Very high expression of an anti-carcinoembryonic antigen single chain Fv antibody fragment in the yeast Pichia pastoris

Journal of Biotechnology 76 (2000) 157 – 163 www.elsevier.com/locate/jbiotec

Very high expression of an anti-carcinoembryonic antigen single chain Fv antibody fragment in the yeast Pichia pastoris Freya M. Freyre a, Javier E. Va´zquez a, Marta Ayala a, Leonardo Canaa´n-Haden b, Hanssel Bell a, Ivonne Rodrı´guez c, Arturo Gonza´lez c, Alberto Cintado a, Jorge V. Gavilondo a,* a

Di6ision of Immunotechnology and Diagnostics, Center for Genetic Engineering and Biotechnology, PO Box 6162, La Habana 10600, Cuba b Di6ision of Physical Chemistry, Center for Genetic Engineering and Biotechnology, PO Box 6162, La Habana 10600, Cuba c Ga6ac Production Di6ision, Center for Genetic Engineering and Biotechnology, PO Box 6162, La Habana 10600, Cuba Received 8 January 1999; received in revised form 2 August 1999; accepted 6 August 1999

Abstract In this paper we report the development of a recombinant strain of the yeast Pichia pastoris, which secretes an anti-carcinoembryonic antigen single chain Fv (scFv) antibody fragment to the culture supernatant as a biologically active protein, at levels of 1.2 g 1 − 1. The yeast scFv was purified by IMAC, with a final yield of approximately 0.440 g of 93% pure scFv per liter of culture supernatant. The specific activity in ELISA of the yeast scFv was almost three times higher than that of a bacterial periplasmic counterpart. These results reaffirm that the yeast P. pastoris is a suitable host for high level production of scFv antibody fragments with potential in vivo diagnostic and therapeutic applications. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Antibody fragments; scFv; Carcinoembryonic antigen; Pichia Pastoris

1. Introduction Single chain Fv (scFv) antibody fragments are small recombinant proteins in which the variable light (VL) and heavy (VH) chain domains of an antibody molecule are connected via an artificial * Corresponding author. Fax: +53-7-218070. E-mail address: [email protected] Gavilondo)

(J.V.

linker to recreate the original binding site (Raag and Whitlow, 1995). Advantages of scFv over whole antibodies are now explored for radioimmunodetection and for in situ radiotherapy of cancer (Begent et al., 1996; Kairemo, 1996; Pietersz et al., 1998), due to potentially better tumor penetration and blood clearance, and reduced immunogenicity of scFv. Ior-cea.1 is an anti-carcinoembryonic antigen (CEA) mouse monoclonal antibody (MAb)

0168-1656/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 8 - 1 6 5 6 ( 9 9 ) 0 0 1 8 3 - 2

158

F.M. Freyre et al. / Journal of Biotechnology 76 (2000) 157–163

(Tormo et al., 1989), approved in Cuba for in vivo diagnostic radioimaging of colorectal cancer metastases. Using reverse transcriptase polymerase chain reaction (RT-PCR), and starting with RNA from ior-cea.1 hybridoma cells, we have developed several scFv gene constructions that have been expressed as biologically active antibody fragments in the periplasm of Escherichia coli (Ayala et al., 1992; Duen˜as et al., 1994; Pe´rez et al., 1996). High level purification of a c-myc tagged antiCEA scFv variant was achieved using affinity chromatography with 9E10 MAbs (Pe´rez et al., 1996), but low final production yields (ca. 2 mg l − 1 of culture) limited our goal of accumulating enough material for preclinical trials. The exploitation of Pichia pastoris as a tool to produce useful quantities of biologically relevant recombinant proteins has gained special attention in recent years due to the existence of well-established fermentation methods and expression plasmids with very powerful and efficient methanol-regulated promoters. Produced proteins are usually properly folded and P. pastoris has no toxic cell wall pyrogens as E. coli nor contains potentially oncogenic or viral nucleic acids, as mammalian cells (Cregg et al., 1993; Romanos, 1995). Antibody fragments have been produced in Saccharomyces cere6isiae (Wood et al., 1985; Edquist et al., 1991), Trichoderma reesei (Nyysso¨nen et al., 1993.), Schizosaccharomyces pombe (Davis et al., 1991), and the yeast P. pastoris (Ridder et al., 1995; Luo et al., 1995, 1996, 1997, 1997a; Fitzgerald et al., 1997; Gerstmayer et al., 1997). The highest yield of scFv fragments reported to date in a non-bacterial host cell was recently documented by Eldin et al. (1997) that obtained 250 mg l − 1 of an anti-desipramine scFv in the culture supernatant of P. pastoris. These data encouraged us to explore the expression of the anti-CEA scFv in the latter eukaryotic system, as an alternative to our efforts using E. coli as host. In this paper we report the development a recombinant strain of the methylotrophic yeast P. pastoris that secretes the anti-CEA scFv to the culture supernatant as a biologically active

protein, at levels of approximately 1.2 g l − 1. The yeast scFv was purified using immobilized metal ion affinity chromatography (IMAC; Porath 1992), and its specific activity is higher in ELISA than that of the bacterial periplasmic counterpart.

2. Material and methods

2.1. PCR modification of the anti CEA scF6 gene The anti-CEA VH-linker-VL scFv encoding sequence contained in the pF3 plasmid (Pe´rez et al., 1996) was first modified by PCR (Mullis et al., 1986) to include flanking EcoRI and EcoRV restriction sites. PCR was carried out using the PanoTaq thermostable polymerase (Panorama Research, Mountain View), according to the following temperature and time probes: 94°C for 3 min (1 cycle); 94°C for 1 min, 50°C for 1 min, 72°C for 3 min (27 cycles); 72°C for 8 min (1 cycle). The synthetic oligonucleotides GGGAATTCC AGGTGAAGCTCCTAGAGTCG (‘sense’), and CCGATATCTCATTATTTCAGCTCC ACGGAGTCG (‘antisense’), designed over the exact gene sequence, were used. The amplified scFv gene was gel-purified (Qiaquick Gel Extraction kit, Qiagen), EcoRI/ EcoRV-digested (Promega), and cloned into the pPACIB.9+ vector (Sa´nchez et al., 1999), to add a histidine hexapeptide encoding sequence at the 3% end of the insert. XL-1 blue subcloning grade competent cells (Stratagene) were transformed with the construction, grown in antibiotic medium (see below), and recombinant clones identifed by restriction analysis of plasmid mini-preps (Qiagen). The selected recombinant plasmid, denominated p1904His6, was used as a template in a second PCR reaction where the anti-CEA scFv encoding gene, including the 6-histidine tail, was then amplified using synthetic primers that introduced a NcoI site, and adjusted reading frame: CATGCCATGGGGCATCATCTCAGGTGAAG CTCCTA (‘sense’), and CATGCCATGGCTATTAGTGGTGGTGGTG (‘antisense’). PCR was carried out as described above.

F.M. Freyre et al. / Journal of Biotechnology 76 (2000) 157–163

159

2.2. Cloning of the anti CEA scF6 gene in the pPS7 yeast 6ector

2.4. Transformation of P. pastoris with the pPSCEA1904His6 expression plasmid

The P. pastoris yeast expression system used in this study, which includes the expression vector pPS7, and the yeast strain MP36 (his 3), was developed in our Center (Margolles et al., 1992; Yong et al., 1992; Paifer et al., 1994; Rodrı´guez et al., 1994; Jime´nez et al., 1997). The integrative vector pPS7 contains a 1.15 kb fragment of the methanol regulated alcohol oxidase (AOX1) promoter, followed by the signal peptide of S. cere6isiae sucrose invertase (Sucil sp), a unique Ncol cloning site, the 960 bp fragment of the glyceraldehyde-3-phosphate dehydrogenase transcription terminator (GAPt), and the histidine 3 gene (HIS3) from S. cere6isiae. The PCR amplified scFv gene segment was gel-purified (Qiaquick Gel Extraction kit, Qiagen), Ncol-digested (Promega), and cloned into the pPS7 vector. XL-1 blue subcloning grade competent cells (Stratagene) were transformed with the construction, grown in antibiotic medium (see below), and recombinant clones identified by restriction analysis of plasmid mini-preps (Qiagen), followed by sequencing (Sambrook et al., 1989). The selected recombinant plasmid was denominated pPSCEA1904His6. 2.3. Bacterial and yeast culture media

Competent P. pastoris MP36 his3 cells were electroporated by application of an exponential decay wave electric pulse of 12 kV cm − 1, for 4.6 ms, in the presence of the Pvull-linearized recombinant pPSCEA1904his6 construct. For the determination of histidine auxotrophy (His+) cells were plated on MD plates and grown at 30°C for 48–72 h. As control, yeast cells were transformed with the vector pPS7 without insert. For the determination of the methanol utilization phenotype, single colonies of His+ transformants were duplicated on MD plates and MM plates and grown for 2 days at 30°C. A colony Hot-Start PCR analysis was performed to verify integration. One ml of each of the 20 mM primer stocks (CGACAACTTGAGAAGATC, for the AOX1 promoter region, and GTAAATTCACTCTTAAGCCTTGG, hybridizing just 3% of the cloning site in the GAP terminator region) were placed on the bottom of a 0.5 ml PCR tube and heated at 94°C for 1 min. After this time, 30 ml of preheated paraffin wax was gently added to the hot wall of the tube, above the primer solution. The closed tube were kept vertical on ice until 13 ml of the PCR reaction mixture was added on top of the paraffin wax. Each single yeast colony to be analyzed was suspended in 10 ml of distilled water, and added gently into the reaction mixture. The tubes were placed in a preheated thermocycler, with the following profile: 1 cycle at 94°C for 2 min, 25 cycles of 1 min at 94°C for, 1 min at 55°C, and 1 min at 72°C, with a final 7 min extension at 72°C. The recombinant pPSCEA1904his6 plasmid was used as positive control. Plasmid without insert, and MP36 cells transformed with the plasmid without insert, were used as negative controls. Selected yeast clones were used for expression studies.

E. coli cells bearing the recombinant plasmids were grown in Luria Broth (Sambrook et al., 1989) containing ampicillin (100 ug ml − 1). The media used for yeast culture were: (a) MD and MM plates (15 g agar, 13.4 g yeast nitrogen base without amino acids, 0.4 mg biotin, and 20 g dextrose (MD), or 5 ml of 100% methanol (MM), per liter), (b) BMGY or BMMY (10 g yeast extract, 20 g peptone, 100 mM potassium phosphate (pH 5.2), 13.4 g yeast nitrogen base without aminoacids, 0.4 mg biotin, and 10 ml of 95% glycerol (BMGY), or 5 ml of 100% methanol stock solution (BMMY), per liter), and (c) basal salts medium (BSM) supplemented with 3.5% glycerol (7.9 g l − 1 KH2PO4, 7.5 g l − 1 (NH4)SO4, 15 g l − 1 MgSO4.7H2O, 0.22 g l − 1 CaCl2.H2O, 4 ml l − 1, of trace metal solution, and 2 ml l − l, of vitamins), as initial media for yeast fermentations.

2.5. Expression analysis in yeast Single colonies of the His+ phenotype were selected and transferred to 10 ml BMGY in 50 ml culture tubes. Cultures were grown in a roller

160

F.M. Freyre et al. / Journal of Biotechnology 76 (2000) 157–163

apparatus at 28°C until an OD600 of 2 was obtained. At this point cells were harvested by centrifugation, washed once with distilled water, resuspended in 10 ml of BMMY medium, transferred to sterile 50 ml culture tubes, and grown in a roller at 28°C for 3 days. Maintained induction was achieved with 100% methanol pulses each 24 h, to a final concentration of 0.5%, and expression analyzed at different times in the culture supernatant and in the cellular pellet by 15% sodium dodecyl sulfate-polyacrilamyde gel electrophoresis (SDS-PAGE) under reducing conditions (Laemmli, 1970), and by Western blot using a Trans-Blot SD apparatus (BioRad). The nitrocellulose membrane was incubated with specific antiscFv rabbit IgG, produced with purified anti-CEA periplasm scFv preparations obtained using the pF3 plasmid (Pe´rez et al., 1996), followed by horseradish peroxidase (HRPO)-conjugated goat anti-rabbit antibodies (Sigma).

trated and diafiltered using a H10P10/20 hollowfiber cartridge (Amicon) with a cutoff of 10 kDa. Diafiltration was performed adding five volumes of 0.1 M Na2HPO4/NaH2PO4, 0.2 M NaCl, pH 8.0. Purification of the scFv was developed on a Sepharose-IDA-Ni + 2 (Pharmacia) column, equilibrated with 0.1 M Na2HPO4/NaH2PO4, 0.2 M NaCl, pH 8.0. Washing with several column volumes of a pH 5.5 buffer solution was done to eliminate contaminants. Elution was made at pH 4.0. The fractions were neutralized and analyzed by SDS-PAGE and Western blot.

2.6. Production of yeast scF6 in a laboratory fermentor

The biological activity of scFv from yeast was studied with a specific direct ELISA. CEA (National Oncology Center, Havana) was coated overnight at 4°C to 96-well microtiter plates (NUNC) at 0.1 mg per well, using carbonate-bicarbonate buffer, pH 9.6. After washing with PBS, the samples to be studied (yeast culture supernatant for initial activity test, or purified yeast scFv for a better characterization) were applied, and incubated for 1 h at 37°C. Anti-scFv specific rabbit IgG, followed by HRPO-conjugated goat anti-rabbit antibodies, were used to develop the reactions. An anti-CEA scFv produced in the periplasm of E. coli (Pe´rez et al., 1996) and purified by affinity chromatography with 9E10 MAbs was used for specific activity comparison. 1:3 dilutions for both scFv were applied (from 0.09 to 200 mg ml − 1). Negative controls included an irrelevant anti-HBsAg scFv (Ayala et al., 1995), and culture supernatant of the MP36 yeast strain transformed with pPS7 without insert.

The inoculum was first grown in culture tubes with 5 ml of BSM medium at 30°C, and 150 rpm, for 24 h. The culture was then transferred to 250 ml BSM in a 2 l shake flask, and incubated under the same above described conditions. Fermentation was performed in a Biolaffitte fermentor with 4 l working volume. The temperature and pH were controlled at 30°C and 5.5, respectively. Stirrer speed and oxygen supplementation started at 800 rpm, and 1 vvm, and the latter was gradually increased to keep an adequate dissolved oxygen concentration. When the available glycerol was exhausted, the carbon source was changed to induce scFv protein expression. To induce expression, methanol was added to a final concentration of 1% (v/v), and 4 h later an exponential flow was started to keep the methanol concentration at 0.5%. After the level of scFv reached a plateau, P. pastoris cells were removed by centrifugation at 4000 rpm, for 30 min.

2.7. Purification of yeast scF6 Supernatant containing the scFv was concen-

2.8. Protein concentration estimations Protein concentrations were determined as suggested by Bradford (1976) using bovine serum albumin as the standard.

2.9. Anti-CEA ELISA

3. Results and discussion A total of 606 His+ colonies were obtained

F.M. Freyre et al. / Journal of Biotechnology 76 (2000) 157–163

after the transformation of P. pastoris MP36 cells with the linear pPSCEA1 904His6 recombinant plasmid. The PCR analysis of His+ colonies confirmed the presence of the scFv gene in 13 out of 14 studied colonies. From the positive colonies, 7.7 and 92.3% were identified as having the with His+/Muts and His+/Mut+ phenotype, respectively. These phenotypic differences are presumably due to the interruption of the AOX 1 gene by the insertion of the expression plasmid in the case of the Muts phenotype, and integration of the expression plasmid at an alternative site in the case of the Mut+ phenotype. After induction at flask scale, only two transformants were found to secrete a protein of molecular size compatible with the scFv (27.5 kDa; Fig. 1A) to the medium, even at similar amounts. This protein was also recognized as the scFv by Western blot (Fig. 1B). The non-purified culture medium from the transformed cells also recognized CEA in a direct ELISA (Fig. 2).

Fig. 1. Electrophoresis and Western blot analysis of the anti CEA scFv produced in yeast. (A) 15% SDS-PAGE. Lane 1: Molecular weight markers (kDa): 97.4, 66.2, 39.2, 26.6, 21.5, and 14.4. Lane 2: Culture supernatant of the induced recombinant His+/Mut+ yeast strain. Lane 3: Pure scFv fraction after IMAC purification. All samples were adjusted to cat 150 mg total protein per lane. (B) Western-blot analysis. Purified scFv fraction recognized with rabbit anti-scFv specific antibodies. An arrow indicates the position of the scFv.

161

Finally, from that two transformants the Mut+ was selected over the MutS and further scaled up in a large laboratory fermentor, using BSM medium. A yield of 1.2 g of scFv per liter of culture medium was obtained after 41 h of induction, as estimated from SDS-PAGE and protein quantitation. Using the same pPS7 vector system, very high expression levels had been reported for alpha amylase (0.9 g l − 1 with the native secretion signal and 2.5 g l − 1, with the Sucil signal peptide) (Margolles et al., 1992; Paifer et al., 1994), and for the B. microplus Bm86 antigen (1.5 g l − 1, Rodrı´guez et al., 1994). For purification, 4 l of fermentation culture were collected at the end of the 3-day induction period with approximately 0.34 kg l − 1 of cell wet weight. After centrifugation, 2.6 l of supernatant were concentrated, and pH-adjusted to 8.0 by diafiltration. Purification was carried out by IMAC using a Sepharose 4B (IDA)-Ni + 2 column. The purified active scFv antibody fragment was found to migrate as a single band in Coomassie blue-stained SDS-PAGE (Fig. 1A), with an estimated purity of 93%. The final overall yield of scFv was 0.440 g l − 1, which represents 24.2% of the initial amount of scFv calculated to be present in the culture supernatant. The biological activity of the purified yeast scFv fragment was compared with that of the 9E10 affinity-purified periplasmic bacterial scFv (Pe´rez et al., 1996) in ELISA, by registering optical density values produced by similar amounts of antibody fragment of different origin. Fig. 2 shows that for several similar antibody fragment concentrations, the molecule derived from bacteria exhibited less specific activity. This difference could be attributed to incorrectly folded soluble species present in the periplasmic scFv preparation. Our yield and specific activity results definitively point out to the yeast expression as the choice for production of the anti-CEA scFv. Finally, the expression and final yield values described in this paper are the highest yet reported for scFv in this methylotrophic yeast. We are currently improving the concentration and diafiltering steps in order to reduce the loss of valuable protein due to precipitation.

162

F.M. Freyre et al. / Journal of Biotechnology 76 (2000) 157–163

Fig. 2. ELISA to detect specitc anti-CEA biological activity of scFv produced in yeast and bacteria. Polystyrene plates were coated with natural CEA, and samples of recombinant yeast culture supernatant (dilution 1:20 in culture medium), IMAC purified yeast scFv, and 9E10 affinity purified scFv from bacterial periplasm were added and incubated for 1 h at 37°C. An anti-HBsAg scFv was employed as negative control. The specific binding was detected by adding rabbit IgG raised against the anti-CEA scFv. The reaction was developed with an anti-rabbit IgG HRPO-conjugate, followed by substrate solution. Optical densitiy (OD) was estimated at 492 nm.

Acknowledgements We are grateful to Daniel Palenzuela and Marta Duen˜as for helpful discussions, and to the Division of Industrial Biotechnology for the pPS7 vector system.

References Ayala, M., Duen˜as, M., Santos, A., Va´zquez, J., Mene´ndez, A., Silva, A., Gavilondo, J.V., 1992. Bacterial single chain antibody fragments, specific for carcinoembryonic antigen. Biotechniques 13, 790–799. Ayala, M., Balint, R.F., Ferna´ndez-de-Cossı´o, M.E., Canaa´nHaden, L., Larrick, J.W., Gavilondo, J.V., 1995. Variable region sequence modulates periplasmic export of a singlechain Fv antibody fragment in Escherichia coli. Biotechniques 18, 832 – 842. Begent, R.H.J., Verhaar, M.J., Chester, K.A., Casey, J.L., Green, A.J., Napier, M.P., Hope-Stone, L.D., Cushen, N., Keep, P.A., Johnson, C.J., Hawkins, R.E., Hilson, A.J.W., Robson, L., 1996. Clinical evidence of efficient tumor targeting based on single-chain Fv antibody selected from a combinatorial library. Nat. Med. 2, 979–984.

Bradford, M.M., 1976. A rapid and sensitive method for the quantitation of microgram quantities of proteins utilizing the principle of protein-dye binding. J. Biol. Biochem. 72, 248 – 254. Cregg, J.M., Vedvick, T.S., Raschke, W.C., 1993. Recent advances in the expression of forein genes in Pichia pastoris. Bio/Technology 11, 905 – 910. Davis, G.T., Bedzyk, W.D., Voss, E.W., Jacobs, T.W., 1991. Single chain antibody (SCA) encoding genes: one-step construction and expression in eukaryotic cells. Bio/Technology 9, 165 – 169. Duen˜as, M., Va´zquez, J., Ayala, M., Soderlind, E., Ohlin, M., Pe´rez, L., Borrebaeck, C.A.K., Gavilondo, J.V., 1994. Intra- and extracellular expression of a scFv antibody fragment in E. coli: effect of bacterial strains and pathway engineering using GroES/L chaperoning. Biotechniques 16, 476 – 483. Edquist, J., Keranen, S., Penttila, M., Straby, K.B., Knowles, J., 1991. Production of functional IgM Fab fragments by Saccharomyces cere6isiae. J. Biotechnol. 20, 291 – 300. Eldin, P., Pauza, M.E., Hieda, Y., Lin, G., Murtaugh, M.P., Pentel, P.R., Pennell, C.A., 1997. High-level secretion of two antibody single chain Fv fragments by Pichia pastoris. J. Immunol. Methods 201, 67 – 75. Fitzgerald, K., Holliger, P., Winter, G., 1997. Improved tumor targeting by disulphide stabilized diabodies expressed in Pichia pastoris. Protein Eng. 10, 1221 – 1225.

F.M. Freyre et al. / Journal of Biotechnology 76 (2000) 157–163 Gerstmayer, B., Altenschmidt, U., Hoffmann, M., Wels, W., 1997. Costimulation of T cell proliferation by a chimeric B72 antibody fusion protein specifically targeted to cells expressing the erbB2 proto-oncogene. J. Immunol. 158, 4584 – 4590. Jime´nez, E.R., Sa´nchez, K., Roca, H., Delgado, J.M., 1997. Different methanol feeding strategies to recombinant Pichia pastoris cultures producing high level of dextranase. Biotechnol. Tech. 11, 461–466. Kairemo, K.J.A., 1996. Radioimmunotherapy of solid cancers. Acta Oncol. 35, 343 –355. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of head of bacteriophage T4. Nature 227, 680 – 685. Luo, D., Mah, N., Krantz, M., Wilde, K., Wishart, D., Zhang, Y., Jacobs, F., 1995. VL-linker-VH orientation-dependent expression of single chain Fv-containing and engineered disulfide-stabilized bond in the framework regions. J. Biochem. 118, 825 – 831. Luo, D., Mah, N., Wishart, D., Zhang, Y., Jacobs, F., Martin, L., 1996. Construction and expression of bi-functional proteins of single chain Fv with effector domains. J. Biochem. 120, 229 – 232. Luo, D., Geng, M., Noujaim, A.A., Madiyalakan, R., 1997. An engineered bivalent single-chain antibody fragment that increases antigen binding activity. J. Biochem. 121, 831– 834. Luo, D., Mah, N., Krantz, M., Wishart, D., Jacobs, F., Martin, L., 1997a. High level secretion of single chain antibody in Pichia expression system. Biotechnol. Tech. 11, 759 – 761. Margolles, E., Paifer, E., Delgado, J., 1992. High level secretion of a bacterial alpha amylase in the yeast Pichia pastoris. Biotechnol. Applic. 9, 38–47. Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., Erlich, H., 1986. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harbor Symp. Quant. Biol. 51, 263–273. Nyysso¨nen, E., Penttila¨, M., Harkki, A., Saloheimo, A., Knowles, J.K.C., Kera¨nen, S., 1993. Efficient production of antibody fragments by the filamentous fungus Trichoderma reesei. Bio/Technology 11, 591–595. Paifer, E., Margolies, E., Cremata, J., Montesino, R., Herrera, L., Delgado, J.M., 1994. Efficient expression and secretion of recombinant alpha amylase in Pichia Pastoris using two different signal sequences. Yeast 10, 1415–1419.

.

163

Pe´rez, L., Va´zquez, J.E., Ayala, M., Siccardi, A.G., Trisoldi, E., de Lalla, C., Gavilondo, J.V., Sidoli, A., 1996. Production, purification and characterization of an anti-carcinoembryonic antigen recombinant single-chain Fv antibody fragment. Biotechnol. Appl. Biochem. 24, 79 – 82. Pietersz, J.A., Patrick, M.R., Chester, K.A., 1998. Preclinical characterization and in vivo imaging studies of an engineered recombinant technetium-99m-labeled metallothionein-containing anti-carcinoembryonic antigen single-chain antibody. J. Nucl. Med. 39, 47 – 55. Raag, R., Whitlow, M., 1995. Single-chain Fvs. FASEBJ 9, 73 – 80. Ridder, R., Schmitz, R., Legay, F., Gram, H., 1995. Generation of rabbit monoclonal antibody fragments from a combinatorial phage display library and their production in the yeast Pichia pastoris. Bio/Technology 13, 255 – 260. Rodrı´guez, M., Rubiera, R., Penichet, M., Montesino, R., Cremata, J., Falco´n, V., Sa´nchez, G., Bringas, R., Cordove´s, C., Valde´s, M., Lleonart, R., Herrera, L.S., de la Fuente, J., 1994. High level expression of the B. microplus Bm86 antigen in the yeast Pichia pastoris forming highly immunogenic particles for cattle. J. Biotechnol. 33, 135 – 146. Romanos, M.A., 1995. Advances in the use of Pichia pastoris for high-level gene expression. Curr. Opin. Biotechnol. 6, 527 – 533. Sa´nchez, L., Ayala, M., Freyre, F., Pedroso, I, Bell, H., Falco´n, V., Gavilondo, J.V., 1999. High cytoplasmic expression in E. coli, purification, and in vitro refolding of a single chain Fv antibody fragment against the hepatitis B surface antigen. J. Biotechnol. 72, 13 – 20. Tormo, B., Gavilondo, J.V., Domı´nguez, C., Freyre, F.M., Rodrı´guez, T., Biberfeld, P., 1989. CEA in colonic adenocarcinomas and precancerous lesions. An immunohistochemical study with a novel monoclonal antibody. APMIS 97, 1073 – 1080. Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Wood, C.R., Boss, M.A., Kenten, J.H., Calvert, J.E., Roberts, N.A., Emtage, J.S., 1985. The synthesis and in vivo assembly of functional antibodies in yeast. Nature 314, 446 – 449. Yong, V., Gonzalez, M.E., Herrera, L.S., Delgado, J., 1992. The gene HIS 3 of El gen HIS 3 Saccharomyces cere6isiae complements a his mutation of Pichia pastoris. Biotechnol. Applic. 9, 55 – 61.