ The peptide was encoded by the DNA sequence gggggaggtggctcgggcggtggcggctcgggtggcggcggatcc[ In VH!VL and VL!VH constructs\ the variable sequences were directly ligated without any Ln[ Primers used for the ligation of the variable regions by PCR are listed in Table 0[ Restriction sites for S_ I and Xho I in the primers are italicized "Table 0#[ Two PCR reactions were carried out[ In PCR 0\ 49 mM of the L primer pairs "Table 1# were annealed in a boiling water bath\ followed by slow cooling to room temperature[ Then 49 ng each of pT2H0VH and pT2H0VL were mixed with the L primers and a 04 cycle PCR reaction "PCR 0\ Table 1# was per! formed[ PCR was continued for 34 cycles "PCR 1\ Table 1# after addition of 49 mM of each of the P primer pairs "Table 1#[ Error proof DNA polymerase\ ULTma "Per! kin!Elmer# was used for these PCR reactions[ The _nal product was puri_ed on LMP agarose gels "FMC BioP! roducts#\ extracted by treatment with GELase "Epicentre Tech[\ Madison\ WI\ U[S[A[# and digested with S_ I and Xho I for subcloning into the pET!11b"¦# expression vector "Novagen#[ To achieve better folding\ synthesized scFv was directed into periplasmic space of the bacteria "Wul_ng and Pluckthun\ 0883#[ An S_ I site was intro! duced into the pelB leader of pET!11b"¦# by in vitro mutagenesis\ using pAlter Sites II in vitro mutagenesis system "Promega\ Madison\ WI\ U[S[A[#[ S_ I:Xho I digested scFv DNA fragments were ligated into the simi! larly cut mutant pET!11b"¦# plasmid and used for trans! formation of competent JM098 strain "Promega# of E[ coli[

P[K[ Tripathi et al[:Molecular Immunology 24 "0887# 742Ð752

744

Table 0 List of primers used for the construction of 2H0 scfv expression plasmids Primers

Sequence

P0 P1 P2 P3 Ll L1 L2 L3 L4 L5 L6 L7

4?!tcgc``ccca`cc``ccatggccgaggtccagctgcaacag 4?!tgcagcatcctc`a`tttgatttc 4?!tcgc``ccca`cc``ccatggccgacatcaagatgacccagtct 4?!gggtgtcgtctc`a`tgaggagac 4?!accgtctcctcagacatcaagatg Complementary sequence of L0 4?!acggtcaccgtctcctcagggggaggtggctcgggcggtggcggctcgggtggcggcggatcc gacatcaagatgacccag Complementary sequence of L2 4?!cgtgaaatcaaagaggtccagctg Complementary sequence of L4 4?!accaagctggaaatcaaagggggaggtggctcgggcggtggcggctcgggtggcggcggatcc gaggtccagctgcaacag Complementary sequence of L6

Table 1 Primers used for linking variable regions of 2H0 heavy and light chains Construct

PCR 0

PCR 1

VH!VL VH!Ln!VL VL!VH VL!Ln!VH

L0\ L1 L2\ L3 L4\ L5 L6\ L7

P0\ P1 P0\ P1 P2\ P3 P2\ P3

1[2[ Expression of 2H0 scFv in E[ coli and puri_cation For protein expression\ the recombinant scFv plasmids were used for transformation of E[ coli strain BL10"DE2# "Novagen#[ A single colony of the bacterium was inocu! lated into 14 ml of TB broth "Sambrook et al[\ 0878# containing 099 mg:ml ampicillin and grown at 26>C until OD599 was ½9[6[ From this starting culture\ 19 ml was transferred to 0999 ml of TB "Sambrook et al[\ 0878# and the incubation was continued until OD599 was ½9[6Ð9[8[ Expression of the recombinant protein was induced by the addition of isopropyl!thio!b!D!galactopyranoside to a _nal concentration of 0 mM[ Incubation was continued for another 3 h[ Induced cells were collected by cen! trifugation at 4999 g for 4 min and stored at −69>C[ 1[3[ Puri_cation and refoldin` of the 2H0 scFv by dena! turation:renaturation 1[3[0[ Two!step procedure The frozen cells were brought to room temperature\ followed by addition of 39 ml of a bu}er containing 4 mM imidazole\ 9[4 M NaCl and 5 M urea in 19 mM Tris! HCl\ pH 6[8[ The bacterial suspension was sonicated three times for 04 sec each for solubilization of the protein and to shear the DNA[ The solution was centrifuged at 19\999 g for 19 min and passed through a 9[34 mm _lter

for puri_cation of scFv by metal chelate a.nity chro! matography "Casey et al[\ 0884#[ Clear supernatant was applied to a column equilibrated at room temperature containing 0 ml of His = Bind metal chelation resin "Nov! agen#\ washed with 09 ml of a bu}er containing 19 mM imidazole\ 9[4 M NaCl\ 5 M urea in 19 mM Tris!HCl\ pH 6[8[ Bound protein was eluted with a bu}er containing 0 M imidazole\ 9[4 M NaCl\ 5 M urea in 19 mM Tris! HCl\ pH 6[8 and 0 ml fractions were collected[ Protein containing fractions\ monitored by OD179 densitometry were pooled and urea was removed by dialysis against a bu}er containing 9[0 M Tris!HCl\ pH 7[9 and 1 mM EDTA[ Refolding of the protein was carried out by incu! bation of the solution at 09>C for 37 h after adjusting the protein concentration to 29 mg:ml and by the addition of L!arginine plus oxidized glutathione to _nal con! centrations of 9[4 M and 7 mM respectively "Buchner et al[\ 0881#[ Finally\ the proteins were dialyzed extensively against PBS and stored at 3>C[ The preparations were clari_ed by centrifugation for removal of precipitated protein[

1[3[1[ One!step procedure In this procedure "Holzinger et al[\ 0885#\ induced pro! tein from 0999 ml culture was extracted in bu}er 0 "5 M Guanidine Hydrochloride\ 9[4 M NaCl\ 3 mM Octyl! glucoside in 19 mM Tris!HCl\ pH 6[8# by sonication as described above[ The cleared supernatant was applied to a column containing 3 ml of His=Bind metal chelation resin\ pre!equilibrated with bu}er 0 at room temperature[ Washing and solubilization steps were performed with 49 ml of bu}er 1 "5 M Urea\ 9[4 M NaCl\ 19 mM Imidazole in 19 mM Tris!HCl\ pH 6[8#\ followed by 49 ml of bu}er 2 "9[04 M NaCl in 19 mM Tris!HCl\ pH 6[8#[ The bound protein was eluted with 14 ml of bu}er 2\ containing 49 mM EDTA[ Final preparation was dialyzed extensively against PBS[

745

P[K[ Tripathi et al[:Molecular Immunology 24 "0887# 742Ð752

1[4[ Extraction of periplasmic fractions The induced culture was centrifuged at 6999 g for 09 min and the cell pellet was suspended in 9[3× culture volume of 29 mM Tris!HCl\ pH 7[9 containing 19) Sucrose[ Following the addition of 0 mM EDTA\ the suspension was stirred for 09 min at room temperature[ The pellet was collected by centrifugation at 09\999 g for 09 min and resuspended in 9[3× culture volume of 4 mM MgSO3[ After stirring in ice for 09 min\ the supernatant containing the periplasmic fraction was collected and dialyzed against PBS[ 1[5[ SDSÐPAGE and immunoblottin` Puri_ed 2H0 scFv products were electrophoresed through a 3Ð19) gradient gel under non!reducing con! ditions and the proteins were visualized by staining with Coomassie Blue "Laemmli\ 0869#[ For immunoblotting\ the proteins were separated in 09) SDS gels under non! reducing conditions[ Proteins were transferred to a nitro! cellulose membrane "Towbin et al[\ 0868#[ After blocking with 2) BSA in PBS\ the membrane was incubated with the mouse monoclonal antibody "Ab0#\ 7908 "Bhat! tacharya!Chatterjee et al[\ 0889#\ at 4mg:ml in PBS!BSA[ Ab0 bound by scFv was detected by reaction with a 0 ] 19\999 dilution of goat anti!mouse IgG "Fc speci_c# conjugated with alkaline phosphatase "Sigma#\ followed by color reaction with BCIP:NBT according to "Xiang et al[\ 0883#[ 1[6[ Relative bindin` of scFv by ELISA Falcon 85!well plates were coated with 099 ml of a solution of 7908 "Ab0# at 4 mg:ml overnight at 3>C[ Wells were blocked with 0) BSA in PBS for 1 h at room temperature and washed with PBS[ Equal amounts each of a puri_ed\ refolded scFv solution in 099 ml PBS were added to a well and incubated overnight at 3>C[ The range of protein used was 0Ð099 mg:well and the assay was carried out in triplicate[ Bound scFv was detected by reaction with nickel!nitrilotriacetic acid!alkaline phos! phatase conjugate\ followed by color reaction with alka! line phosphatase substrate according to the instructions of the supplier "Qiagen#[ 1[7[ Inhibition of bindin` of Ab0? "7908# to CEA by scFv Falcon plates "85!well# were coated with 099 ml "4 mg:ml# of a solution of rCEA "Vitro Diagnostics\ Inc[\ Littleton\ CO\ U[S[A[# at 3>C overnight[ Following blocking with BSA!PBS as above\ 099 ml of 014I!7908 "099\999 cpm# mixed with indicated concentrations of scFv were added to each well[ After 1 h incubation at room temperature\ the plates were washed thoroughly with PBS[ Radioactivity remaining in the wells was mea!

sured in a gamma counter[ Assays were performed at least in triplicate and samples with SDs less than 09) were used to calculate the mean[ Percentage inhibition was calculated according to the formula] Percentage inhi! bition  ð0−""RT−RC#:"Rmax−RC##Ł×099\ where RT is the mean radioactivity of the experimental well\ Rmax\ radioactivity in the absence of any inhibitor and RC is the background radioactivity[ 1[8[ Immunization Three 6Ð7 week old female C46BL:5 mice per group were immunized i[p[ with 09Ð099 mg of scFv or scFv!KLH in 099 ml PBS after emulsi_cation with CFA[ Subsequent immunizations were performed s[c[ with IFA\ using the same range of protein concentration[ Proteins were con! jugated to KLH by glutaraldehyde and the conjugates were dialyzed extensively against PBS "Bhattacharya! Chatterjee et al[\ 0877#[ Sera were drawn from the tail vein before each immunization and stored at −19>C for assay[ 1[09[ Detection of anti!CEA antibodies For the detection of anti!CEA antibodies "Ab0?# in the sera of mice immunized with scFv\ 85!well plates were coated with rCEA\ blocked and washed as described above[ Sera from immunized mice were diluted in PBS as indicated in the legends to the _gures and 099 ml of the sample was added per well[ After incubation at 3>C overnight\ the plates were washed with PBS[ Then 099 ml of goat anti!mouse IgG conjugated with alkaline phos! phatase "0 ] 0999!fold dilution# was added to each well[ The plates were incubated at room temperature for 1 h[ After thorough washing with PBS\ 099 ml of p!nitro! phenylphosphate dissolved in diethanolamine bu}er "0 mg:ml # was added to each well[ The absorbance at 394 nm was determined in an ELISA reader[ Each sample was analyzed in triplicate to obtain the mean[ 1[00[ Idiotype analysis of Ab2 ELISA plates were coated with 099 ml of a solution of 7908 "Ab0#\ 2H0 or CEA "4 mg:ml# in PBS and blocked with BSA as described above[ To each well 49 ml of diluted serum and 49 ml of 014I!labeled antibodies "2H0 or 7908\ as appropriate # containing 099\999 cpm in 0) BSA in PBS were added simultaneously[ After incubation at room temperature for 1 h\ the plates were washed and the radioactivity was determined as described above[ 1[01[ Immune ~ow cytometry CEA positive MC!27cea "Fox et al[\ 0889# and CEA negative MC!27 "Robbins et al[\ 0880# cells "9[4×095:tube# were reacted with 099 ml of mouse serum

P[K[ Tripathi et al[:Molecular Immunology 24 "0887# 742Ð752

746

diluted 0 ] 19 with PBS or 099 ml of 7908 "1 mg # for 0 h at 3>C[ After washing with PBS\ the cells were incubated with 049 ml of 0 ] 49 diluted goat anti!mouse F"ab?#1 IgG! FITC!labeled antibody "Tago\ Inc[\ Burlingame\ CA\ U[S[A[# for 0 h at 3>C[ The labeled cells were washed twice with PBS\ _xed in 1) paraformaldehyde\ and ana! lyzed by immune ~ow cytometry "FACStar\ Becton Dick! inson\ San Jose\ CA\ U[S[A[#[ 2[ Results 2[0[ Expression of various constructs of 2H0 scFv To determine the con_guration of an anti!idiotype antibody necessary for antigen mimicry\ we designed vec! tors for the expression of four di}erent formats of scFv] VH!Ln!VL\ VL!Ln!VH\ VH!VL and VL!VH[ These scFv fragments contain the framework 0 through frame! work 3 of the variable regions of each of the heavy and light chains of 2H0[ We analyzed the total synthesis of the proteins and distribution of proteins in bacteria by taking small culture samples at various time points[ The amounts of induced proteins were analyzed by SDSÐPAGE[ We found that the synthesis of the induced proteins leveled o} in about 3 h "½0mg:ml culture medium# and 69) of the induced protein accumulated in the periplasm[ Analysis of the culture supernatant after 099!fold concentration showed that very little protein was secreted in the medium even after 05 h of incubation "data not shown#[ We checked the purity of the induced scFv by SDSÐPAGE[ The SDSÐ PAGE pattern of the puri_ed scFv in a 3Ð19) non! reducing gradient gel is shown in Figure 0A[ In all sam! ples a broad protein band ½16 Kd could be detected by staining with Coomassie Blue[ Similar patterns of protein bands were obtained by SDSÐPAGE under reducing con! ditions[ Analysis of the proteins with a lower sample load "½0 mg:well#\ demonstrated that the protein was a doublet\ regardless of whether the protein was isolated from the periplasmic fraction or from the total cell extract "data not shown#[ Yield of scFv obtained from periplasmic fractions ranged from 349Ð599 mg:l of culture medium\ whereas yield with total cell extracts varied between 649Ð0199 mg:l[ Preparartion of scFv from the periplasmic fractions involves handling of large volumes of bu}ers "799 ml bu}er:l of culture medium# and the biological activities of the scFv were similar[ Therefore\ for simplicity and higher yields\ subsequent experiments were performed with proteins obtained from total cellular extracts[ 2[1[ Relative bindin` activity of various forms of 2H0 scFv Ab0 Binding activity of various con_gurations of 2H0 scFv to the Ab0\ 7908\ was determined by ELISA and the

Fig[ 0[ Analysis of scFv formats of 2H0 by SDSÐPAGE[ "A# Puri_ed\ renatured proteins "09 mg:lane# were electrophoresed through a 3Ð19) gradient gel under non!reducing conditions and stained with Coomassie Blue as described in Materials and methods[ Lane 0\ VH!VL^ lane 1\ VL!VH^ lane 2\ VH!Ln!VL^ lane 3\ VL!Ln!VH[ "B# Proteins were electrophoresed in a 09) SDS gel under non!reducing conditions\ transferred to nitrocellulose membranes and immunoblot was developed with mAb 7908 as described in Materials and methods[ Position of the molecular weight markers are shown on the sides[

results of a representative experiment are shown in Fig[ 1[ Falcon 85!well plates were coated with 7908\ and 09 mg of each of the puri_ed scFv was added in each well[ ScFv bound by 7908 was detected by reaction of nickel! nitrilotriacetic acid to the His=Tag part of scFv[ Among the four con_gurations\ only VH!Ln!VL showed sig! ni_cant binding to 7908[ The preferential binding of VH! Ln!VL to 7908 is possibly not due to conditions of rena! turation\ since similar results were obtained by the rena! turation folding by two di}erent methods "Fig[ 1#[ These

747

P[K[ Tripathi et al[:Molecular Immunology 24 "0887# 742Ð752

patterns of binding were obtained on numerous occasions with di}erent concentrations of scFv "0Ð099 mg# as well as with proteins prepared from bacteria grown under di}erent cultural conditions[ The binding activity of VH! Ln!VL was stable for at least 1 months at 3>C in PBS at 099Ð199 mg:ml[ The binding of 7908 to various formats of scFv was studied by immunoblot experiments[ Puri_ed proteins were separated on a 09) non!denaturing SDS gel and transferred to a nitrocellulose membrane as described under Materials and methods[ Results of a representative immunoblot experiment with the scFv renatured by the one!step column procedure is shown in Fig[ 0B[ Only VH!Ln!VL demonstrated a reactive band at ½16 Kd[ Faintly reactive bands at the high molecular regions are probably not aggregates\ since these were also present in reducing gels[ Similar results were obtained when rena! turation was performed by the two!step procedure "data not shown#[ From these results\ we concluded\ that among the four scFv con_gurations\ only VH!Ln!VL was capable of binding 7908[

"Chakraborty et al[\ 0884b# was used as the control[ The results of a representative experiment are shown in Fig[ 2[ VH!Ln!VL had the highest binding inhibition of Ab0 to CEA[ VL!Ln!VH also inhibited binding\ but only two! thirds of that by VH!Ln!VL[ Maximum inhibition by intact 2H0 was achieved at a concentration of ½0 mg:well "Fig[ 2#[ We found that the concentration of VH!Ln!VL required for 49) inhibition was one log higher than the concentration of intact 2H0[ We believe this is due to the abnormal folding of scFv in bacterial cells\ which could not be completely renatured in vitro[ 2[3[ Immuno`enicity of VH!Ln!VL

Binding competition assays were performed to deter! mine whether the scFv fragments synthesized in bacteria retained the antigen mimicry of intact 2H0[ Labeled 7908 was allowed to bind to CEA coated onto 85!well plates\ in the absence and presence of increasing concentrations of intact 2H0 and various scFv forms[ An isotype matched\ unrelated anti!idiotype antibody\ 00D09

Among the various scFv con_gurations\ only VH!Ln! VL demonstrated signi_cant binding to the Ab0 and caused the highest inhibition of Ab0 binding to antigen[ It is likely that the VH!Ln!VL format most closely resembles the intact 2H0 molecule[ To determine whether VH!Ln!VL retains the immunogenicity of the intact 2H0 by generating an Ab0? immune response\ we vaccinated C46BL:5 mice with naked VH!Ln!VL and VH!Ln!VL conjugated with KLH[ As a control\ a mock vaccination was performed with PBS containing CFA[ Sera were drawn from the mice before each immunization[ To deter! mine the induction of Ab0?\ plates were coated with CEA and CEA bound mouse antibodies were detected by ELISA using goat anti!mouse Ig!alkaline phosphatase conjugate as the second antibody[ The results of the assay are shown in Fig[ 3[ Ab0? was generated after the second or third boost in all the mice immunized with either the naked scFv "Fig[ 3A# or scFv!KLH conjugate "Fig[ 3B#[

Fig[ 1[ Relative binding of scFv proteins by ELISA[ Plates were coated with mAb 7908 and binding of the scFv was determined by reaction with nickel!nitrilotriacetic acid!alkaline phosphatase conjugate as described in Material and methods[ Results with 09 mg of puri_ed\ renatured protein per well are shown[ Controls without scFv or 7908 were negligible[

Fig[ 2[ Inhibition of binding of anti!CEA mAb to CEA by puri_ed\ renatured 2H0 derived scFv[ Plates were coated with CEA and binding of 014I!7908 in the absence and presence of increasing concentrations of intact anti!idiotype antibody and scFv proteins was determined as described in Materials and methods[ As control\ 00D09 an isotype matched\ unrelated intact anti!idiotype antibody "Chakraborty et al[\ 0884b# was used[

2[2[ Inhibition of bindin` of Ab0 to CEA by various forms of 2H0 scFv

748

P[K[ Tripathi et al[:Molecular Immunology 24 "0887# 742Ð752 Table 2 Abl? induced in mice immunized with 2H0 single chain vaccinesa Amount of protein "mg# Vaccine

09

14

49

099

ScFv

9[20Ð0[52b "9[66#c 9[44Ð1[21 "0[45#

9[32Ð0[00 "9[65# 9[34Ð9[78 "9[55#

9[36Ð0[91 "9[67# 9[43Ð0[23 "9[76#

9[51Ð0[31 "0[99# 9[44Ð9[84 "9[66#

ScFv!KLH

a Mice were injected with the vaccines and Ab0? antibodies "OD394# induced after the 3th immunization were assayed by ELISA with 0 ] 099 diluted sera as described in the Materials and methods[ Control values with a pooled normal mouse serum and mean of 2 mice immunized with an isotype matched unrelated anti!Id antibody 0A6 "Sen et al[\ 0887# were 9[05 and 9[03 respectively[ b Range[ c Mean[

Fig[ 3[ Detection of anti!CEA antibodies in mice immunized with VH! Ln!VL[ Groups of mice "2 in each group# were immunized with 14 mg of naked VH!Ln!VL "A# or VH!Ln!VL!KLH conjugate "B#[ Sera were drawn before each injection and diluted 49Ð199 fold with PBS for the assay of induced anti!CEA antibody[ Each sample was assayed in triplicate[ The mean and SEM in each group are shown in the graph[ Details are described in Materials and methods[

The level of Ab0? reached a plateau after 1Ð2 injections[ Experiments described in Fig[ 3 were performed with 14 mg of immunogen[ Patterns of induction of anti!CEA antibodies were similar with di}erent concentrations of the immunogen ranging from 09Ð099 mg of vaccine "Table 2#[ 2[4[ Idiotype analysis of Ab2 "Ab0?# induced by immu! nization with VH!Ln!VL Results described above demonstrated that\ at least a portion of the polyclonal Ab2 reacted with the nominal antigen\ CEA and are true Ab0?[ To determine whether the Ab2 shared the same idiotope with the Ab0 mAb 7908\ the inhibition of binding of Ab0 to Ab1 by the diluted sera from immunized C46BL:5 was assayed[

Results of these experiments are summarized in Table 3[ Binding of 7908 "Ab0# to 2H0"Ab1# was inhibited by 0 ] 099 diluted sera from mice immunized with naked scFv as well as scFv conjugated to KLH[ This binding\ although low\ was consistent in three independent experi! ments[ Binding of 7908 to CEA was also inhibited by these sera[ No inhibition of binding was observed with pooled sera of mice immunized with PBS or pooled sera from mice immunized with an isotype matched\ unrelated anti!idiotype antibody 0A6 "Sen et al[\ 0887#[ These results suggested that the Ab2 induced in mice by the VH!Ln!VL vaccine shared the same idiotype as Ab0\ 7908 and is Ab0? type[ 2[5[ Flow cytometric analysis of Ab0? To further con_rm the nature of the Ab0? induced in the sera of C46BL:5 mice by immunization with VH!Ln! VL\ ~ow cytometric analyses of CEA!positive MC!27cea

Table 3 Idiotype analysis of Ab2 induced in mice immunized with single chain 2H0 fragmentsa Vaccine

7908 Coat 2H0 Bind

2H0 Coat 7908 Bind

CEA Coat 7908 Bind

ScFv ScFv!KLH 0A6!KLH PBS

1922 1124 9 9

0620 0122 9 9

0122 0829 9 9

a Percentage inhibition "mean2SEM# was determined as described in Materials and methods[ Sera from mice immunized four times with 14 mg of the vaccine were pooled for the assay[ Idiotype analysis was carried out with mouse serum diluted 0 ] 099 with PBS[ Pooled sera from 4 mice immunized with an isotype matched unrelated antibody\ 0A6 "20# conjugated to KLH and sera from mice immunized with PBS were used as controls[

759

P[K[ Tripathi et al[:Molecular Immunology 24 "0887# 742Ð752

and CEA!negative MC!27 cells were performed with diluted sera from immunized mice[ Pooled sera from three mice\ before immunization and after four immu! nizations with either naked scFv or scFv!KLH conjugate was used for this assay[ Results presented in Fig[ 4 dem! onstrate that sera from mice immunized with either the free scFV or scFv!KLH bind to CEA on the surface of MC!27cea cells "Fig[ 4J and 4I #\ identical to the monoclonal anti!CEA antibody\ 7908 "Fig[ 4H#[ No binding was observed with the CEA!negative MC!27 cells "Fig[ 4D and E#[ Results were also negative with pre! immune sera "Fig 4B and G#[ These results provide additional evidence for CEA mimicry by VH!Ln!VL[

3[ Discussion In scFv constructs the carboxy terminus of one variable domain is joined to the amino terminus of the second variable domain by a Ln of appropriate length and ~exi! bility[ The scFv can be constructed with the sequence VH!Ln!VL or VL!Ln!VH "Huston et al[\ 0880#[ The VH! VL construct typically exhibits Euclidean distances between Ln termini of 18Ð24 _\ whereas the VL!VH orientation generally exhibits distances that are 4Ð09 _ longer for the same Fv "Huston et al[\ 0884#[ Thus\ di}er! ential orientation of a domain may distort the native Fv conformation[ An anti!idiotype antibody acts as an antigen intended to induce Ab0? in the injected host[ Distortion of the scFv derived from an anti!idiotype anti! body is likely to a}ect its antigen mimicry[ With 2H0 scFv\ VH needs to be in the amino terminal for antigen mimicry\ and probably for induction of Ab0?\ the clini! cally relevant subgroup of Ab2 which binds the nominal antigen[ Francisco et al[ "0884# made two types of anti! CD39 immunotoxin constructs consisting of the scFv fused to a truncated form of Pseudomonas exotoxin "PE39# and studied the binding of these molecules to CD39[ Their VL!Ln!VH format had a binding capacity 09!fold higher than the corresponding VH!Ln!VH form[ On the other hand\ using a similar scFv immunotoxin with the anti!Tac Ab\ Batra et al[ "0889# did not detect any e}ect of the orientation of the variable domains[ The VH!Ln!VL format of another scFv\ directed against the Salmonella serotype B!O antigen\ showed 09!fold higher a.nity for the antigen than the corresponding VL!Ln! VH form "Anand et al[\ 0880#[ Thus\ the domain order necessary for a scFv for antigen binding is dependent on the structure of the original antibody[ However\ the requirement for VH orientation at amino terminus of the 2H0 scFv for antigen mimicry may not be valid for other anti!idiotype antibodies[ Tsumoto et al[ "0883# reported that the level of expression of a scFv is a}ected by the order of the variable domains\ with the yield of VL!Ln!VH being signi_cantly higher than that of VH!Ln!VL[ However\ the expression

of any of the 2H0 scFv constructs was not a}ected by the domain order or the presence of the Ln "Fig[ 0#[ By using a Ln that is too short to allow pairing between the domains on the same chain\ the domains are forced to pair with the complementary domains of another chain and create two antigen!binding sites[ These types of dim! eric antibody fragments called {diabodies|\ showed higher a.nity for the antigen than the scFv formats "Holliger et al[\ 0882#[ In this study\ two formats of 2H0 scFv without the Ln\ VH!VL and VL!VH\ did not bind to 7908 "Ab0#[ Moreover\ by analysis of these proteins by SDSÐPAGE\ dimers were not detected under reducing and non!reduc! ing conditions "Fig[ 0#[ Among the four formats of 2H0 scFv\ only VH!Ln! VL showed binding to 7908[ It is unlikely that these di}erences in the binding to 7908 was due to renaturation conditions\ since similar results were obtained by two di}erent refolding techniques "Fig[ 1#[ The results were also independent of the concentrations of scFv protein "0Ð099 mg:well#[ The maximum level of binding was reached at a protein concentration of 09 mg:well regard! less of the method of renaturation[ In this ELISA\ scFv bound to 7908 was detected by a color reaction involving the "His#5 tag[ Whereas\ positive color reactions may be a}ected by the accessibility of nickel!nitrilotriacetic acid! alkaline phosphatase conjugate to the "His#5 tag\ results of the immunoblot experiments rule out such a possi! bility[ In immunoblot experiments\ binding was inde! pendent of the "His#5 tag[ In these experiments\ scFv proteins were bound to the nitrocellulose membranes\ and excess 7908 was equally available for binding to the various scFv forms[ However\ 7908 showed binding to only VH!Ln!VL "Fig[ 0B#[ Moreover\ results of the inhi! bition of binding of 7908 to CEA by intact 2H0 and various forms of scFv "Fig[ 2# also suggested that among the scFv proteins\ only VH!Ln!VL had the ability to bind signi_cantly to 7908[ Refolding of the recombinant mammalian protein expressed in bacteria appears to be incomplete[ In experi! ments described in Fig[ 2\ at least 09 times as much VH! Ln!VL protein was needed compared to intact 2H0 for 49) inhibition of binding of 7908 to CEA[ Since the molecular weight of VH!Ln!VL is one!sixth that of 2H0\ only ½0Ð1) of the bacterial protein appeared to be active in the binding inhibition assay[ Interestingly\ insp! ite of this\ the induction of Ab0? by VH!Ln!VL as an immunogen in in vivo studies was higher than the intact 2H0^ 1[4! and 3[9!fold respectively with scFv and scFv! KLH[ Ab0? was not detected in the sera of mice immunized with as much as 099 mg of naked 2H0\ even after 4Ð5 immunizations unless it was conjugated to a carrier such as KLH "Pervin et al[\ 0886#[ In contrast\ 09 mg of naked VH!Ln!VL "equivalent to ½59 mg of intact 2H0# was able to induce signi_cant Ab0? in the immunized mice and this titer could be enhanced by a factor of 1 when the

P[K[ Tripathi et al[:Molecular Immunology 24 "0887# 742Ð752

750

Fig[ 4[ Immune ~ow cytometric analysis of sera from mice immunized with 2H0 derived scFv\ VH!Ln!VL[ Groups of mice "2:group# were immunized with 14 mg of naked VH!Ln!VL "scFv# or VH!Ln!VL!KLH conjugate "scFv!KLH# as in Fig[ 3[ Pre!immune sera and the sera after the 3th immunization were pooled and reacted with CEA!negative MC!27 "AÐE# and CEA!positive MC!27cea "FÐJ# cells[ Reaction with PBS "A\ F#^ diluted pre!immune sera "B\ G#^ anti!CEA mAb\ 7908^ "C\ H#^ sera from mice immunized with scFv!KLH "D\ I# and naked scFv "E\ J# were performed as described in Materials and methods[

751

P[K[ Tripathi et al[:Molecular Immunology 24 "0887# 742Ð752

scFv was conjugated to KLH "Table 2#[ A comparision of Ab0? induced in the sera of mice immunized with scFv! KLH vs 2H0!KLH demonstrated that the level of Ab0? induced with the scFv conjugate was ½3 times as much as with 2H0 conjugate "data not shown#[ Idiotype analy! sis of the Ab2 from the sera of mice immunized with VH! Ln!VL\ by binding inhibition of Ab0 to Ab1 and binding inhibition of Ab0 to antigen "Table 3#\ demonstrated that the Ab2 had the properties of an Ab0?[ The Ab0? nature of the induced antibody was con_rmed by analysis of the mouse sera by immuno ~ow cytometric analysis\ dem! onstrated that the antibody induced by naked scFv and scFv!KLH speci_cally bound to only the CEA positive cells "Fig[ 4#[ Since we did not test other scFv formats\ we cannot rule out the possibility that other forms of scFv can also induce Ab0? in immunized mice[ The results of binding studies lead us to believe that VH!Ln!VL most closely resembled the intact 2H0[ Critical for our studies is the _nding that VH!Ln!VL can induce Ab0? in immunized mice and the level of this antibody was higher compared to intact 2H0[ Ab0? is the most clinically relevant anti! anti!idiotype antibody\ which can bind to the nominal antigen and be expected to show an anti!tumor e}ect[ In contrast to intact antibody\ this type of fragment can be used for the repeated immunization of cancer patients without invoking human anti!mouse antibody response[ In addition\ immunogens prepared by fusion of antibody to other proteins such as cytokines can be easily prepared using scFv in large quantities in bacterial fermentors[ Antibody!cytokine fusion proteins showed enhanced immunity in injected hosts without using an adjuvant or carrier proteins in an anti!idiotype lymphoma model "Tao and Levy\ 0882#[ Recent _ndings that inoculation with plasmids encoding a variety of proteins leads to T cell and antibody responses in vivo against these proteins provides a novel means of active speci_c immunization by plasmid vaccination "Conry et al[\ 0884^ Wang et al[\ 0884#[ Vaccination with plasmids or live viruses express! ing scFv of an anti!idiotype antibody\ thus\ may be used for cancer therapy[ This study suggests that DNA vac! cines based on the structure of 2H0 should have the format VH!Ln!VL[ Acknowledgments We thank Dr Je}rey Schlom "NIH# for the MC!27 and MC!27cea cells\ Dr L[ Kelly "The Lucille Parker Markey Cancer Center# for critical review of the manuscript[ This work was supported in part by NIH grants RO0 CA61662 and RO0 CA61907[ References Altschul\ S[F[\ Gish\ W[\ Miller\ W[\ Myers\ E[W[\ Lipman\ D[J[\ 0889[ Basic local alignment search tool[ J[ Mol[ Biol[ 104\ 392Ð309[

Anand\ N[N[\ Mandal\ S[\ MacKenzie\ C[R[\ Sadowska\ J[\ Sigurskjold\ B[\ Young\ N[M[\ Bundle\ D[R[\ Narang\ S[A[\ 0880[ Bacterial expression and secretion of various single!chain Fv genes encoding proteins speci_c for a Salmonella serotype B O!antigen[ J[ Biol[ Chem[ 155\ 10763Ð10768[ Batra\ J[K[\ FitzGerald\ D[\ Gately\ M[\ Chaudhary\ V[K[\ Pastan\ I[\ 0889[ Anti!Tac"Fv#!PE39\ a single chain antibody Pseudomonas fusion protein directed at interleukin 1 receptor bearing cells[ J[ Biol[ Chem[ 154\ 04087Ð04191[ Bhattacharya!Chatterjee\ M[\ Chatterjee\ S[K[\ Vasile\ S[\ Seon\ B[K[\ Kohler\ H[\ 0877[ Idiotype vaccines against human T cell leukemia[ II[ Generation and characterization of a monoclonal idiotype cas! cade "Ab0\ Ab1\ and Ab2#[ J[ Immunol[ 030\ 0287Ð0392[ Bhattacharya!Chatterjee\ M[\ Foon\ K[A[\ Kohler\ H[\ 0880[ Anti! Idiotype monoclonal antibodies as vaccines for human cancer[ Intern[ Rev[ Immunol[ 6\ 178Ð291[ Bhattacharya!Chatterjee\ M[\ Mukerjee\ S[\ Biddle\ W[\ Foon\ K[A[\ Kohler\ H[\ 0889[ Murine monoclonal anti!idiotype antibody as a potential network antigen for human carcinoembryonic antigen[ J[ Immunol[ 034\ 1647Ð1654[ Bird\ R[E[\ Hardman\ K[D[\ Jacobson\ J[W[\ Johnson\ S[\ Kaufman\ B[M[\ Lee\ S[M[\ Lee\ T[\ Pope\ S[H[\ Riordan\ G[S[\ Whitlow\ M[\ 0877[ Single!chain antigen!binding proteins[ Science 131\ 312Ð315[ Bona\ C[A[\ Kohler\ H[\ 0873[ In Ventor\ J[C[\ Fraser\ C[M[\ Linstrom\ J[ "Eds[#[ Antiidiotypic antibodies and internal images in mon! oclonal and anti!idiotypic antibodies[ Alan R[ Liss\ New York\ pp[ 030Ð038[ Buchner\ J[\ Pastan\ I[\ Brinkmann\ U[\ 0881[ A method for increasing the yield of properly folded recombinant fusion proteins] single! chain immunotoxins from renaturation of bacterial inclusion bodies[ Anal Biochem[ 194\ 152Ð169[ Casey\ J[L[\ Keep\ P[A[\ Chester\ K[A[\ Robson\ L[\ Hawkins\ R[E[\ Begent\ R[H[\ 0884[ Puri_cation of bacterially expressed single chain Fv antibodies for clinical applications using metal chelate chro! matography[ J[ Immunol[ Methods 068\ 094Ð005[ Chakraborty\ M[\ Foon\ K[A[\ Kohler\ H[\ Bhattacharya!Chatterjee\ M[\ 0884a[ Preclinical evaluation in nonhuman primates of an anti! idiotypic antibody that mimicks the carcinoembryonic antigen[ J[ Immunother Emphasis Tumor Immunol[ 07\ 84Ð092[ Chakraborty\ M[\ Mukerjee\ S[\ Foon\ K[A[\ Kohler\ H[\ Ceriani\ R[L[\ Bhattacharya!Chatterjee\ M[\ 0884b[ Induction of human breast cancer!speci_c antibody responses in cynomolgus monkeys by a murine monoclonal anti!idiotype antibody[ Cancer Res[ 44\ 0414Ð 0429[ Chatterjee\ S[K[\ Tripathi\ P[K[\ Chakraborty\ M[\ Yannelli\ J[\ Wang\ H[\ Foon\ K[A[\ Maier\ C[C[\ Blalock\ J[E[\ Bhattacharya!Chat! terjee\ M[\ 0887[ Molecular Mimicry of Carcinoembryonic Antigen by Peptides Derived from the Structure of an Anti!Idiotype Anti! body[ Cancer Res[ 47\ 0106Ð0113[ Chomczynski\ P[\ Sacchi\ N[\ 0876[ Single!step method of RNA iso! lation by acid guanidinium thiocyanate!phenol!chloroform extrac! tion[ Anal Biochem[ 051\ 045Ð048[ Conry\ R[M[\ LoBuglio\ A[F[\ Loechel\ F[\ Moore\ S[E[\ Sumerel\ L[A[\ Barlow\ D[L[\ Pike\ J[\ Curiel\ D[T[\ 0884[ A carcinoembryonic antigen polynucleotide vaccine for human clinical use[ Cancer Gene Ther[ 1\ 22Ð27[ Foon\ K[A[\ Chakraborty\ M[\ John\ W[J[\ Sherratt\ A[\ Kohler\ H[\ Bhattacharya!Chatterjee\ M[\ 0884[ Immune response to the car! cinoembryonic antigen in patients treated with an anti!idiotype antibody vaccine[ J[ Clin[ Invest[ 85\ 223Ð231[ Foon\ K[A[\ John\ W[J[\ Chakraborty\ M[\ Sherratt\ A[\ Garrison\ J[\ Flett\ M[\ Bhattacharya!Chatterjee\ M[\ 0886[ Clinical and immune responses in advanced colorectal cancer patients treated with anti! idiotype monoclonal antibody vaccine that mimics the car! cinoembryonic antigen[ Clinical Cancer Research 2\ 0156Ð0165[ Fox\ B[A[\ Spiess\ P[J[\ Kasid\ A[\ Puri\ R[\ Mule\ J[J[\ Weber\ J[S[\ Rosenberg\ S[A[\ 0889[ In vitro and in vivo antitumor properties of

P[K[ Tripathi et al[:Molecular Immunology 24 "0887# 742Ð752 a T!cell clone generated from murine tumor!in_ltrating lympho! cytes[ J[ Biol[ Response Mod[ 8\ 388Ð400[ Francisco\ J[A[\ Gilliland\ L[K[\ Stebbins\ M[R[\ Norris\ N[A[\ Ledbet! ter\ J[A[\ Siegall\ C[B[\ 0884[ Activity of a single!chain immunotoxin that selectively kills lymphoma and other B!lineage cells expressing the CD39 antigen[ Cancer Res[ 44\ 2988Ð2093[ Holliger\ P[\ Prospero\ T[\ Winter\ G[\ 0882[ {Diabodies|] small bivalent and bispeci_c antibody fragments[ Proc[ Natl[ Acad[ Sci[ U[S[A[ 89\ 5333Ð5337[ Holzinger\ A[\ Phillips\ K[S[\ Weaver\ T[E[\ 0885[ Single!step puri! _cation:solubilization of recombinant proteins] application to sur! factant protein B[ Biotechniques 19\ 793Ð795\ 797[ Huston\ J[S[\ Geoge\ A[J[T[\ Tai\ M[S[\ McCartney\ J[E[\ Jin\ D[\ Segal\ D[M[\ Keck\ P[\ Oppermann\ H[\ 0884[ In Borrebaeck\ C[A[K[ "Eds[#[ Single!chain Fv design and production by preparative fold! ing[ Oxford University Press\ New York\ pp[ 074Ð116[ Huston\ J[S[\ Mudgett!Hunter\ M[\ Tai\ M[S[\ McCartney\ J[\ Warren\ F[\ Haber\ E[\ Oppermann\ H[\ 0880[ Protein engineering of single! chain Fv analogs and fusion proteins[ Methods Enzymol[ 192\ 35Ð 77[ Kabat\ E[A[\ Wu\ T[T[\ Perry\ H[M[\ Gottesman\ K[S[\ Foeller\ C[\ 0880[ Sequences of Proteins of Immunological Interest[ U[S[ Department of Health and Human Services\ Public Health Service\ National Institutes of Health\ Bethesda[ Laemmli\ U[K[\ 0869[ Cleavage of structural proteins during the assembly of the head of bacteriophage T3[ Nature 116\ 579Ð574[ Mayforth\ R[D[\ 0882[ Idiotypes and anti!idiotypic antibodies[ Aca! demic Press\ Inc[\ San Diego\ pp[ 037Ð055[ Muraro\ R[\ Wunderlich\ D[\ Thor\ A[\ Lundy\ J[\ Noguchi\ P[\ Cun! ningham\ R[\ Schlom\ J[\ 0874[ De_nition by monoclonal antibodies of a repertoire of epitopes on carcinoembryonic antigen di}er! entially expressed in human colon carcinomas versus normal adult tissues[ Cancer Res[ 34\ 4658Ð4679[ Pervin\ S[\ Chakraborty\ M[\ Bhattacharya!Chatterjee\ M[\ Zeytin\ H[\ Foon\ K[A[\ Chatterjee\ S[K[\ 0886[ Induction of antitumor immun! ity by an anti!idiotype antibody mimicking carcinoembryonic anti! gen[ Cancer Res[ 46\ 617Ð623[ Raag\ R[\ Whitlow\ M[\ 0884[ Single!chain Fvs[ Faseb J[ 8\ 62Ð79[

752

Robbins\ P[F[\ Kantor\ J[A[\ Salgaller\ M[\ Hand\ P[H[\ Fernsten\ P[D[\ Schlom\ J[\ 0880[ Transduction and expression of the human car! cinoembryonic antigen gene in a murine colon carcinoma cell line[ Cancer Res[ 40\ 2546Ð2551[ Sambrook\ J[\ Fritsch\ E[F[\ Maniatis\ T[\ 0878[ Molecular Cloning] A Laboratory Manual[ Cold Spring Harbor Laboratory Press\ Cold Spring Harbor[ Sen\ G[\ Chakraborty\ M[\ Foon\ K[A[\ Reisfeld\ R[A[\ Bhattacharya! Chatterjee\ M[\ 0887[ Induction of IgG antibodies by an anti!idiot! ype antibody mimicking disialoganglioside GD1[ J[ Immunother[ 10\ 64Ð72[ Steward\ A[M[\ Nixon\ D[\ Zamcheck\ N[\ Aisenberg\ A[\ 0863[ Car! cinoembryonic antigen in breast cancer patients] serum levels and disease progress[ Cancer 22\ 0135Ð0141[ Tao\ M[H[\ Levy\ R[\ 0882[ Idiotype:granulocyte!macrophage colony! stimulating factor fusion protein as a vaccine for B!cell lymphoma ðsee commentsŁ[ Nature 251\ 644Ð647[ Towbin\ H[\ Staehelin\ T[\ Gordon\ J[\ 0868[ Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets] pro! cedure and some applications[ Proc[ Natl[ Acad[ Sci[ U[S[A[ 65\ 3249Ð3243[ Tsumoto\ K[\ Nakaoki\ Y[\ Ueda\ Y[\ Ogasahara\ K[\ Yutani\ K[\ Watanabe\ K[\ Kumagai\ I[\ 0883[ E}ect of the order of antibody variable regions on the expression of the single!chain HyHEL09 Fv fragment in E[ coli and the thermodynamic analysis of its antigen! binding properties[ Biochem[ Biophys[ Res[ Commun[ 190\ 435Ð 440[ Vincent\ R[G[\ Chu\ T[M[\ Lane\ W[W[\ Gutierrez\ A[C[\ Stegemann\ P[J[\ Madajewicz\ S[\ 0867[ Carcinoembryonic antigen as a monitor of successful surgical resection in 029 patients with carcinoma of the lung[ J[ Thorac[ Cardiovasc[ Surg[ 64\ 623Ð628[ Wang\ B[\ Merva\ M[\ Dang\ K[\ Ugen\ K[E[\ Williams\ W[V[\ Weiner\ D[B[\ 0884[ Immunization by direct DNA inoculation induces rejec! tion of tumor cell challenge[ Hum[ Gene[ Ther[ 5\ 396Ð307[ Wul_ng\ C[\ Pluckthun\ A[\ 0883[ Protein folding in the periplasm of Escherichia coli[ Mol[ Microbiol[ 01\ 574Ð581[ Xiang\ J[\ Liu\ E[\ Moyana\ T[\ Qi\ Y[\ 0883[ Single!chain antibody variable region!targeted interleukin!1 stimulates T cell killing of human colorectal carcinoma cells[ Immunol[ Cell Biol[ 61\ 164Ð174[