- Email: [email protected]
Expression of eukaryotic glycosyltransferases in the yeast Pichia pastoris
Biochimie 85 (2003) 413–422 www.elsevier.com/locate/biochi
Expression of eukaryotic glycosyltransferases in the yeast Pichia pastoris Monika Bencúrová, Dubravko Rendic´, Gustáv Fabini, Eva-Maria Kopecky 1, Friedrich Altmann, Iain B.H. Wilson * Glycobiology Division, Institut für Chemie, Universität für Bodenkultur, Muthgasse 18, A-1190 Vienna, Austria Received 22 November 2002; accepted 21 February 2003
Abstract The methylotrophic yeast Pichia pastoris is often used as an organism for the heterologous expression of proteins and has been used already for production of a number of glycosyltransferases involved in the biosynthesis of N- and O-linked oligosaccharides. In our recent studies, we have examined the expression in P. pastoris of Arabidopsis thaliana and Drosophila melanogaster core a1,3-fucosyltransferases (EC 2.4.1.214), A. thaliana b1,2-xylosyltransferase (EC 2.4.2.38), bovine b1,4-galactosyltransferase I (EC 2.4.1.38), D. melanogaster peptide O-xylosyltransferase (EC 2.4.2.26), D. melanogaster and Caenorhabditis elegans b1,4-galactosyltransferase VII (SQV-3; EC 2.4.1.133) and tomato Lewis-type a1,4-fucosyltransferase (EC 2.4.1.65). Temperature, cell density and medium formulation have varying effects on the amount of activity resulting from expression under the control of either the constitutive glyceraldehyde-3-phosphate dehydrogenase (GAP) or inducible alcohol oxidase (AOX1) promoters. In the case of the A. thaliana xylosyltransferase these effects were most pronounced, since constitutive expression at 16 °C resulted in 30-times more activity than inducible expression at 30 °C. Also, the exact nature of the constructs had an effect; whereas soluble forms of the A. thaliana xylosyltransferase and fucosyltransferase were active with N-terminal pentahistidine tags (in the former case facilitating purification of the recombinant protein to homogeneity), a C-terminally tagged form of the A. thaliana fucosyltransferase was inactive. In the case of D. melanogaster b1,4-galactosyltransferase VII, expression with a yeast secretion signal yielded no detectable activity; however, when a full-length form of the enzyme was introduced into P. pastoris, an active secreted form of the protein was produced. © 2003 Éditions scientifiques et médicales Elsevier SAS and Société française de biochimie et biologie moléculaire. All rights reserved. Keywords: Arabidopsis; Caenorhabditis; Drosophila; Glycosyltransferase; Pichia
1. Introduction In recent years, a major focus in glycobiology has been the cloning of cDNAs encoding glycosyltransferases and their expression in order to define the exact enzymatic activities [1]. The genomic era has led to the uncovering of far more
Abbreviations: GalGal, Galb1,4GlcNAcb1,2Mana1,6(Galb1,4GlcNAc b1,2Mana1,3)Manb1,4GlcNAc-b1,4GlcNAc;GnGn,GlcNAcb1,2Mana1,6 (GlcNAcb1,2Mana1,3)Manb1,4GlcNAc-b1,4GlcNAc; MES, 2-morpholinoethanesulphonic acid; MMH, minimal medium with methanol and histidine; MMY, minimal medium with methanol and yeast extract and peptone; MMYC, minimal medium with methanol and yeast extract, peptone and casamino acids. * Corresponding author. Tel.: +43-1-36006-6541; fax: +43-1-36006-6059. E-mail address: [email protected] (I.B.H. Wilson). 1
Present address: Institut für angewandte Mikrobiologie, Universität für Bodenkultur, Muthgasse 18, A-1190 Vienna, Austria.
glycosyltransferase genes than was previously considered possible. The discovery of multiple enzymes with overlapping substrate specificities has led to the revision of previous theories such as ‘one linkage, one enzyme’; furthermore, it appears now that most glycosyltransferases fall into a distinct number of protein families. Key to these discoveries has been the use of a wide variety of expression systems, particularly bacterial, yeast, insect and mammalian–each with its own advantages and disadvantages–in order to produce sufficient amounts of glycosyltransferases for enzymatic characterisation. Bacterial systems have the advantage of being simple to manipulate but the disadvantage of lacking the eukaryotic post-translational machinery and often result in the desired protein being locked in inclusion bodies. Nevertheless, some mammalian glycosyltransferases have been successfully expressed in E. coli and refolded to generate active protein; in some cases (b1,4-galactosyltransferase I, two a1,3-galactosyltransferases and a b1,3-glucuronyltransferase), crystallo-
© 2003 Éditions scientifiques et médicales Elsevier SAS and Société française de biochimie et biologie moléculaire. All rights reserved. DOI: 1 0 . 1 0 1 6 / S 0 3 0 0 - 9 0 8 4 ( 0 3 ) 0 0 0 7 2 - 5
414
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
graphic data has been gained after refolding procedures [2–6]. Insect systems and mammalian systems, such as Chinese hamster ovary (CHO) and monkey (COS) cells have probably been most widely used and the examples are too numerous to count here. Obviously many groups have found these systems adequate for their needs, although background endogenous activities, as well as the more complex nature of the laboratory tasks involved, may be a problem in certain cases. Yeasts have the advantage of being simpler to cultivate than mammalian cells, while still be eukaryotic. However, Saccharomyces cerevisiae hypermannosylates its glycoproteins and although human b1,4-galactosyltransferase I and a2,6-sialyltransferase have been expressed in this system [7], it appears not to have found a niche as a tool in studying the glycoenzymology of higher eukaryotes. On the other hand, Pichia pastoris appears not to hypermannosylate to the same extent as Saccharomyces [8] and a number of studies from other groups have shown its utility as a glycobiological tool. It has been used to overexpress human Lewis-type a1,3/4fucosyltransferase [9], human a1,3-fucosyltransferase VI [10], human b1,4-galactosyltransferase I [10], human b1,3glucuronyltransferase [11], human heparan sulphate copolymerase subunits [12], human a2,6-sialyltransferase ST6Gal I [10], marmoset a1,3-galactosyltransferase [13] and murine polypeptide N-acetylgalactosaminyltransferase 1 [14], as well as plant enzymes (an a1,6-galactosyltransferase and an a1,6-xylosyltransferase) involved in the biosynthesis of xyloglucans and galactomannans [15,16]. In this laboratory we have recently cloned a number of cDNA encoding enzymes involved in glycoconjugate biosynthesis in plants and insects [17–20]. Two of our targets, core a1,3-fucosyltransferase and b1,2-xylosyltransferase, are responsible for the immunogenicity of plant N-glycans [21]. We decided early on to use a simple and yet effective expression system and have successfully demonstrated heterologous expression in P. pastoris in a number of cases. Here, we describe in more detail about our efforts to optimise expression of a number of glycosyltransferases and present data on the purification of one of them (recombinant b1,2xylosyltransferase) to apparent homogeneity from yeast culture supernatant.
2. Experimental procedures 2.1. Plasmid construction and yeast transformation Trizol reagent (Invitrogen) was used to prepare total RNA from either Arabidopsis thaliana (apical tissue), Bos taurus mammary gland, unstaged Caenorhabditis elegans (Bristol N2), adult Drosophila melanogaster (Canton S or Tf24) or Leucopersicon esculentum (tomato, cv. Ailsa Craig, young leaves). For D. melanogaster peptide-O-xylosyltransferase, Berkeley EST LD43716 (Research Genetics) was used as the template.
After reverse transcription (Superscript from Invitrogen or ImProm-II from Promega with T18 primer), PCR was performed using relevant pairs of primers listed in Table 1 and the Expand High Fidelity PCR system (Roche) under the following conditions: one cycle of 95 °C for 2–3 min, 40 cycles of 1 min at 52–55 °C, 2–3 min at 72 °C and 1 min at 95 °C with a final extension step at 72 °C for 7–8 min. In the case of A. thaliana and D. melanogaster core a1,3-fucosyltransferases, A. thaliana b1,2-xylosyltransferase, D. melanogaster b1,4-galactosyltransferase VII, D. melanogaster peptide-O-xylosyltransferase and tomato Lewis a1,4-fucosyltransferase, the RT-PCR fragments were gel purified (Qiagen or Pharmacia gel purification kits) and incubated for 1 h with KpnI at 37 °C prior to addition of EcoRI, after which time the digestion was continued for one further hour. For C. elegans b1,4-galactosyltransferase VII (SQV-3), the relevant fragment was purified without electrophoresis before digestion with PstI and KpnI for 2 h prior to a second round of DNA purification, whereas for bovine b1,4-galactosyltransferase I the fragment was cut with EcoRI and XbaI and gel purified. Relevant pPICZa, pPICZ and pGAPZa plasmids (Invitrogen) were cut under the same conditions as for the cDNA fragments and were generally treated with shrimp alkaline phosphatase (Roche) during the final half-hour of restriction digestion. In the case of the A. thaliana xylosyltransferase constructs, and some of the A. thaliana fucosyltransferase constructs, cDNA fragments were then ligated into either pPICZa C (for inducible expression of secreted proteins under control of the alcohol oxidase promoter) or pGAPZa C (for constitutive expression of secreted proteins under control of the glyceraldehyde-3-phosphate dehydrogenase promoter) for 1 h at room temperature using T4 DNA ligase (Promega) and a fast ligation buffer. In all other cases, the standard ligase buffer was used for overnight ligation at 14 °C. For preparation of some of the pGAPZa forms, inserts cut from the corresponding pPICZa construct were used as fragments. After transformation into E. coli TOP10F’ cells by heat-shock and plating the cells on LB/half-salt agar containing zeocin (25 µg/ml; Invitrogen), positive clones were selected after PCR screening and by sequencing to confirm the reading frame. Two to 10 µg of the expression construct plasmid DNA was linearised according to the supplier’s instructions and used to electroporate P. pastoris competent cells (GS115), which were then plated on YPD agar containing zeocin (100 µg/ml). Screening by direct PCR amplification of colonies or after preparation of genomic DNA, using plasmid or insert specific primers, confirmed the integration of the relevant expression cassette. 2.2. Expression of glycosyltransferases in P. pastoris Selected colonies of recombinant P. pastoris were inoculated into 10 ml of pre-culture medium (YPD for constitutive or glycerol-containing MGYC medium for inducible expression) containing 100 µg/ml zeocin. After overnight incuba-
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
415
Table 1 Primers used to amplify cDNA fragments in this study A. thaliana core $ 1,3-fucosyltransferase (FucTA) AraFucTA/1/EcoRI CCGGAATTCATGGGTGTTTTCTCCAATC Sol1A/EcoRI CCGGAATTCTTTGGTCGATACGTTAAC Sol1A/EcoRI/His CCGGAATTCTCATCATCATCATCATTTGGTCGATACGTTAACC Sol1A/Del1/EcoRI CCGGAATTCTGAGAAATGCCAGGAGTGG Sol1A/Del2/EcoRI CCGGAATTCTTTAGAGAGAGTGGATTCAG 2dA/KpnI CGGGGTACCTTAGACAAAGACAACTTCG 2dA/KpnI/His CGGGGTACCACAAAGACAACTTCGAATTTG A. thaliana b 1,2-xylosyltransferase AXT1/EcoRI CCGGAATTCGTCGTTTTCACCGGAG AXT1/EcoR1/His CCGGAATTCTCATCATCATCATCATTCGTTTTCACCGGAG AXT2/KpnI CGGGGTACCTTAGCAGCCAAGGCTCTTC Bovine b 1,4-galactosyltransferase I (lactose synthetase A) GalT/1/EcoRI CCGAATTCCTGCGAGGGGTCGCAC GalT/2/XbaI TGCTCTAGAGCACTAGCTCGGCGTCCCG C. elegans b 1,4-galactosyltransferase VII (SQV-3) SQV3/1/PstI AACTGCAGTTCTCGATTTAGAGATAAC SQV/2/KpnI CCGGTACCTATGATTTGCAATAAGGTG D. melanogaster core ␣ 1,3-fucosyltransferase (FucTA) 10071EcoHisTM CGGGAATTCCATCATCATCATCATAAGGAGCGCGAAATATGGAAG 10071revKpn CCGGGGTACCTCAGTCGTCGCTGGAGTCG D. melanogaster b 1,4-galactosyltransferase VII DmGalT7/1/EcoRI CCGGAATTCATGGTCAATATATCCACC GalT7TmHis4EcoRI CCGGAATTCCATCATCATCATAGTGTCATGCCATTGGGATC GalT7revKpnI CCGGGGTACCTCAGGTTTGTACCGCCGATG D. melanogaster peptide O-xylosyltransferase (OXT) DMXT3/EcoRI CCGGAATTCCCTGGACATCGTAGG DMXT2/KpnI CGGGGTACCTCATTTGAGCAGGGCATC Tomato Lewis ␣ 1,4-fucosyltransferase (FucTC) TomC5/EcoRI CCGGAATTCACTTCACACTTCTTC TomC2/KpnI CGGGGTACCTCAAGAGGCTTTTGCATTTC
tion at generally 30 °C with continuous shaking (200 rpm) in baffled flasks, cells where collected by centrifugation at 1500 × g. In the case of constitutive expression, cells were then resuspended in freshYPD with no zeocin and samples of the culture were removed every 24 h. In the case of inducible expression, the cells were washed once in 1.34% (w/v) yeast nitrogen base solution and resuspended in methanolcontaining MMYC medium. Every 24 h samples of the cultures were removed and extra methanol added to maintain a concentration of 1% (v/v). 2.3. Assay for glycosyltransferases In order to verify activity of the secreted forms of A. thaliana and D. melanogaster core a1,3-fucosyltransferase, A. thaliana b1,2-xylosyltransferase and bovine b1,4-galactosyltransferase I, culture supernatants were collected by centrifugation, generally concentrated by centrifugal ultrafiltration (Vivaspin or Amicon, MWCO 10000) and enzymatic assays performed. Dabsyl- or dansyl-modified forms of a GnGn glycopeptide, with the sequence Gly– Glu–Asn–Arg derived from Pronase digestion of bovine fibrin, were used as acceptor substrates (Calbiochem) [17,22]. Reactions containing 0.05–0.1 mM acceptor, 1 mM donor (GDP-Fuc, UDP-Xyl or UDP-Gal), 10 mM MnCl2, 25 mM
Forward, full-length form Forward, ∆1–66 and ∆1–66/C-His forms Forward, ∆1–66/N-His form Forward, ∆1–90 form Forward, ∆1–95 form Reverse, most forms Reverse, only ∆1–66/C-His form Forward, untagged form Forward, His-tagged form Reverse, both forms Forward Reverse Forward Reverse Forward Reverse Forward, full-length form Forward, truncated form Reverse, both forms Forward Reverse Forward Reverse
2-morpholinoethanesulphonic acid (MES), pH 6.5 (pH 7.0 in the case of bovine galactosyltransferase) and 5 µl of 10-fold concentrated supernatant were performed in a final volume of 10 µl. Aliquots of the enzymatic assay mixtures were removed after either 1, 2 or 4 h or overnight incubation and analysed by reversed-phase HPLC [22] or MALDI-TOF mass spectrometry [17]. For bovine galactosyltransferase, 1 U is defined as the amount of enzyme transferring 1 µmol of galactose from UDP-galactose to dabsylated GnGn-peptide per min at 37 °C, the reaction always being terminated before the appearance of the digalactosylated form (GalGal), whereas for core fucosyltransferase (or xylosyltransferase) 1 U is defined as the amount of enzyme transferring 1 µmol of fucose (or xylose) from GDP-fucose (or UDP-xylose) to dansylated GnGn-peptide per min at 37 °C (or 16 °C)-the reaction being always terminated before 20% conversion of substrate. For D. melanogaster b1,4-galactosyltransferase VII, both the supernatants and cells of P. pastoris transformed with full-length forms of the open reading frame were assayed for activity. After removal and 10-fold concentration of the supernatant (Ultrafree-0.5 with a Biomax membrane with MWCO of 5000, Millipore), cells from 2 ml culture were resuspended in 100 µl 40 mM MES, pH 7, 1 mM ethylenediamine tetraacetate, 1 mM dithiothreitol, 5 mM MnCl2, 5 mM
416
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
MgCl2, 0.4% Triton-X-100 with protease inhibitor cocktail (Roche), vortexed and centrifuged. The pellet was again vortexed and centrifuged, but in the presence of glass beads, to obtain a second Triton extract. Soluble recombinant C. elegans, intracellular and soluble forms of recombinant D. melanogaster b1,4-galactosyltransferase VII were assayed for transfer of galactose to p-nitrophenyl xylose. Briefly, reaction mixtures of 30 µl containing 100 mM MES, pH 6, 15 mM MnCl2, 20 mM p-nitrophenyl xylose (from a 500 mM stock dissolved in DMSO), 0.67 mM UDPgalactose, 80,000 dpm UDP-[14C]galactose (NEN) and 10 µl of P. pastoris extract were incubated for 21 h at room temperature. Two microlitres of these mixtures were spotted onto HPTLC plates (Merck). After development of the chromatograms in 100:10:10:3:30 ethanol/pyridine/n-butanol/acetic acid/water, the TLC plates were subject to autoradiography. One unit of activity is defined as the transfer of 1 µmol of galactose from UDP-galactose to p-nitrophenyl xylose per min at pH 6.5 and room temperature as estimated by relative spot intensities. For other glycosyltransferases (tomato Lewis a1,4fucosyltransferase and D. melanogaster peptide-O-xylosyltransferase), previously-published procedures were used for assaying activity [18,19]. In all cases, various controls (P. pastoris transformed with other glycosyltransferase cDNAs or with a vector lacking an insert) were used to test for background activities. 2.4. Purification of core ␣1,3-fucosyltransferase To enrich the recombinant A. thaliana core a1,3fucosyltransferase, dye-ligand affinity chromatography was performed as used in the procedure to purify mung bean fucosyltransferase [23]. All steps were performed at 4 °C. After expression, phenylmethylsulphonyl flouride (final concentration 0.1 mg/ml) was added to the culture medium, which was then centrifuged at 1500 × g for 5 min. The resulting supernatant was centrifuged again at 13,000 × g for 15 min prior to concentration, washing with binding buffer (25 mM, MES, pH 6.8) and reconcentration to finally yield a 10-fold concentrated supernatant, 0.5 ml of which was then applied to an Affi-Gel Blue column (BioRad, 0.7 × 15 cm) previously equilibrated with binding buffer. The sample was incubated with the resin for 1 h at 4 °C and the column was washed using 200 ml of binding buffer. The active enzyme was eluted with binding buffer additionally containing 0.05% Triton and 600 mM NaCl and was subsequently concentrated 10-fold. Protein content of the partially purified enzyme was determined by utilizing the Micro BCA protein Assay Reagent Kit (Pierce). 2.5. Purification of recombinant b1,2-xylosyltransferase All purification steps for recombinant A. thaliana b1,2xylosyltransferase were performed at 4 °C. Immediately after the expression, the protease inhibitors phenylmethanesulphonyl fluoride (Roche; final concentration 0.1 mg/ml)
and leupeptin (Sigma; final concentration 0.5 µg/ml) were added to the culture, which was then centrifuged in the same way as with fucosyltransferase prior to adjusting the pH of the culture supernatant to 7.2 with HCl. One hundred and fifty millilitres of medium was diluted with 350 ml of binding buffer containing 25 mM MES, 400 mM NaCl, 10 mM imidazole and 0.02% (w/v) NaN3, pH 7.2 and applied to a Ni2+-chelation column (iminodiacetic acid-agarose, Sigma; approximately 700 µl packed volume) sequentially prewashed with 0.1 M NiSO4 and binding buffer. After application of the sample, the column was washed with increasing amounts of imidazole prior to elution in buffer containing 25 mM MES, 400 mM NaCl, 250 mM imidazole and 0.02% NaN3, pH 6.8. The purified protein was collected and concentrated 10-fold (Centricon, Millipore, MWCO 10000) and stored at 4 °C. The purity of the protein was analysed by SDS-PAGE and silver-stained according to the Amersham Pharmacia Biotech protocol. 3. Results 3.1. Expression of A. thaliana core ␣1,3-fucosyltransferase Initial optimisation studies on A. thaliana core a1,3fucosyltransferase (FucTA) were performed on the previously-described form (D1-66; see Table 1 for construct nomenclature) [17] to determine the effect of different media compositions on methanol-inducible expression (Fig. 1). Using a minimal methanol medium containing histidine (MMH) was found to result in no detectable activity, whereas cells growing in a standard medium (MMY, methanol minimal medium with yeast extract) secreted detectable activity. The best results, though, were obtained when using a richer medium (MMYC, methanol minimal medium with yeast extract and casamino acids). The beneficial effect of casamino acids on activity levels was also seen with recombinant murine polypeptide N-acetylgalactosaminyltransferases [24]. It was also found that using MMYC medium buffered with MES to pH 6 had no significant effect on the activity as compared to non-buffered medium even though in the latter case the final pH (as measured after 2 d of expression: 7.4 in contrast to 6.6) was higher. Subsequently, two variants (D1-66/C-His and D1-66/NHis) with either an in-frame 3’-terminal series of six histidine codons as present in the commercial pPICZaC vector or with five histidine codons present in frame within the 5’-primer and two forms (D1-90 and D1-95) encoding proteins having or lacking the conserved C-Q/E-E-W motif [17] were constructed in the pPICZaC vector. The D1-66, D1-66/N-His and D1-66/C-His forms were cloned also into pGAPZaC. Both vectors encode an N-terminal S. cerevisiae a-secretion factor signal, which facilitates the secretion of the protein into the medium. In all cases, the expected fucosyltransferase activity could be detected for all forms except for those with either a His-tag on its C-terminus or lacking the C-Q/E-E-W sequence at its N-terminus. In addition, intracellular fucosyl-
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
417
Table 2 Enzymatic activity of different enzymes after either constitutive or inducible expression in P. pastoris. The results given are of the highest activities (U/l) obtained in the supernatants. ND, not determined Enzyme A. thaliana core a1,3-fucosyltransferase ∆1–66 ∆1–66/N-His ∆1–66/C-His ∆1–95 A. thaliana b1,2-xylosyltransferasea Bovine b1,4-galactosyltransferase I C. elegans galactosyltransferase VII D. melanogaster core a1,3-fucosyltransferase D. melanogaster galactosyltransferase VIIb D. melanogaster peptide O-xylosyltransferase Tomato Lewis a1,4-fucosyltransferase
Constitutive
Inducible
1.0 (30 °C) 1.0 (30 °C) 0 ND 1.5 (16 °C) 0.3 (30 °C) ND 0.00165 (30 °C) ND
1.0 (30 °C) 1.0 (30 °C) 0 0 0.05 (16 °C) 0.3 (30 °C) 0.016 (16 °C) 0.0015 (30 °C)
ND
1.0 (30 °C)
0.8 (30 °C)
1.0 (30 °C)
0.16 (16 °C)
a
Both His-tagged and non-tagged forms gave comparable results. b activity secreted into medium from P. pastoris transformed with the full-length form.
Fig. 1. Assay of core a1,3-fucosyltransferase activity. Supernatants of P. pastoris transformed with the A. thaliana core a1,3-fucosyltransferase D1-66 construct (i.e., lacking the first 66 residues) and grown in either MMH, MMY or MMYC were collected after 48 h. After incubation of 5 µl supernatant with dansyl GnGn and GDP-Fuc for 24 h at 37 °C, the assay mixtures were analysed by reversed-phase HPLC and fluorescence detection.
transferase activity was only found when P. pastoris were transformed with a full-length form of the A. thaliana core fucosyltransferase reading frame (data not shown). By screening 25 individual P. pastoris clones of D1-66 and D1-66/N-His (freshly restreaked prior to inoculation to yield single colonies), those producing constitutively and inducibly expressed enzyme with the highest activity per volume were selected. For successful expression, the preculture in the presence of zeocin was crucial and the ideal optical density of culture at the starting point of expression was found to be 1. During the 4 d of expression, aliquots of the supernatants were taken every 24 h in order to monitor the enzymatic activity. There was no significant difference between the constitutive and inducible methods for expression and maximal fucosyltransferase expression at 30 °C for 72 h was approximately 1 U/l (see also Table 2). 3.2. Purification of recombinant core ␣1,3-fucosyltransferases Preliminary trials indicated that purification of A. thaliana fucosyltransferase carrying the pentahistidine tag on its N-terminus using Ni2+-chelate affinity chromatography was unsuccessful, since the protein failed to bind the affinity matrix. Therefore, as an alternative, Affi-Gel Blue was used as the matrix. The addition of Triton-X-100 was found to be essential for the success of the subsequent high-salt elution step. The enzyme was eluted within 3 ml (i.e., six-times the
loaded volume). Approximately 80% of enzymatic activity was recovered after dye-affinity chromatography of both the His-tagged and non-fused forms of the protein, but only partial purification was achieved (specific activity 0.45 U/mg). In contrast, to the A. thaliana enzyme, the N-terminally His-tagged D. melanogaster core fucosyltransferase FucTA [20] was able to interact with – and be eluted from – the nickel resin, but the overall levels of enzyme activity after either inducible or constitutive expression were rather low (Table 2) and subsequent studies were, therefore, not pursued. Proteolysis of the recombinant enzyme is probably not responsible for the low activity, since western blotting of a supernatant of yeast expressing fly FucTA indicated that a mouse antiserum raised against a peptide corresponding to residues 121–140 of the fly FucTA sequence recognised only a single polypeptide of approximately Mr 60,000 as compared to a theoretical molecular weight of the soluble form of Mr57,000 (data not shown). 3.3. Expression and purification of recombinant b1,2-xylosyltransferase The A. thaliana b1,2-xylosyltransferase cDNA fragment missing the first 31 codons and with a 5’-terminal in-frame (CAT)5 sequence (encoding an N-terminal pentahistidine tag), but otherwise identical with the sequence of Strasser et al. [25], was engineered into pGAPZa C and pPICZa C and a number of P. pastoris clones were screened for activity (see Fig. 2 for an example activity assay). In the case of this enzyme, the comparison of constitutive and inducible expression showed the former to be far superior. Fermentation conditions were particularly crucial: by expression and assay at 16 °C, a maximal activity of 1.5 U/l after 94 h of expression was achieved (Table 2). Longer times of expression led to a decreasing level of activity even at 16 °C.
418
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
Fig. 3. SDS-PAGE analysis of purified recombinant b1,2-xylosyltransferase. Fig. 2. Assay of b1,2-xylosyltransferase activity. Incubations (1 h, 16 °C) of dansyl GnGn and culture supernatant of P. pastoris transformed with b1,2xylosyltransferase in the absence (a) and presence (b) of UDP-xylose were analysed by MALDI-TOF mass spectrometry. The difference between the m/z of the substrate (2006.5) and the product (2138.8) corresponds to the addition of a single xylose residue. The species of m/z 2168.9 corresponds to a remnant of a b1,3-galactose-substituted GnGn glycopeptide.
The recombinant enzyme was purified using Ni2+-chelate affinity chromatography to apparent homogeneity. A single silver-stained band of approximately 60 kDa was observed upon SDS-PAGE (Fig. 3). According to the staining, the yield was estimated to be approximately 2.5 µg protein from 100 ml collected culture media with a specific activity was 0.33 U/mg. While the purified enzyme was not stable when subject to a single freeze-thaw cycle, it could be stored at 4 °C for at least 3 weeks with no appreciable loss of activity. 3.4. Expression of bovine b1,4-galactosyltransferase I Bovine b1,4-galactosyltransferase I (lactose synthase A protein) is one of the most studied enzymes of the glycosyltransferase superfamily. In our initial studies a cDNA fragment encoding the soluble form of this enzyme was cloned into the pICZaC vector and it was expressed under the control of the methanol-inducible promoter, data from screening the activity in growth media indicating a yield of
11 mU/l. Induction of the P. pastoris culture with methanol at higher OD600 (e.g., 15) yielded lower activities of the recombinant enzyme, while, typically, the best yields of b1,4galactosyltransferase activity were achieved on a second and third day of expression. As expected, minor variations in activity (up to threefold) from clone to clone did exist. It was also noticed that the pH of the media during the expression rose from pH 7–9.5. Since it is known that the bovine b1,4galactosyltransferase is active in range pH 6–9 with a maximum between pH 6.5 and 8 [26], pH of the media was adjusted to either 5.0, 6.0 or 7.0 with HCl (either with or without the inclusion in the medium of MES, sodium salt). Overall, optimised expression (i.e., at pH 6 with resuspension of the cells in the induction medium to give OD600 1) with the best clone yielded 300 mU/l after 2 d of expression. Recloning of the enzyme reading frame into the pGAPZaC vector, placing the galactosyltransferase under the control of a constitutive promoter, yielded activities comparable to those achieved under the control of methanol-inducible promoter. It must also be noted that some galactosyltransferase activity was detected within the transformed P. pastoris cells (ca. 70 mU/l of culture after 3 d of expression), indicating that roughly one third of the active enzyme remains in the cells or is in the process of leaving the cells.
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
419
3.5. Expression of C. elegans and D. melanogaster b1,4-galactosyltransferase VII The enzyme which transfers the first galactose residue of the chondroitin/heparan glycosaminoglycan core is important in nematode development, as judged by the effect of the sqv-3 (squashed vulva-3) mutation [27], and defects in the homologous human gene are implicated in some cases of Ehlers-Danlos syndrome [28,29]. The results of sequencing the D. melanogaster genome indicated that the fly has three b1,4-galactosyltransferase genes of unknown function [30,31]; therefore, we were interested in determining which homologue encoded a galactosyltransferase I (following the nomenclature of glycosaminoglycan synthesis) activity. Initially, fragments of all fly b1,4-galactosyltransferase cDNAs encoding soluble forms of the putative enzymes were cloned into Baculovirus and P. pastoris vectors; however, in no case were the initial results promising. Later, we constructed a form of the pPICZ A vector (which lacks the a-factor secretion signal) carrying the full open reading frame of the fly cDNA (CG11780) encoding the closest homologue to the worm SQV-3 and human b1,4-galactosyltransferase VII, as well as a truncated form of the worm SQV-3 cDNA within the pPICZa B vector lacking the region encoding the cytoplasmic and transmembrane domains. Testing various extracts from the cells (a first Triton extract and a second Triton extract obtained after beating the cells with beads) and 10-fold concentrated supernatant after 2 and 3 d of expression of full-length form of fly b1,4galactosyltransferase VII in P. pastoris indicated that the enzyme was also present in the medium as judged by a TLC-based activity test (Fig. 4). The secreted form of the worm SQV-3 protein was apparently expressed less well, but activity was detected after 4 d expression at 16 °C (Fig. 4); 17 °C being the apparent temperature optimum for the recombinant worm enzyme expressed in COS-7 cells [27]. As the control, no transfer of galactose to p-nitrophenyl xylose was detected with the medium of P. pastoris transformed with a full-length A. thaliana FucTB cDNA. Furthermore, RP-HPLC confirmed that the recombinant fly b1,4galactosyltransferase VII converted p-nitrophenyl xylose into a product of lower retention time (data not shown); this product was digested back to p-nitrophenyl xylose by the b1,4-specific galactosidase from Aspergillus oryzae. Although recently two reports [32,33] have confirmed that the fly b1,4-galactosyltransferase VII homologue has indeed the same function as that putatively assigned by its homology, the present data is the first to show successful expression of a fly galactosyltransferase in P. pastoris. Perhaps significantly, both the other studies on heterologous expression of this enzyme utilised full-length rather than secreted forms. 3.6. Other glycosyltransferases expressed in P. pastoris In the course of our studies, three other enzymes have been successfully expressed in P. pastoris: D. melanogaster peptide-O-xylosyltransferase [19], rice N-acetylglucos-
Fig. 4. Assay of D. melanogaster and C. elegans b1,4-galactosyltransferase VII. Incubations were performed as described under Section 2, using the following extracts: 1, 10-fold concentrated medium of P. pastoris transformed with expression vector carrying A. thaliana FucTB open reading frame; 2–7, P. pastoris expressing D. melanogaster b1,4-galactosyltransferase VII—respectively, 10-fold concentrated media (second and third day of expression), first Triton-X-100 extracts (second and third day of expression), second Triton-X-100 extracts (second and third day of expression); 8–10, concentrated medium of P. pastoris expressing C. elegans b1,4galactosyltransferase VII (second, third and fourth day of expression, respectively).
aminyltransferase I (Wilson et al., in preparation) and tomato Lewis-type a1,4-fucosyltransferase [18]. In the first and last case, inducible expression was never optimised, but was of the order of 1 U/l and was thus considered sufficient for the purpose of enzymatic characterisation. In the case of the D. melanogaster peptide-O-xylosyltransferase, the presence of a C-terminal His-tag appeared to have no deleterious effect on activity (I.B.H.W., unpublished data). Subsequent to the previous publication [18], the tomato enzyme has been expressed under the control of the constitutive glyceraldehyde-3-phosphate dehydrogenase promoter. No significant difference in activity was detected comparing inducible and constitutive heterologous expression of the tomato enzyme (Table 2). 4. Discussion As shown by the present and previously-published data, we have been able to express a range of glycosyltransferases in P. pastoris, using either methanol-inducible (AOX1 promoter) or constitutive (GAP1 promoter) expression. Generally, most studies on P. pastoris expression are performed using the methanol-inducible system; however, the possible advantage of constitutive expression was shown by a study on marmoset a1,3-galactosyltransferase [13] in which 100times more protein were produced than by inducible expression. Due to the low expression level obtained on methanolinduction of A. thaliana b1,2-xylosyltransferase activity, we
420
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
Despite the switch in the promoter used, expression of A. thaliana b1,2-xylosyltransferase (either His-tagged or non-tagged) was still not especially high and still considered insufficient for the proposed use (i.e., remodelling of glycoproteins in order to produce neoglycoforms suitable for the study of anti-carbohydrate antibodies). A search of the literature resulted in finding a few studies (e.g., with a galactose oxidase and blue mussel b-mannanase) showing that lowering the temperature during expression had a significant effect [34,35]. Indeed a lower temperature (16 °C in contrast to the normal 30 °C) and longer time of expression (94 h) resulted in the highest yields of activity. The purified P. pastorisexpressed xylosyltransferase was most active at 16 °C indicating that the enzyme is unstable at higher temperatures. In other cases, the effect of temperature on expression levels was not so pronounced, but certainly with two enzymes whose temperature stability was tested (A. thaliana core fucosyltransferase and D. melanogaster peptide-O-xylosyltransferase), the initial rate of reaction was higher at 37 °C, but when measured by overnight incubation, these two enzymes were more stable at RT and 30 °C; at 16 °C neither enzyme was significantly active.
In some cases attempts to express glycosyltransferases in P. pastoris have not resulted in any activity (e.g., a human a2,3-sialyltransferase [40]). However, most studies do not present data on failures and so there may be many other groups who have not detected activity of their desired enzyme from recombinant P. pastoris. In our case, preliminary attempts with soluble expression of mammalian and plant b1,3-galactosyltransferase homologues, a bovine and a fly sialyltransferase, A. thaliana a1,4-fucosyltransferase (FucTC), three fly fucosyltransferases (a1,6-fucosyltransferase, FucTB and FucTC) and three fly b1,4-galactosyltransferase homologues, failed to result in detectable activities. We have not, so far, attempted to express all these ‘failures’ at temperatures lower than 30 °C or with constitutive expression or in full-length form or in a proteasedeficient strain. Prompted, however, by data in press demonstrating that the fly b1,4-galactosyltransferase VII homologue was indeed active upon overexpression in insect and mammalian cells [32,33] and by data indicating that a plant a1,6-xylosyltransferase was expressed as a full-length membrane-bound enzyme in P. pastoris [16], we decided to once again try one of these problematic cases by expressing a full-length form of fly b1,4-galactosyltransferase VII at 16 °C with the pre-culture grown in the presence of zeocin. Indeed in this experiment the expression was successful with activity being present in the medium (0.16 U/l) and in the cells, suggesting that either the previous attempts had failed due to an incompatibility of the fly galactosyltransferase with the yeast secretion signal or that expression at 16 °C was crucial.
The correct position of the fusion purification tag with respect to the catalytic domain of the glycosyltransferase can be important, since according to our experience with A. thaliana core fucosyltransferase, construction of a form with a C-terminally fused His-tag resulted in the detection of no enzyme activity. One could hypothesise that the correct folding important for the activity could have been influenced by the fusion-indeed the C-terminal region of the plant core fucosyltransferases is quite highly conserved [17]. In some glycosyltransferases the C-terminus has also been found to be sensitive to any changes in primary structure, since the removal of only a few amino acids from the C-terminus of either marmoset a1,3-galactosyltransferase, human FucT-V or rabbit GlcNAcT-I results in a complete or large loss of enzyme activity [36–38]; on the other hand, the human a1,3/4-fucosyltransferase, FucT-III, was successfully expressed in CHO cells with a C-terminal His-tag and was even active when immobilised on a chelation resin [39]. The N-terminal region of A. thaliana core fucosyltransferase is less sensitive to such changes, perhaps since the stem region is less conserved. Indeed removal of the entire stem, but still retaining the conserved C-Q-E-W motif [17], seems possible, but a form (D1-95) lacking this sequence is inactive. Thus, both the removal and addition of amino acids from either the N- or C-termini can have significant effects on glycosyltransferase activity.
Overall, therefore, a number of factors must be considered before using P. pastoris as an expression system for glycosyltransferases. Any strategy should include constructing vectors encoding both soluble and full-length forms under the control of either promoter. If one promoter has to be chosen, then the constitutive promoter is that of choice since the expression is the easiest to perform (no washing to remove non-methanolic carbon sources, no addition of extra methanol each day, no need to optimise methanol concentration) and since, of those tested, no enzyme that worked with inducible expression did not function with constitutive expression. Our own data as well as that from a study on Brassica endoglucanase [41] suggest that zeocin should be present in any pre-culture; also, factors affecting protease activities should be considered. We assume that reducing expression temperature, diluting the cells to an OD600 of 1 for expression and including casamino acids in the medium have their effects due to reducing or crudely inhibiting protease activities. Even though reducing the temperature of expression (pre-culturing still being performed at 28 or 30 °C) slows down yeast growth, overall yields of activity can be higher. In summary, the P. pastoris system can be used to express glycosyltransferases from a variety of eukaryotic organisms and culture supernatants can be used directly in MALDIbased assays. Furthermore, transformation and expression
were then prompted to try constitutive expression with this enzyme and indeed far higher levels of activity resulted. With none of the other four enzymes tested in both systems (A. thaliana and D. melanogaster core a1,3-fucosyltransferase, bovine b1,4-galactosyltransferase I and tomato a1,4-fucosyltransferase), though, was the difference between inducible and constitutive expression significant.
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
are easy to perform in almost any biochemical laboratory and the lack of endogenous complex glycosylation, resulting in a lack of background activities, supports our belief that P. pastoris can be considered a suitable host for the study of enzymes relevant to the glycosylation pathway of plants and animals.
Acknowledgements This study was funded by the Austrian Fonds zur Förderung der wissenschaftlichen Forschung (grant S-8803 to F.A. and grant P-13810 to I.B.H.W.) and Neose Technologies, Inc. (Glycoscience Research Award to I.B.H.W.). The authors thank Katharina Paschinger for preparing cDNA from C. elegans and reading the manuscript, to Angelika Freilinger for preliminary purification experiments with D. melanogaster core a1,3-fucosyltransferase and to Dr. Florian Rüker for his advice during our initial experiments with P. pastoris. The authors also thank Prof. Leopold März, currently Rektor of the Universität für Bodenkultur, for his continued support for the people and research of the Glycobiology Division.
References [1] [2]
[3]
[4]
[5]
[6]
[7]
[8] [9]
R.M. Bill, L. Revers, I.B.H. Wilson, Protein Glycosylation, Kluwer Academic Publishers, Boston/Dordrecht/London, 1998. B. Ramakrishnan, P.K. Qasba, Crystal structure of lactose synthase reveals a large conformational change in its catalytic component, the b1,4 galactosyltransferase-I, J. Mol. Biol. 310 (2001) 205–218. L.N. Gastinel, C. Bignon, A.K. Misra, O. Hindsgaul, J.H. Shaper, D.H. Joziasse, Bovine ␣1,3-galactosyltransferase catalytic domain structure and its relationship with ABO histo-blood group and glycosphingolipid glycosyltransferases, EMBO J. 20 (2001) 638–649. E. Boix, G.J. Swaminathan, Y. Zhang, R. Natesh, K. Brew, K.R. Acharya, Structure of UDP-complex of UDP-galactose: b-galactoside-␣-1,3-galactosyltransferase at 1.53-Å resolution reveals a conformational change in the catalytically important C-terminus, J. Biol. Chem. 276 (2001) 48608–48614. S.I. Patenaude, N.O. Seto, S.N. Borisova, A. Szpacenko, S.L. Marcus, M.M. Palcic, S.V. Evans, The structural basis for specificity in human ABO(H) blood group biosynthesis, Nat. Struct. Biol. 9 (2002) 685–690. L.C. Pedersen, K. Tsuchida, H. Kitagawa, K. Sugahara, T.A. Darden, M. Negishi, Heparan/Chondroitin sulphate biosynthesis. Structure and mechanism of human glucuronyltransferase I, J. Biol. Chem. 275 (2000) 34580–34585. C.H. Krezdorn, R.B. Kleene, M. Watzele, S.X. Ivanov, C.H. Hokke, J.P. Kamerling, E.G. Berger, Human b1,4 galactosyltransferase and ␣2,6 sialyltransferase expressed in Saccharomyces cerevisiae are retained as active enzymes in the endoplasmic reticulum, Eur. J. Biochem. 220 (1994) 809–817. R.K. Bretthauer, F.J. Castellino, Glycosylation of Pichia pastorisderived proteins, Biotechnol. Appl. Biochem. 30 (1999) 193–200. P.F. Gallet, H. Vaujour, J.M. Petit, A. Maftah, A. Oulmouden, R. Oriol, C. Le Narvor, M. Guilloton, R. Julien, Heterologous expression of an engineered truncated form of human Lewis fucosyltransferase (FucTIII) by the methylotrophic yeast Pichia pastoris, Glycobiology 8 (1998) 919–925.
421
[10] M. Malissard, S. Zeng, E.G. Berger, Expression of functional soluble forms of human b-1,4-galactosyltransferase I, ␣-2,6-sialyltransferase, and ␣-1,3-fucosyltransferase VI in the methylotrophic yeast Pichia pastoris, Biochem. Biophys. Res. Commun. 267 (2000) 169–173. [11] M. Ouzzine, S. Gulberti, P. Netter, J. Magdalou, S. Fournel-Gigleux, Structure/function of the human Galb1,3-glucuronosyltransferase. Dimerization and functional activity are mediated by two crucial cysteine residues, J. Biol. Chem. 275 (2000) 28254–28260. [12] C. Senay, T. Lind, K. Mugurama, Y. Tone, H. Kitagawa, K. Sugahara, K. Lidholt, U. Lindahl, M. Kusche-Gullberg, The EXT1/EXT2 tumour suppressors: catalytic activities and role in heparan sulphate biosynthesis, EMBO Rep. 1 (2000) 282–286. [13] Z.C. Chen, M. Tanemura, U. Galili, Synthesis of ␣-gal epitopes (Gal␣1-3Galb1-4GlcNAc-R) on human tumour cells by recombinant ␣1,3-galactosyltransferase produced in Pichia pastoris, Glycobiology 11 (2001) 577–586. [14] K.G. Ten Hagen, D. Tetaert, F.K. Hagen, C. Richet, T.M. Beres, J. Gagnon, M.M. Balys, B. VanWuyckhuyse, G.S. Bedi, P. Degand, L.A. Tabak, Characterization of a UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase that displays glycopeptide N-acetylgalactosaminyltransferase activity, J. Biol. Chem. 274 (1999) 27867–27874. [15] M.E. Edwards, C.A. Dickson, S. Chengappa, C. Sidebottom, M.J. Gidley, J.S. Reid, Molecular characterisation of a membranebound galactosyltransferase of plant cell wall matrix polysaccharide biosynthesis, Plant J. 19 (1999) 691–697. [16] A. Faik, N.J. Price, N.V. Raikhel, K. Keegstra, An Arabidopsis gene encoding an ␣-xylosyltransferase involved in xyloglucan biosynthesis, Proc. Natl. Acad. Sci. USA 99 (2002) 7797–7802. [17] I.B.H. Wilson, D. Rendic´ , J. Dumic´ , A. Freilinger, F. Altmann, J. Mucha, S. Müller, M.T. Hauser, Cloning and expression of ␣1,3fucosyltransferase homologues from Arabidopsis thaliana, Biochim. Biophys. Acta 1527 (2001) 88–96. [18] I.B.H. Wilson, Identification of a cDNA encoding a plant Lewis-type ␣1,4-fucosyltransferase, Glycoconj. J. 18 (2001) 439–447. [19] I.B.H. Wilson, Functional characterisation of Drosophila melanogaster peptide O-xylosyltransferase, the key enzyme for proteoglycan chain initiation and member of the core 2/I N-acetylglucosaminyltransferase family, J. Biol. Chem. 277 (2002) 21207–21212. [20] G. Fabini, A. Freilinger, F. Altmann, I.B.H. Wilson, Identification of core ␣1,3-fucosylated glycans and the requisite fucosyltransferase in Drosophila melanogaster. Potential basis of the neural antihorseradish peroxidase epitope, J. Biol. Chem. 276 (2001) 28058–28067. [21] K. Fötisch, S. Vieths, N- and O-linked oligosaccharides of allergenic glycoproteins, Glycoconj. J. 18 (2001) 373–390. [22] A. Roitinger, H. Leiter, E. Staudacher, F. Altmann, HPLC method for the determination of Fuc to Asn-linked GlcNAc fucosyltransferases, Glycoconj. J. 15 (1998) 89–91. [23] H. Leiter, J. Mucha, E. Staudacher, R. Grimm, J. Glössl, F. Altmann, Purification, cDNA cloning, and expression of GDP-L-Fuc:Asnlinked GlcNAc ␣1,3-fucosyltransferase from mung beans, J. Biol. Chem. 274 (1999) 21830–21839. [24] H. Mao, M.E. Forsythe, G.S. Bedi, B. van Wuyckhuyse, L.A. Tabak, Expression of murine UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase-T1, T2, T3 in Pichia pastoris, Glycoconj. J. 17 (2000) 45 (Abstract S2.10). [25] R. Strasser, J. Mucha, L. Mach, F. Altmann, I.B.H. Wilson, J. Glössl, H. Steinkellner, Molecular cloning and functional expression of b1,2xylosyltransferase cDNA from Arabidopsis thaliana, FEBS Lett. 472 (2000) 105–108. [26] H. Babad, W.Z. Hassid, Soluble uridine diphosphate D-galactose: D-glucose b-4-D-galactosyltransferase from bovine milk, J. Biol. Chem. 241 (1966) 2672–2678.
422
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
[27] D.A. Bulik, G. Wei, H. Toyoda, A. Kinoshita-Toyoda, W.R. Waldrip, J.D. Esko, P.W. Robbinsm, S.B. Selleck, sqv-3, -7, and -8, a set of genes affecting morphogenesis in Caenorhabditis elegans, encode enzymes required for glycosaminoglycan biosynthesis, Proc. Natl. Acad. Sci. USA 97 (2000) 10838–10843. [28] R. Almeida, S.B. Levery, U. Mandel, H. Kresse, T. Schwientek, E.P. Bennett, H. Clausen, Cloning and expression of a proteoglycan UDP-galactose: b-xylose b1,4-galactosyltransferase. A seventh member of the human b4-galactosyltransferase gene family, J. Biol. Chem. 274 (1999) 26165–26171. [29] K. Furukawa, T. Okajima, Galactosyltransferase I is a gene responsible for progeroid variant of Ehlers-Danlos syndrome: molecular cloning and identification of mutations, Biochim. Biophys. Acta 1573 (2002) 377–381. [30] F. Altmann, G. Fabini, H. Ahorn, I.B.H. Wilson, Genetic model organisms in the study of N-glycans, Biochimie 83 (2001) 703–712. [31] G. Fabini, I.B.H. Wilson, Glycosyltransferases from Drosophila melanogaster, Dros. Inf. Serv. 84 (2001) 122–129. [32] Y. Nakamura, N. Haines, J. Chen, T. Okajima, K. Furukawa, T. Urano, P. Stanley, K.D. Irvine, Identification of a Drosophila gene encoding xylosylprotein b4-galactosyltransferase that is essential for the synthesis of glycosaminoglycans and for morphogenesis, J. Biol. Chem. 277 (2002) 46280–46288. [33] N. Vadaie, R.S. Hulinsky, D.L. Jarvis, Identification and characterization of a Drosophila melanogaster ortholog of human b1,4galactosyltransferase VII, Glycobiology 12 (2002) 589–597. [34] M.M. Whittaker, J.W. Whittaker, Expression of recombinant galactose oxidase by Pichia pastoris, Protein Expr. Purif. 20 (2000) 105–111.
[35] B. Xu, D. Sellos, J.C. Janson, Cloning and expression in Pichia pastoris of a blue mussel (Mytilus edulis) b-mannanase gene, Eur. J. Biochem. 269 (2002) 1753–1760. [36] T.R. Henion, B.A. Macher, F. Anaraki, U. Galili, Defining the minimal size of catalytically active primate ␣1,3 galactosyltransferase: structure-function studies on the recombinant truncated enzyme, Glycobiology 4 (1994) 193–202. [37] X.H. Xu, L. Vo, B.A. Macher, Structure-function analysis of human ␣1,3-fucosyltransferase-amino acids involved in acceptor substrate specificity, J. Biol. Chem. 271 (1996) 8818–8823. [38] M. Sarkar, S. Pagny, U. Ünligil, D. Joziasse, J. Mucha, J. Glössl, H. Schachter, Removal of 106 amino acids from the N-terminus of UDP-GlcNAc:␣-3-D-mannoside b-1,2-N-acetylglucosaminyltransferase I does not inactivate the enzyme, Glycoconj. J. 15 (1998) 193–197. [39] C. Augé, A. Malleron, H. Tahrat, A. Marc, J.L. Goergen, M. Cerutti, W.F.A. Steelant, P. Dellanoy, A. Lubineau, Outstanding stability of immobilised recombinant ␣(1-3/4)-fucosyltransferases exploited in the synthesis of Lewis a and Lewis x trisaccharides, Chem. Commun. (2000) 2017–2018. [40] J. Shang, R. Qiu, J. Wang, J. Liu, R. Zhou, H. Ding, S. Yang, S. Zhang, C. Jin, Molecular cloning and expression of Galb1,3GalNAc ␣2,3sialyltransferase from human fetal liver, Eur. J. Biochem. 265 (1999) 580–588. [41] M. Molhøj, P. Ulvskov, F. Dal Degan, Characterization of a functional soluble form of a Brassica napus membrane-anchored endo-1,4-bglucanase heterologously expressed in Pichia pastoris, Plant Physiol. 127 (2001) 674–684.
Expression of eukaryotic glycosyltransferases in the yeast Pichia pastoris Monika Bencúrová, Dubravko Rendic´, Gustáv Fabini, Eva-Maria Kopecky 1, Friedrich Altmann, Iain B.H. Wilson * Glycobiology Division, Institut für Chemie, Universität für Bodenkultur, Muthgasse 18, A-1190 Vienna, Austria Received 22 November 2002; accepted 21 February 2003
Abstract The methylotrophic yeast Pichia pastoris is often used as an organism for the heterologous expression of proteins and has been used already for production of a number of glycosyltransferases involved in the biosynthesis of N- and O-linked oligosaccharides. In our recent studies, we have examined the expression in P. pastoris of Arabidopsis thaliana and Drosophila melanogaster core a1,3-fucosyltransferases (EC 2.4.1.214), A. thaliana b1,2-xylosyltransferase (EC 2.4.2.38), bovine b1,4-galactosyltransferase I (EC 2.4.1.38), D. melanogaster peptide O-xylosyltransferase (EC 2.4.2.26), D. melanogaster and Caenorhabditis elegans b1,4-galactosyltransferase VII (SQV-3; EC 2.4.1.133) and tomato Lewis-type a1,4-fucosyltransferase (EC 2.4.1.65). Temperature, cell density and medium formulation have varying effects on the amount of activity resulting from expression under the control of either the constitutive glyceraldehyde-3-phosphate dehydrogenase (GAP) or inducible alcohol oxidase (AOX1) promoters. In the case of the A. thaliana xylosyltransferase these effects were most pronounced, since constitutive expression at 16 °C resulted in 30-times more activity than inducible expression at 30 °C. Also, the exact nature of the constructs had an effect; whereas soluble forms of the A. thaliana xylosyltransferase and fucosyltransferase were active with N-terminal pentahistidine tags (in the former case facilitating purification of the recombinant protein to homogeneity), a C-terminally tagged form of the A. thaliana fucosyltransferase was inactive. In the case of D. melanogaster b1,4-galactosyltransferase VII, expression with a yeast secretion signal yielded no detectable activity; however, when a full-length form of the enzyme was introduced into P. pastoris, an active secreted form of the protein was produced. © 2003 Éditions scientifiques et médicales Elsevier SAS and Société française de biochimie et biologie moléculaire. All rights reserved. Keywords: Arabidopsis; Caenorhabditis; Drosophila; Glycosyltransferase; Pichia
1. Introduction In recent years, a major focus in glycobiology has been the cloning of cDNAs encoding glycosyltransferases and their expression in order to define the exact enzymatic activities [1]. The genomic era has led to the uncovering of far more
Abbreviations: GalGal, Galb1,4GlcNAcb1,2Mana1,6(Galb1,4GlcNAc b1,2Mana1,3)Manb1,4GlcNAc-b1,4GlcNAc;GnGn,GlcNAcb1,2Mana1,6 (GlcNAcb1,2Mana1,3)Manb1,4GlcNAc-b1,4GlcNAc; MES, 2-morpholinoethanesulphonic acid; MMH, minimal medium with methanol and histidine; MMY, minimal medium with methanol and yeast extract and peptone; MMYC, minimal medium with methanol and yeast extract, peptone and casamino acids. * Corresponding author. Tel.: +43-1-36006-6541; fax: +43-1-36006-6059. E-mail address: [email protected] (I.B.H. Wilson). 1
Present address: Institut für angewandte Mikrobiologie, Universität für Bodenkultur, Muthgasse 18, A-1190 Vienna, Austria.
glycosyltransferase genes than was previously considered possible. The discovery of multiple enzymes with overlapping substrate specificities has led to the revision of previous theories such as ‘one linkage, one enzyme’; furthermore, it appears now that most glycosyltransferases fall into a distinct number of protein families. Key to these discoveries has been the use of a wide variety of expression systems, particularly bacterial, yeast, insect and mammalian–each with its own advantages and disadvantages–in order to produce sufficient amounts of glycosyltransferases for enzymatic characterisation. Bacterial systems have the advantage of being simple to manipulate but the disadvantage of lacking the eukaryotic post-translational machinery and often result in the desired protein being locked in inclusion bodies. Nevertheless, some mammalian glycosyltransferases have been successfully expressed in E. coli and refolded to generate active protein; in some cases (b1,4-galactosyltransferase I, two a1,3-galactosyltransferases and a b1,3-glucuronyltransferase), crystallo-
© 2003 Éditions scientifiques et médicales Elsevier SAS and Société française de biochimie et biologie moléculaire. All rights reserved. DOI: 1 0 . 1 0 1 6 / S 0 3 0 0 - 9 0 8 4 ( 0 3 ) 0 0 0 7 2 - 5
414
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
graphic data has been gained after refolding procedures [2–6]. Insect systems and mammalian systems, such as Chinese hamster ovary (CHO) and monkey (COS) cells have probably been most widely used and the examples are too numerous to count here. Obviously many groups have found these systems adequate for their needs, although background endogenous activities, as well as the more complex nature of the laboratory tasks involved, may be a problem in certain cases. Yeasts have the advantage of being simpler to cultivate than mammalian cells, while still be eukaryotic. However, Saccharomyces cerevisiae hypermannosylates its glycoproteins and although human b1,4-galactosyltransferase I and a2,6-sialyltransferase have been expressed in this system [7], it appears not to have found a niche as a tool in studying the glycoenzymology of higher eukaryotes. On the other hand, Pichia pastoris appears not to hypermannosylate to the same extent as Saccharomyces [8] and a number of studies from other groups have shown its utility as a glycobiological tool. It has been used to overexpress human Lewis-type a1,3/4fucosyltransferase [9], human a1,3-fucosyltransferase VI [10], human b1,4-galactosyltransferase I [10], human b1,3glucuronyltransferase [11], human heparan sulphate copolymerase subunits [12], human a2,6-sialyltransferase ST6Gal I [10], marmoset a1,3-galactosyltransferase [13] and murine polypeptide N-acetylgalactosaminyltransferase 1 [14], as well as plant enzymes (an a1,6-galactosyltransferase and an a1,6-xylosyltransferase) involved in the biosynthesis of xyloglucans and galactomannans [15,16]. In this laboratory we have recently cloned a number of cDNA encoding enzymes involved in glycoconjugate biosynthesis in plants and insects [17–20]. Two of our targets, core a1,3-fucosyltransferase and b1,2-xylosyltransferase, are responsible for the immunogenicity of plant N-glycans [21]. We decided early on to use a simple and yet effective expression system and have successfully demonstrated heterologous expression in P. pastoris in a number of cases. Here, we describe in more detail about our efforts to optimise expression of a number of glycosyltransferases and present data on the purification of one of them (recombinant b1,2xylosyltransferase) to apparent homogeneity from yeast culture supernatant.
2. Experimental procedures 2.1. Plasmid construction and yeast transformation Trizol reagent (Invitrogen) was used to prepare total RNA from either Arabidopsis thaliana (apical tissue), Bos taurus mammary gland, unstaged Caenorhabditis elegans (Bristol N2), adult Drosophila melanogaster (Canton S or Tf24) or Leucopersicon esculentum (tomato, cv. Ailsa Craig, young leaves). For D. melanogaster peptide-O-xylosyltransferase, Berkeley EST LD43716 (Research Genetics) was used as the template.
After reverse transcription (Superscript from Invitrogen or ImProm-II from Promega with T18 primer), PCR was performed using relevant pairs of primers listed in Table 1 and the Expand High Fidelity PCR system (Roche) under the following conditions: one cycle of 95 °C for 2–3 min, 40 cycles of 1 min at 52–55 °C, 2–3 min at 72 °C and 1 min at 95 °C with a final extension step at 72 °C for 7–8 min. In the case of A. thaliana and D. melanogaster core a1,3-fucosyltransferases, A. thaliana b1,2-xylosyltransferase, D. melanogaster b1,4-galactosyltransferase VII, D. melanogaster peptide-O-xylosyltransferase and tomato Lewis a1,4-fucosyltransferase, the RT-PCR fragments were gel purified (Qiagen or Pharmacia gel purification kits) and incubated for 1 h with KpnI at 37 °C prior to addition of EcoRI, after which time the digestion was continued for one further hour. For C. elegans b1,4-galactosyltransferase VII (SQV-3), the relevant fragment was purified without electrophoresis before digestion with PstI and KpnI for 2 h prior to a second round of DNA purification, whereas for bovine b1,4-galactosyltransferase I the fragment was cut with EcoRI and XbaI and gel purified. Relevant pPICZa, pPICZ and pGAPZa plasmids (Invitrogen) were cut under the same conditions as for the cDNA fragments and were generally treated with shrimp alkaline phosphatase (Roche) during the final half-hour of restriction digestion. In the case of the A. thaliana xylosyltransferase constructs, and some of the A. thaliana fucosyltransferase constructs, cDNA fragments were then ligated into either pPICZa C (for inducible expression of secreted proteins under control of the alcohol oxidase promoter) or pGAPZa C (for constitutive expression of secreted proteins under control of the glyceraldehyde-3-phosphate dehydrogenase promoter) for 1 h at room temperature using T4 DNA ligase (Promega) and a fast ligation buffer. In all other cases, the standard ligase buffer was used for overnight ligation at 14 °C. For preparation of some of the pGAPZa forms, inserts cut from the corresponding pPICZa construct were used as fragments. After transformation into E. coli TOP10F’ cells by heat-shock and plating the cells on LB/half-salt agar containing zeocin (25 µg/ml; Invitrogen), positive clones were selected after PCR screening and by sequencing to confirm the reading frame. Two to 10 µg of the expression construct plasmid DNA was linearised according to the supplier’s instructions and used to electroporate P. pastoris competent cells (GS115), which were then plated on YPD agar containing zeocin (100 µg/ml). Screening by direct PCR amplification of colonies or after preparation of genomic DNA, using plasmid or insert specific primers, confirmed the integration of the relevant expression cassette. 2.2. Expression of glycosyltransferases in P. pastoris Selected colonies of recombinant P. pastoris were inoculated into 10 ml of pre-culture medium (YPD for constitutive or glycerol-containing MGYC medium for inducible expression) containing 100 µg/ml zeocin. After overnight incuba-
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
415
Table 1 Primers used to amplify cDNA fragments in this study A. thaliana core $ 1,3-fucosyltransferase (FucTA) AraFucTA/1/EcoRI CCGGAATTCATGGGTGTTTTCTCCAATC Sol1A/EcoRI CCGGAATTCTTTGGTCGATACGTTAAC Sol1A/EcoRI/His CCGGAATTCTCATCATCATCATCATTTGGTCGATACGTTAACC Sol1A/Del1/EcoRI CCGGAATTCTGAGAAATGCCAGGAGTGG Sol1A/Del2/EcoRI CCGGAATTCTTTAGAGAGAGTGGATTCAG 2dA/KpnI CGGGGTACCTTAGACAAAGACAACTTCG 2dA/KpnI/His CGGGGTACCACAAAGACAACTTCGAATTTG A. thaliana b 1,2-xylosyltransferase AXT1/EcoRI CCGGAATTCGTCGTTTTCACCGGAG AXT1/EcoR1/His CCGGAATTCTCATCATCATCATCATTCGTTTTCACCGGAG AXT2/KpnI CGGGGTACCTTAGCAGCCAAGGCTCTTC Bovine b 1,4-galactosyltransferase I (lactose synthetase A) GalT/1/EcoRI CCGAATTCCTGCGAGGGGTCGCAC GalT/2/XbaI TGCTCTAGAGCACTAGCTCGGCGTCCCG C. elegans b 1,4-galactosyltransferase VII (SQV-3) SQV3/1/PstI AACTGCAGTTCTCGATTTAGAGATAAC SQV/2/KpnI CCGGTACCTATGATTTGCAATAAGGTG D. melanogaster core ␣ 1,3-fucosyltransferase (FucTA) 10071EcoHisTM CGGGAATTCCATCATCATCATCATAAGGAGCGCGAAATATGGAAG 10071revKpn CCGGGGTACCTCAGTCGTCGCTGGAGTCG D. melanogaster b 1,4-galactosyltransferase VII DmGalT7/1/EcoRI CCGGAATTCATGGTCAATATATCCACC GalT7TmHis4EcoRI CCGGAATTCCATCATCATCATAGTGTCATGCCATTGGGATC GalT7revKpnI CCGGGGTACCTCAGGTTTGTACCGCCGATG D. melanogaster peptide O-xylosyltransferase (OXT) DMXT3/EcoRI CCGGAATTCCCTGGACATCGTAGG DMXT2/KpnI CGGGGTACCTCATTTGAGCAGGGCATC Tomato Lewis ␣ 1,4-fucosyltransferase (FucTC) TomC5/EcoRI CCGGAATTCACTTCACACTTCTTC TomC2/KpnI CGGGGTACCTCAAGAGGCTTTTGCATTTC
tion at generally 30 °C with continuous shaking (200 rpm) in baffled flasks, cells where collected by centrifugation at 1500 × g. In the case of constitutive expression, cells were then resuspended in freshYPD with no zeocin and samples of the culture were removed every 24 h. In the case of inducible expression, the cells were washed once in 1.34% (w/v) yeast nitrogen base solution and resuspended in methanolcontaining MMYC medium. Every 24 h samples of the cultures were removed and extra methanol added to maintain a concentration of 1% (v/v). 2.3. Assay for glycosyltransferases In order to verify activity of the secreted forms of A. thaliana and D. melanogaster core a1,3-fucosyltransferase, A. thaliana b1,2-xylosyltransferase and bovine b1,4-galactosyltransferase I, culture supernatants were collected by centrifugation, generally concentrated by centrifugal ultrafiltration (Vivaspin or Amicon, MWCO 10000) and enzymatic assays performed. Dabsyl- or dansyl-modified forms of a GnGn glycopeptide, with the sequence Gly– Glu–Asn–Arg derived from Pronase digestion of bovine fibrin, were used as acceptor substrates (Calbiochem) [17,22]. Reactions containing 0.05–0.1 mM acceptor, 1 mM donor (GDP-Fuc, UDP-Xyl or UDP-Gal), 10 mM MnCl2, 25 mM
Forward, full-length form Forward, ∆1–66 and ∆1–66/C-His forms Forward, ∆1–66/N-His form Forward, ∆1–90 form Forward, ∆1–95 form Reverse, most forms Reverse, only ∆1–66/C-His form Forward, untagged form Forward, His-tagged form Reverse, both forms Forward Reverse Forward Reverse Forward Reverse Forward, full-length form Forward, truncated form Reverse, both forms Forward Reverse Forward Reverse
2-morpholinoethanesulphonic acid (MES), pH 6.5 (pH 7.0 in the case of bovine galactosyltransferase) and 5 µl of 10-fold concentrated supernatant were performed in a final volume of 10 µl. Aliquots of the enzymatic assay mixtures were removed after either 1, 2 or 4 h or overnight incubation and analysed by reversed-phase HPLC [22] or MALDI-TOF mass spectrometry [17]. For bovine galactosyltransferase, 1 U is defined as the amount of enzyme transferring 1 µmol of galactose from UDP-galactose to dabsylated GnGn-peptide per min at 37 °C, the reaction always being terminated before the appearance of the digalactosylated form (GalGal), whereas for core fucosyltransferase (or xylosyltransferase) 1 U is defined as the amount of enzyme transferring 1 µmol of fucose (or xylose) from GDP-fucose (or UDP-xylose) to dansylated GnGn-peptide per min at 37 °C (or 16 °C)-the reaction being always terminated before 20% conversion of substrate. For D. melanogaster b1,4-galactosyltransferase VII, both the supernatants and cells of P. pastoris transformed with full-length forms of the open reading frame were assayed for activity. After removal and 10-fold concentration of the supernatant (Ultrafree-0.5 with a Biomax membrane with MWCO of 5000, Millipore), cells from 2 ml culture were resuspended in 100 µl 40 mM MES, pH 7, 1 mM ethylenediamine tetraacetate, 1 mM dithiothreitol, 5 mM MnCl2, 5 mM
416
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
MgCl2, 0.4% Triton-X-100 with protease inhibitor cocktail (Roche), vortexed and centrifuged. The pellet was again vortexed and centrifuged, but in the presence of glass beads, to obtain a second Triton extract. Soluble recombinant C. elegans, intracellular and soluble forms of recombinant D. melanogaster b1,4-galactosyltransferase VII were assayed for transfer of galactose to p-nitrophenyl xylose. Briefly, reaction mixtures of 30 µl containing 100 mM MES, pH 6, 15 mM MnCl2, 20 mM p-nitrophenyl xylose (from a 500 mM stock dissolved in DMSO), 0.67 mM UDPgalactose, 80,000 dpm UDP-[14C]galactose (NEN) and 10 µl of P. pastoris extract were incubated for 21 h at room temperature. Two microlitres of these mixtures were spotted onto HPTLC plates (Merck). After development of the chromatograms in 100:10:10:3:30 ethanol/pyridine/n-butanol/acetic acid/water, the TLC plates were subject to autoradiography. One unit of activity is defined as the transfer of 1 µmol of galactose from UDP-galactose to p-nitrophenyl xylose per min at pH 6.5 and room temperature as estimated by relative spot intensities. For other glycosyltransferases (tomato Lewis a1,4fucosyltransferase and D. melanogaster peptide-O-xylosyltransferase), previously-published procedures were used for assaying activity [18,19]. In all cases, various controls (P. pastoris transformed with other glycosyltransferase cDNAs or with a vector lacking an insert) were used to test for background activities. 2.4. Purification of core ␣1,3-fucosyltransferase To enrich the recombinant A. thaliana core a1,3fucosyltransferase, dye-ligand affinity chromatography was performed as used in the procedure to purify mung bean fucosyltransferase [23]. All steps were performed at 4 °C. After expression, phenylmethylsulphonyl flouride (final concentration 0.1 mg/ml) was added to the culture medium, which was then centrifuged at 1500 × g for 5 min. The resulting supernatant was centrifuged again at 13,000 × g for 15 min prior to concentration, washing with binding buffer (25 mM, MES, pH 6.8) and reconcentration to finally yield a 10-fold concentrated supernatant, 0.5 ml of which was then applied to an Affi-Gel Blue column (BioRad, 0.7 × 15 cm) previously equilibrated with binding buffer. The sample was incubated with the resin for 1 h at 4 °C and the column was washed using 200 ml of binding buffer. The active enzyme was eluted with binding buffer additionally containing 0.05% Triton and 600 mM NaCl and was subsequently concentrated 10-fold. Protein content of the partially purified enzyme was determined by utilizing the Micro BCA protein Assay Reagent Kit (Pierce). 2.5. Purification of recombinant b1,2-xylosyltransferase All purification steps for recombinant A. thaliana b1,2xylosyltransferase were performed at 4 °C. Immediately after the expression, the protease inhibitors phenylmethanesulphonyl fluoride (Roche; final concentration 0.1 mg/ml)
and leupeptin (Sigma; final concentration 0.5 µg/ml) were added to the culture, which was then centrifuged in the same way as with fucosyltransferase prior to adjusting the pH of the culture supernatant to 7.2 with HCl. One hundred and fifty millilitres of medium was diluted with 350 ml of binding buffer containing 25 mM MES, 400 mM NaCl, 10 mM imidazole and 0.02% (w/v) NaN3, pH 7.2 and applied to a Ni2+-chelation column (iminodiacetic acid-agarose, Sigma; approximately 700 µl packed volume) sequentially prewashed with 0.1 M NiSO4 and binding buffer. After application of the sample, the column was washed with increasing amounts of imidazole prior to elution in buffer containing 25 mM MES, 400 mM NaCl, 250 mM imidazole and 0.02% NaN3, pH 6.8. The purified protein was collected and concentrated 10-fold (Centricon, Millipore, MWCO 10000) and stored at 4 °C. The purity of the protein was analysed by SDS-PAGE and silver-stained according to the Amersham Pharmacia Biotech protocol. 3. Results 3.1. Expression of A. thaliana core ␣1,3-fucosyltransferase Initial optimisation studies on A. thaliana core a1,3fucosyltransferase (FucTA) were performed on the previously-described form (D1-66; see Table 1 for construct nomenclature) [17] to determine the effect of different media compositions on methanol-inducible expression (Fig. 1). Using a minimal methanol medium containing histidine (MMH) was found to result in no detectable activity, whereas cells growing in a standard medium (MMY, methanol minimal medium with yeast extract) secreted detectable activity. The best results, though, were obtained when using a richer medium (MMYC, methanol minimal medium with yeast extract and casamino acids). The beneficial effect of casamino acids on activity levels was also seen with recombinant murine polypeptide N-acetylgalactosaminyltransferases [24]. It was also found that using MMYC medium buffered with MES to pH 6 had no significant effect on the activity as compared to non-buffered medium even though in the latter case the final pH (as measured after 2 d of expression: 7.4 in contrast to 6.6) was higher. Subsequently, two variants (D1-66/C-His and D1-66/NHis) with either an in-frame 3’-terminal series of six histidine codons as present in the commercial pPICZaC vector or with five histidine codons present in frame within the 5’-primer and two forms (D1-90 and D1-95) encoding proteins having or lacking the conserved C-Q/E-E-W motif [17] were constructed in the pPICZaC vector. The D1-66, D1-66/N-His and D1-66/C-His forms were cloned also into pGAPZaC. Both vectors encode an N-terminal S. cerevisiae a-secretion factor signal, which facilitates the secretion of the protein into the medium. In all cases, the expected fucosyltransferase activity could be detected for all forms except for those with either a His-tag on its C-terminus or lacking the C-Q/E-E-W sequence at its N-terminus. In addition, intracellular fucosyl-
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
417
Table 2 Enzymatic activity of different enzymes after either constitutive or inducible expression in P. pastoris. The results given are of the highest activities (U/l) obtained in the supernatants. ND, not determined Enzyme A. thaliana core a1,3-fucosyltransferase ∆1–66 ∆1–66/N-His ∆1–66/C-His ∆1–95 A. thaliana b1,2-xylosyltransferasea Bovine b1,4-galactosyltransferase I C. elegans galactosyltransferase VII D. melanogaster core a1,3-fucosyltransferase D. melanogaster galactosyltransferase VIIb D. melanogaster peptide O-xylosyltransferase Tomato Lewis a1,4-fucosyltransferase
Constitutive
Inducible
1.0 (30 °C) 1.0 (30 °C) 0 ND 1.5 (16 °C) 0.3 (30 °C) ND 0.00165 (30 °C) ND
1.0 (30 °C) 1.0 (30 °C) 0 0 0.05 (16 °C) 0.3 (30 °C) 0.016 (16 °C) 0.0015 (30 °C)
ND
1.0 (30 °C)
0.8 (30 °C)
1.0 (30 °C)
0.16 (16 °C)
a
Both His-tagged and non-tagged forms gave comparable results. b activity secreted into medium from P. pastoris transformed with the full-length form.
Fig. 1. Assay of core a1,3-fucosyltransferase activity. Supernatants of P. pastoris transformed with the A. thaliana core a1,3-fucosyltransferase D1-66 construct (i.e., lacking the first 66 residues) and grown in either MMH, MMY or MMYC were collected after 48 h. After incubation of 5 µl supernatant with dansyl GnGn and GDP-Fuc for 24 h at 37 °C, the assay mixtures were analysed by reversed-phase HPLC and fluorescence detection.
transferase activity was only found when P. pastoris were transformed with a full-length form of the A. thaliana core fucosyltransferase reading frame (data not shown). By screening 25 individual P. pastoris clones of D1-66 and D1-66/N-His (freshly restreaked prior to inoculation to yield single colonies), those producing constitutively and inducibly expressed enzyme with the highest activity per volume were selected. For successful expression, the preculture in the presence of zeocin was crucial and the ideal optical density of culture at the starting point of expression was found to be 1. During the 4 d of expression, aliquots of the supernatants were taken every 24 h in order to monitor the enzymatic activity. There was no significant difference between the constitutive and inducible methods for expression and maximal fucosyltransferase expression at 30 °C for 72 h was approximately 1 U/l (see also Table 2). 3.2. Purification of recombinant core ␣1,3-fucosyltransferases Preliminary trials indicated that purification of A. thaliana fucosyltransferase carrying the pentahistidine tag on its N-terminus using Ni2+-chelate affinity chromatography was unsuccessful, since the protein failed to bind the affinity matrix. Therefore, as an alternative, Affi-Gel Blue was used as the matrix. The addition of Triton-X-100 was found to be essential for the success of the subsequent high-salt elution step. The enzyme was eluted within 3 ml (i.e., six-times the
loaded volume). Approximately 80% of enzymatic activity was recovered after dye-affinity chromatography of both the His-tagged and non-fused forms of the protein, but only partial purification was achieved (specific activity 0.45 U/mg). In contrast, to the A. thaliana enzyme, the N-terminally His-tagged D. melanogaster core fucosyltransferase FucTA [20] was able to interact with – and be eluted from – the nickel resin, but the overall levels of enzyme activity after either inducible or constitutive expression were rather low (Table 2) and subsequent studies were, therefore, not pursued. Proteolysis of the recombinant enzyme is probably not responsible for the low activity, since western blotting of a supernatant of yeast expressing fly FucTA indicated that a mouse antiserum raised against a peptide corresponding to residues 121–140 of the fly FucTA sequence recognised only a single polypeptide of approximately Mr 60,000 as compared to a theoretical molecular weight of the soluble form of Mr57,000 (data not shown). 3.3. Expression and purification of recombinant b1,2-xylosyltransferase The A. thaliana b1,2-xylosyltransferase cDNA fragment missing the first 31 codons and with a 5’-terminal in-frame (CAT)5 sequence (encoding an N-terminal pentahistidine tag), but otherwise identical with the sequence of Strasser et al. [25], was engineered into pGAPZa C and pPICZa C and a number of P. pastoris clones were screened for activity (see Fig. 2 for an example activity assay). In the case of this enzyme, the comparison of constitutive and inducible expression showed the former to be far superior. Fermentation conditions were particularly crucial: by expression and assay at 16 °C, a maximal activity of 1.5 U/l after 94 h of expression was achieved (Table 2). Longer times of expression led to a decreasing level of activity even at 16 °C.
418
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
Fig. 3. SDS-PAGE analysis of purified recombinant b1,2-xylosyltransferase. Fig. 2. Assay of b1,2-xylosyltransferase activity. Incubations (1 h, 16 °C) of dansyl GnGn and culture supernatant of P. pastoris transformed with b1,2xylosyltransferase in the absence (a) and presence (b) of UDP-xylose were analysed by MALDI-TOF mass spectrometry. The difference between the m/z of the substrate (2006.5) and the product (2138.8) corresponds to the addition of a single xylose residue. The species of m/z 2168.9 corresponds to a remnant of a b1,3-galactose-substituted GnGn glycopeptide.
The recombinant enzyme was purified using Ni2+-chelate affinity chromatography to apparent homogeneity. A single silver-stained band of approximately 60 kDa was observed upon SDS-PAGE (Fig. 3). According to the staining, the yield was estimated to be approximately 2.5 µg protein from 100 ml collected culture media with a specific activity was 0.33 U/mg. While the purified enzyme was not stable when subject to a single freeze-thaw cycle, it could be stored at 4 °C for at least 3 weeks with no appreciable loss of activity. 3.4. Expression of bovine b1,4-galactosyltransferase I Bovine b1,4-galactosyltransferase I (lactose synthase A protein) is one of the most studied enzymes of the glycosyltransferase superfamily. In our initial studies a cDNA fragment encoding the soluble form of this enzyme was cloned into the pICZaC vector and it was expressed under the control of the methanol-inducible promoter, data from screening the activity in growth media indicating a yield of
11 mU/l. Induction of the P. pastoris culture with methanol at higher OD600 (e.g., 15) yielded lower activities of the recombinant enzyme, while, typically, the best yields of b1,4galactosyltransferase activity were achieved on a second and third day of expression. As expected, minor variations in activity (up to threefold) from clone to clone did exist. It was also noticed that the pH of the media during the expression rose from pH 7–9.5. Since it is known that the bovine b1,4galactosyltransferase is active in range pH 6–9 with a maximum between pH 6.5 and 8 [26], pH of the media was adjusted to either 5.0, 6.0 or 7.0 with HCl (either with or without the inclusion in the medium of MES, sodium salt). Overall, optimised expression (i.e., at pH 6 with resuspension of the cells in the induction medium to give OD600 1) with the best clone yielded 300 mU/l after 2 d of expression. Recloning of the enzyme reading frame into the pGAPZaC vector, placing the galactosyltransferase under the control of a constitutive promoter, yielded activities comparable to those achieved under the control of methanol-inducible promoter. It must also be noted that some galactosyltransferase activity was detected within the transformed P. pastoris cells (ca. 70 mU/l of culture after 3 d of expression), indicating that roughly one third of the active enzyme remains in the cells or is in the process of leaving the cells.
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
419
3.5. Expression of C. elegans and D. melanogaster b1,4-galactosyltransferase VII The enzyme which transfers the first galactose residue of the chondroitin/heparan glycosaminoglycan core is important in nematode development, as judged by the effect of the sqv-3 (squashed vulva-3) mutation [27], and defects in the homologous human gene are implicated in some cases of Ehlers-Danlos syndrome [28,29]. The results of sequencing the D. melanogaster genome indicated that the fly has three b1,4-galactosyltransferase genes of unknown function [30,31]; therefore, we were interested in determining which homologue encoded a galactosyltransferase I (following the nomenclature of glycosaminoglycan synthesis) activity. Initially, fragments of all fly b1,4-galactosyltransferase cDNAs encoding soluble forms of the putative enzymes were cloned into Baculovirus and P. pastoris vectors; however, in no case were the initial results promising. Later, we constructed a form of the pPICZ A vector (which lacks the a-factor secretion signal) carrying the full open reading frame of the fly cDNA (CG11780) encoding the closest homologue to the worm SQV-3 and human b1,4-galactosyltransferase VII, as well as a truncated form of the worm SQV-3 cDNA within the pPICZa B vector lacking the region encoding the cytoplasmic and transmembrane domains. Testing various extracts from the cells (a first Triton extract and a second Triton extract obtained after beating the cells with beads) and 10-fold concentrated supernatant after 2 and 3 d of expression of full-length form of fly b1,4galactosyltransferase VII in P. pastoris indicated that the enzyme was also present in the medium as judged by a TLC-based activity test (Fig. 4). The secreted form of the worm SQV-3 protein was apparently expressed less well, but activity was detected after 4 d expression at 16 °C (Fig. 4); 17 °C being the apparent temperature optimum for the recombinant worm enzyme expressed in COS-7 cells [27]. As the control, no transfer of galactose to p-nitrophenyl xylose was detected with the medium of P. pastoris transformed with a full-length A. thaliana FucTB cDNA. Furthermore, RP-HPLC confirmed that the recombinant fly b1,4galactosyltransferase VII converted p-nitrophenyl xylose into a product of lower retention time (data not shown); this product was digested back to p-nitrophenyl xylose by the b1,4-specific galactosidase from Aspergillus oryzae. Although recently two reports [32,33] have confirmed that the fly b1,4-galactosyltransferase VII homologue has indeed the same function as that putatively assigned by its homology, the present data is the first to show successful expression of a fly galactosyltransferase in P. pastoris. Perhaps significantly, both the other studies on heterologous expression of this enzyme utilised full-length rather than secreted forms. 3.6. Other glycosyltransferases expressed in P. pastoris In the course of our studies, three other enzymes have been successfully expressed in P. pastoris: D. melanogaster peptide-O-xylosyltransferase [19], rice N-acetylglucos-
Fig. 4. Assay of D. melanogaster and C. elegans b1,4-galactosyltransferase VII. Incubations were performed as described under Section 2, using the following extracts: 1, 10-fold concentrated medium of P. pastoris transformed with expression vector carrying A. thaliana FucTB open reading frame; 2–7, P. pastoris expressing D. melanogaster b1,4-galactosyltransferase VII—respectively, 10-fold concentrated media (second and third day of expression), first Triton-X-100 extracts (second and third day of expression), second Triton-X-100 extracts (second and third day of expression); 8–10, concentrated medium of P. pastoris expressing C. elegans b1,4galactosyltransferase VII (second, third and fourth day of expression, respectively).
aminyltransferase I (Wilson et al., in preparation) and tomato Lewis-type a1,4-fucosyltransferase [18]. In the first and last case, inducible expression was never optimised, but was of the order of 1 U/l and was thus considered sufficient for the purpose of enzymatic characterisation. In the case of the D. melanogaster peptide-O-xylosyltransferase, the presence of a C-terminal His-tag appeared to have no deleterious effect on activity (I.B.H.W., unpublished data). Subsequent to the previous publication [18], the tomato enzyme has been expressed under the control of the constitutive glyceraldehyde-3-phosphate dehydrogenase promoter. No significant difference in activity was detected comparing inducible and constitutive heterologous expression of the tomato enzyme (Table 2). 4. Discussion As shown by the present and previously-published data, we have been able to express a range of glycosyltransferases in P. pastoris, using either methanol-inducible (AOX1 promoter) or constitutive (GAP1 promoter) expression. Generally, most studies on P. pastoris expression are performed using the methanol-inducible system; however, the possible advantage of constitutive expression was shown by a study on marmoset a1,3-galactosyltransferase [13] in which 100times more protein were produced than by inducible expression. Due to the low expression level obtained on methanolinduction of A. thaliana b1,2-xylosyltransferase activity, we
420
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
Despite the switch in the promoter used, expression of A. thaliana b1,2-xylosyltransferase (either His-tagged or non-tagged) was still not especially high and still considered insufficient for the proposed use (i.e., remodelling of glycoproteins in order to produce neoglycoforms suitable for the study of anti-carbohydrate antibodies). A search of the literature resulted in finding a few studies (e.g., with a galactose oxidase and blue mussel b-mannanase) showing that lowering the temperature during expression had a significant effect [34,35]. Indeed a lower temperature (16 °C in contrast to the normal 30 °C) and longer time of expression (94 h) resulted in the highest yields of activity. The purified P. pastorisexpressed xylosyltransferase was most active at 16 °C indicating that the enzyme is unstable at higher temperatures. In other cases, the effect of temperature on expression levels was not so pronounced, but certainly with two enzymes whose temperature stability was tested (A. thaliana core fucosyltransferase and D. melanogaster peptide-O-xylosyltransferase), the initial rate of reaction was higher at 37 °C, but when measured by overnight incubation, these two enzymes were more stable at RT and 30 °C; at 16 °C neither enzyme was significantly active.
In some cases attempts to express glycosyltransferases in P. pastoris have not resulted in any activity (e.g., a human a2,3-sialyltransferase [40]). However, most studies do not present data on failures and so there may be many other groups who have not detected activity of their desired enzyme from recombinant P. pastoris. In our case, preliminary attempts with soluble expression of mammalian and plant b1,3-galactosyltransferase homologues, a bovine and a fly sialyltransferase, A. thaliana a1,4-fucosyltransferase (FucTC), three fly fucosyltransferases (a1,6-fucosyltransferase, FucTB and FucTC) and three fly b1,4-galactosyltransferase homologues, failed to result in detectable activities. We have not, so far, attempted to express all these ‘failures’ at temperatures lower than 30 °C or with constitutive expression or in full-length form or in a proteasedeficient strain. Prompted, however, by data in press demonstrating that the fly b1,4-galactosyltransferase VII homologue was indeed active upon overexpression in insect and mammalian cells [32,33] and by data indicating that a plant a1,6-xylosyltransferase was expressed as a full-length membrane-bound enzyme in P. pastoris [16], we decided to once again try one of these problematic cases by expressing a full-length form of fly b1,4-galactosyltransferase VII at 16 °C with the pre-culture grown in the presence of zeocin. Indeed in this experiment the expression was successful with activity being present in the medium (0.16 U/l) and in the cells, suggesting that either the previous attempts had failed due to an incompatibility of the fly galactosyltransferase with the yeast secretion signal or that expression at 16 °C was crucial.
The correct position of the fusion purification tag with respect to the catalytic domain of the glycosyltransferase can be important, since according to our experience with A. thaliana core fucosyltransferase, construction of a form with a C-terminally fused His-tag resulted in the detection of no enzyme activity. One could hypothesise that the correct folding important for the activity could have been influenced by the fusion-indeed the C-terminal region of the plant core fucosyltransferases is quite highly conserved [17]. In some glycosyltransferases the C-terminus has also been found to be sensitive to any changes in primary structure, since the removal of only a few amino acids from the C-terminus of either marmoset a1,3-galactosyltransferase, human FucT-V or rabbit GlcNAcT-I results in a complete or large loss of enzyme activity [36–38]; on the other hand, the human a1,3/4-fucosyltransferase, FucT-III, was successfully expressed in CHO cells with a C-terminal His-tag and was even active when immobilised on a chelation resin [39]. The N-terminal region of A. thaliana core fucosyltransferase is less sensitive to such changes, perhaps since the stem region is less conserved. Indeed removal of the entire stem, but still retaining the conserved C-Q-E-W motif [17], seems possible, but a form (D1-95) lacking this sequence is inactive. Thus, both the removal and addition of amino acids from either the N- or C-termini can have significant effects on glycosyltransferase activity.
Overall, therefore, a number of factors must be considered before using P. pastoris as an expression system for glycosyltransferases. Any strategy should include constructing vectors encoding both soluble and full-length forms under the control of either promoter. If one promoter has to be chosen, then the constitutive promoter is that of choice since the expression is the easiest to perform (no washing to remove non-methanolic carbon sources, no addition of extra methanol each day, no need to optimise methanol concentration) and since, of those tested, no enzyme that worked with inducible expression did not function with constitutive expression. Our own data as well as that from a study on Brassica endoglucanase [41] suggest that zeocin should be present in any pre-culture; also, factors affecting protease activities should be considered. We assume that reducing expression temperature, diluting the cells to an OD600 of 1 for expression and including casamino acids in the medium have their effects due to reducing or crudely inhibiting protease activities. Even though reducing the temperature of expression (pre-culturing still being performed at 28 or 30 °C) slows down yeast growth, overall yields of activity can be higher. In summary, the P. pastoris system can be used to express glycosyltransferases from a variety of eukaryotic organisms and culture supernatants can be used directly in MALDIbased assays. Furthermore, transformation and expression
were then prompted to try constitutive expression with this enzyme and indeed far higher levels of activity resulted. With none of the other four enzymes tested in both systems (A. thaliana and D. melanogaster core a1,3-fucosyltransferase, bovine b1,4-galactosyltransferase I and tomato a1,4-fucosyltransferase), though, was the difference between inducible and constitutive expression significant.
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
are easy to perform in almost any biochemical laboratory and the lack of endogenous complex glycosylation, resulting in a lack of background activities, supports our belief that P. pastoris can be considered a suitable host for the study of enzymes relevant to the glycosylation pathway of plants and animals.
Acknowledgements This study was funded by the Austrian Fonds zur Förderung der wissenschaftlichen Forschung (grant S-8803 to F.A. and grant P-13810 to I.B.H.W.) and Neose Technologies, Inc. (Glycoscience Research Award to I.B.H.W.). The authors thank Katharina Paschinger for preparing cDNA from C. elegans and reading the manuscript, to Angelika Freilinger for preliminary purification experiments with D. melanogaster core a1,3-fucosyltransferase and to Dr. Florian Rüker for his advice during our initial experiments with P. pastoris. The authors also thank Prof. Leopold März, currently Rektor of the Universität für Bodenkultur, for his continued support for the people and research of the Glycobiology Division.
References [1] [2]
[3]
[4]
[5]
[6]
[7]
[8] [9]
R.M. Bill, L. Revers, I.B.H. Wilson, Protein Glycosylation, Kluwer Academic Publishers, Boston/Dordrecht/London, 1998. B. Ramakrishnan, P.K. Qasba, Crystal structure of lactose synthase reveals a large conformational change in its catalytic component, the b1,4 galactosyltransferase-I, J. Mol. Biol. 310 (2001) 205–218. L.N. Gastinel, C. Bignon, A.K. Misra, O. Hindsgaul, J.H. Shaper, D.H. Joziasse, Bovine ␣1,3-galactosyltransferase catalytic domain structure and its relationship with ABO histo-blood group and glycosphingolipid glycosyltransferases, EMBO J. 20 (2001) 638–649. E. Boix, G.J. Swaminathan, Y. Zhang, R. Natesh, K. Brew, K.R. Acharya, Structure of UDP-complex of UDP-galactose: b-galactoside-␣-1,3-galactosyltransferase at 1.53-Å resolution reveals a conformational change in the catalytically important C-terminus, J. Biol. Chem. 276 (2001) 48608–48614. S.I. Patenaude, N.O. Seto, S.N. Borisova, A. Szpacenko, S.L. Marcus, M.M. Palcic, S.V. Evans, The structural basis for specificity in human ABO(H) blood group biosynthesis, Nat. Struct. Biol. 9 (2002) 685–690. L.C. Pedersen, K. Tsuchida, H. Kitagawa, K. Sugahara, T.A. Darden, M. Negishi, Heparan/Chondroitin sulphate biosynthesis. Structure and mechanism of human glucuronyltransferase I, J. Biol. Chem. 275 (2000) 34580–34585. C.H. Krezdorn, R.B. Kleene, M. Watzele, S.X. Ivanov, C.H. Hokke, J.P. Kamerling, E.G. Berger, Human b1,4 galactosyltransferase and ␣2,6 sialyltransferase expressed in Saccharomyces cerevisiae are retained as active enzymes in the endoplasmic reticulum, Eur. J. Biochem. 220 (1994) 809–817. R.K. Bretthauer, F.J. Castellino, Glycosylation of Pichia pastorisderived proteins, Biotechnol. Appl. Biochem. 30 (1999) 193–200. P.F. Gallet, H. Vaujour, J.M. Petit, A. Maftah, A. Oulmouden, R. Oriol, C. Le Narvor, M. Guilloton, R. Julien, Heterologous expression of an engineered truncated form of human Lewis fucosyltransferase (FucTIII) by the methylotrophic yeast Pichia pastoris, Glycobiology 8 (1998) 919–925.
421
[10] M. Malissard, S. Zeng, E.G. Berger, Expression of functional soluble forms of human b-1,4-galactosyltransferase I, ␣-2,6-sialyltransferase, and ␣-1,3-fucosyltransferase VI in the methylotrophic yeast Pichia pastoris, Biochem. Biophys. Res. Commun. 267 (2000) 169–173. [11] M. Ouzzine, S. Gulberti, P. Netter, J. Magdalou, S. Fournel-Gigleux, Structure/function of the human Galb1,3-glucuronosyltransferase. Dimerization and functional activity are mediated by two crucial cysteine residues, J. Biol. Chem. 275 (2000) 28254–28260. [12] C. Senay, T. Lind, K. Mugurama, Y. Tone, H. Kitagawa, K. Sugahara, K. Lidholt, U. Lindahl, M. Kusche-Gullberg, The EXT1/EXT2 tumour suppressors: catalytic activities and role in heparan sulphate biosynthesis, EMBO Rep. 1 (2000) 282–286. [13] Z.C. Chen, M. Tanemura, U. Galili, Synthesis of ␣-gal epitopes (Gal␣1-3Galb1-4GlcNAc-R) on human tumour cells by recombinant ␣1,3-galactosyltransferase produced in Pichia pastoris, Glycobiology 11 (2001) 577–586. [14] K.G. Ten Hagen, D. Tetaert, F.K. Hagen, C. Richet, T.M. Beres, J. Gagnon, M.M. Balys, B. VanWuyckhuyse, G.S. Bedi, P. Degand, L.A. Tabak, Characterization of a UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase that displays glycopeptide N-acetylgalactosaminyltransferase activity, J. Biol. Chem. 274 (1999) 27867–27874. [15] M.E. Edwards, C.A. Dickson, S. Chengappa, C. Sidebottom, M.J. Gidley, J.S. Reid, Molecular characterisation of a membranebound galactosyltransferase of plant cell wall matrix polysaccharide biosynthesis, Plant J. 19 (1999) 691–697. [16] A. Faik, N.J. Price, N.V. Raikhel, K. Keegstra, An Arabidopsis gene encoding an ␣-xylosyltransferase involved in xyloglucan biosynthesis, Proc. Natl. Acad. Sci. USA 99 (2002) 7797–7802. [17] I.B.H. Wilson, D. Rendic´ , J. Dumic´ , A. Freilinger, F. Altmann, J. Mucha, S. Müller, M.T. Hauser, Cloning and expression of ␣1,3fucosyltransferase homologues from Arabidopsis thaliana, Biochim. Biophys. Acta 1527 (2001) 88–96. [18] I.B.H. Wilson, Identification of a cDNA encoding a plant Lewis-type ␣1,4-fucosyltransferase, Glycoconj. J. 18 (2001) 439–447. [19] I.B.H. Wilson, Functional characterisation of Drosophila melanogaster peptide O-xylosyltransferase, the key enzyme for proteoglycan chain initiation and member of the core 2/I N-acetylglucosaminyltransferase family, J. Biol. Chem. 277 (2002) 21207–21212. [20] G. Fabini, A. Freilinger, F. Altmann, I.B.H. Wilson, Identification of core ␣1,3-fucosylated glycans and the requisite fucosyltransferase in Drosophila melanogaster. Potential basis of the neural antihorseradish peroxidase epitope, J. Biol. Chem. 276 (2001) 28058–28067. [21] K. Fötisch, S. Vieths, N- and O-linked oligosaccharides of allergenic glycoproteins, Glycoconj. J. 18 (2001) 373–390. [22] A. Roitinger, H. Leiter, E. Staudacher, F. Altmann, HPLC method for the determination of Fuc to Asn-linked GlcNAc fucosyltransferases, Glycoconj. J. 15 (1998) 89–91. [23] H. Leiter, J. Mucha, E. Staudacher, R. Grimm, J. Glössl, F. Altmann, Purification, cDNA cloning, and expression of GDP-L-Fuc:Asnlinked GlcNAc ␣1,3-fucosyltransferase from mung beans, J. Biol. Chem. 274 (1999) 21830–21839. [24] H. Mao, M.E. Forsythe, G.S. Bedi, B. van Wuyckhuyse, L.A. Tabak, Expression of murine UDP-GalNAc:polypeptide N-acetylgalactosaminyltransferase-T1, T2, T3 in Pichia pastoris, Glycoconj. J. 17 (2000) 45 (Abstract S2.10). [25] R. Strasser, J. Mucha, L. Mach, F. Altmann, I.B.H. Wilson, J. Glössl, H. Steinkellner, Molecular cloning and functional expression of b1,2xylosyltransferase cDNA from Arabidopsis thaliana, FEBS Lett. 472 (2000) 105–108. [26] H. Babad, W.Z. Hassid, Soluble uridine diphosphate D-galactose: D-glucose b-4-D-galactosyltransferase from bovine milk, J. Biol. Chem. 241 (1966) 2672–2678.
422
M. Bencúrová et al. / Biochimie 85 (2003) 413–422
[27] D.A. Bulik, G. Wei, H. Toyoda, A. Kinoshita-Toyoda, W.R. Waldrip, J.D. Esko, P.W. Robbinsm, S.B. Selleck, sqv-3, -7, and -8, a set of genes affecting morphogenesis in Caenorhabditis elegans, encode enzymes required for glycosaminoglycan biosynthesis, Proc. Natl. Acad. Sci. USA 97 (2000) 10838–10843. [28] R. Almeida, S.B. Levery, U. Mandel, H. Kresse, T. Schwientek, E.P. Bennett, H. Clausen, Cloning and expression of a proteoglycan UDP-galactose: b-xylose b1,4-galactosyltransferase. A seventh member of the human b4-galactosyltransferase gene family, J. Biol. Chem. 274 (1999) 26165–26171. [29] K. Furukawa, T. Okajima, Galactosyltransferase I is a gene responsible for progeroid variant of Ehlers-Danlos syndrome: molecular cloning and identification of mutations, Biochim. Biophys. Acta 1573 (2002) 377–381. [30] F. Altmann, G. Fabini, H. Ahorn, I.B.H. Wilson, Genetic model organisms in the study of N-glycans, Biochimie 83 (2001) 703–712. [31] G. Fabini, I.B.H. Wilson, Glycosyltransferases from Drosophila melanogaster, Dros. Inf. Serv. 84 (2001) 122–129. [32] Y. Nakamura, N. Haines, J. Chen, T. Okajima, K. Furukawa, T. Urano, P. Stanley, K.D. Irvine, Identification of a Drosophila gene encoding xylosylprotein b4-galactosyltransferase that is essential for the synthesis of glycosaminoglycans and for morphogenesis, J. Biol. Chem. 277 (2002) 46280–46288. [33] N. Vadaie, R.S. Hulinsky, D.L. Jarvis, Identification and characterization of a Drosophila melanogaster ortholog of human b1,4galactosyltransferase VII, Glycobiology 12 (2002) 589–597. [34] M.M. Whittaker, J.W. Whittaker, Expression of recombinant galactose oxidase by Pichia pastoris, Protein Expr. Purif. 20 (2000) 105–111.
[35] B. Xu, D. Sellos, J.C. Janson, Cloning and expression in Pichia pastoris of a blue mussel (Mytilus edulis) b-mannanase gene, Eur. J. Biochem. 269 (2002) 1753–1760. [36] T.R. Henion, B.A. Macher, F. Anaraki, U. Galili, Defining the minimal size of catalytically active primate ␣1,3 galactosyltransferase: structure-function studies on the recombinant truncated enzyme, Glycobiology 4 (1994) 193–202. [37] X.H. Xu, L. Vo, B.A. Macher, Structure-function analysis of human ␣1,3-fucosyltransferase-amino acids involved in acceptor substrate specificity, J. Biol. Chem. 271 (1996) 8818–8823. [38] M. Sarkar, S. Pagny, U. Ünligil, D. Joziasse, J. Mucha, J. Glössl, H. Schachter, Removal of 106 amino acids from the N-terminus of UDP-GlcNAc:␣-3-D-mannoside b-1,2-N-acetylglucosaminyltransferase I does not inactivate the enzyme, Glycoconj. J. 15 (1998) 193–197. [39] C. Augé, A. Malleron, H. Tahrat, A. Marc, J.L. Goergen, M. Cerutti, W.F.A. Steelant, P. Dellanoy, A. Lubineau, Outstanding stability of immobilised recombinant ␣(1-3/4)-fucosyltransferases exploited in the synthesis of Lewis a and Lewis x trisaccharides, Chem. Commun. (2000) 2017–2018. [40] J. Shang, R. Qiu, J. Wang, J. Liu, R. Zhou, H. Ding, S. Yang, S. Zhang, C. Jin, Molecular cloning and expression of Galb1,3GalNAc ␣2,3sialyltransferase from human fetal liver, Eur. J. Biochem. 265 (1999) 580–588. [41] M. Molhøj, P. Ulvskov, F. Dal Degan, Characterization of a functional soluble form of a Brassica napus membrane-anchored endo-1,4-bglucanase heterologously expressed in Pichia pastoris, Plant Physiol. 127 (2001) 674–684.