Expression of a TGF-β superfamily protein, macrophage inhibitory cytokine-1, in the yeast Pichia pastoris

Gene 254 (2000) 67–76 www.elsevier.com/locate/gene

Expression of a TGF-b superfamily protein, macrophage inhibitory cytokine-1, in the yeast Pichia pastoris W. Douglas Fairlie, Hong-Ping Zhang, Peter K. Brown, Patricia K. Russell, Asne R. Bauskin, Samuel N. Breit * Centre for Immunology, St. Vincent’s Hospital and the University of New South Wales, Sydney, Australia Received 17 December 1999; received in revised form 9 May 2000; accepted 22 June 2000 Received by B. Dujon

Abstract The methylotrophic yeast, Pichia pastoris, has been used to express both human and murine macrophage inhibitory cytokine-1 (MIC-1), a transforming growth factor beta (TGF-b) superfamily cytokine. This is the first report of the expression of a correctly folded TGF-b superfamily protein in a microbial organism. The protein is secreted in its correctly folded dimeric form at milligram per litre quantities, which are significantly higher than we have been able to achieve using mammalian expression systems. Purification schemes are described, and the purified protein is immunologically identical to protein produced in a mammalian expression system. Protein expression was influenced by a number of factors, most significantly by the concentration of methanol used during the induction phase. However, with very high levels of MIC-1 induction, substantial amounts of MIC-1 monomer were also secreted. © 2000 Elsevier Science B.V. All rights reserved. Keywords: Dimerisation; Histidine tag; Protein production; Secretion

1. Introduction Macrophage inhibitory cytokine-1 (MIC-1) is a divergent member of the transforming growth factor beta ( TGF-b) superfamily first described by this laboratory (Bootcov et al., 1997). The identical protein has subsequently been reported as placental transforming growth Abbreviations: AOX-1, gene encoding alcohol oxidase-1; CHO, Chinese hamster ovary; cpm, counts per minute; hCG, human chorionic gonadotrophin; HF, His-FLAG; HFP, His-FLAG-PKA; HIC, hydrophobic interaction chromatography; 6HIS, hexahistidine tag; HPLC, high performance liquid chromatography; kDA, kilodalton; KEX2, gene encoding kexin protein; MIC-1, macrophage inhibitory cytokine-1; Mut, methanol utilisation phenotype; OD , optical den600 sity at 600 nm; PCR, polymerase chain reaction; PDF, prostate-derived factor; PDGF, platelet-derived growth factor; PDI, protein disulphide isomerase; P. pastoris, Pichia pastoris; PKA, protein kinase A; PLAB, placental bone morphogenetic protein; PTGFB, placental transforming growth factor beta; RIA, radioimmuno assay; SDS-PAGE, sodium dodecyl polyacrylamide gel electrophoresis; STE13, gene encoding dipeptidyl aminopeptidase A; TFA, trifluoracetic acid; TGF-b, transforming growth factor beta; YPD, yeast extract, peptone, dextrose. * Corresponding author. Tel.: +61-2-9361-7700; fax: +61-2-9361-2391. E-mail address: [email protected] (S.N. Breit)

factor beta (PTGFB) (Lawton et al., 1997), prostatederived factor (PDF ) (Paralkar et al., 1998), growth/differentiation factor 15/MIC-1 (GDF 15/MIC-1) (Bo¨ttner et al., 1999a,b), and as a placental bone morphogenetic protein (PLAB) (Hromas et al., 1997). The transforming growth factor beta ( TGF-b) superfamily, which includes the TGF-bs themselves, bone-morphogenic proteins, Mu¨llerian inhibitory substance, growth/differentiation factors, and inhibins/ activins all share a number of common structural characteristics. They are all synthesised with a long propeptide separated from the mature protein by a conserved RXXR furin-like cleavage site. The processed, secreted mature proteins are homodimers (in the case of MIC-1 each subunit has 112 amino acids), and all contain a highly conserved seven-cysteine domain which encompasses most of the mature (bioactive) peptide. This forms a cysteine knot motif, a structural hallmark of this superfamily. The exact function of MIC-1 is still uncertain, though it has been shown to be produced in the epithelial cells of various tissues and most abundantly in the placenta (Lawton et al., 1997; Hromas et al., 1997; Fairlie et al., 1999; Bo¨ttner et al., 1999a). The in vitro expression of TGF-b superfamily proteins

0378-1119/00/$ - see front matter © 2000 Elsevier Science B.V. All rights reserved. PII: S0 3 7 8 -1 1 1 9 ( 0 0 ) 0 0 29 5 - X

68

W.D. Fairlie et al. / Gene 254 (2000) 67–76

has hitherto been limited by the requirement for the use of cell types which can fold then process the pre-pro form of the molecule. In the case of TGF-b1 and activin A, the propeptide regions have been shown to be necessary for the folding, assembly and secretion of TGF-b1 and activin A dimers (Gray and Mason, 1990). Supernatants from cells transfected with constructs in which the propeptide of either protein was deleted contained no detectable protein. In addition, analysis of the cell lysates from the mature activin A transfected cells indicated that the protein had aggregated in the endoplasmic reticulum. Recombinant TGF-b superfamily proteins, therefore, have generally been produced in mammalian cell systems, typically using Chinese hamster ovary (CHO) cells (e.g. Archer et al., 1993), although the baculovirus/insect cell expression system has also been used for production of some members from ‘fulllength’ constructs (Hu¨sken-Hindi et al., 1994). The TGF-b2 mature peptide has been expressed in the absence of the propeptide in E. coli, however, subsequent refolding was required (Han et al., 1997). MIC-1 seems to differ substantially in its synthesis and secretion compared with other superfamily members, as it is secreted from mammalian cells in the correctly folded, dimeric form without the necessity for the propeptide, and hence requirement for processing (Bauskin et al., 2000). This suggests the possibility that expression of MIC-1 may be possible in cell types and organisms in which other members of the TGF-b superfamily cannot be expressed and folded correctly. Previously, we have expressed MIC-1 in CHO cells (both with and without the propeptide) (Bootcov et al., 1997; Bauskin et al., 2000), however, the cost and effort of production have been high, and expression levels low in comparison with that possible in microbial systems. In order to overcome these limitations, we have expressed MIC-1 in the methylotrophic yeast, Pichia pastoris. This organism has gained popularity as an alternative eukaryotic expression system for the efficient, high level production of a wide variety of molecules including hormones and cytokines, receptors, enzymes and antibodies (reviewed by Romanos, 1995 and Hollenberg and Gellisen, 1997). This system has the advantages of very high inducible expression levels, being easy and cost-effective to grow, and readily scaled

up for fermentation culture. The expressed proteins can undergo post-translational modifications, are secreted into the medium if necessary, and there is no need for refolding. Foreign genes are expressed under the control of the tightly regulated methanol-induced alcohol oxidase 1 promoter. In this paper we describe the expression and characterisation of MIC-1 in P. pastoris. This is the first report of the expression of a correctly folded TGF-b superfamily cytokine in a microbial organism.

2. Materials and methods 2.1. Materials CHO cell-derived MIC-1 was produced in this laboratory as described previously (Bootcov et al., 1997). The pPIC9K vector and GS115 P. pastoris strain were purchased from Invitrogen. Media components including yeast extract, bactopeptone, yeast nitrogen base and casamino acids were from Difco. Restriction enzymes and T4 ligase were from Boehringer Mannheim. Vent DNA polymerase was from New England Biolabs. Polyclonal antiserum to P. pastoris-derived MIC-1 was raised in sheep. Anti-MIC-1 monoclonal antibodies were produced by immunisation of BALB/c mice with the same yeast-derived protein. The anti-FLAG M2 monoclonal antibody was purchased from Sigma. 2.2. Vector construction and transformation In order to express MIC-1 with a wild-type aminoterminus, a construct (‘wtMIC-1’ construct, see Fig. 1) was made by insertion of the DNA encoding the mature peptide of MIC-1 into the XhoI/NotI sites of the pPIC9K vector. To obtain this construct, the MIC-1 sequence was amplified from previously described constructs (Bootcov et al., 1997) by the polymerase chain reaction (PCR) using Vent DNA polymerase and the following oligonucleotide primers. Primer 1: 5∞-AGTCCTCGAGAAAAGAGAGGCTGAAGCTGCGCGCAACG-3∞ which regenerated part of the secretory signal sequence (bold) (see Fig. 1) and added a XhoI restriction site (underlined ) to the 5∞ end of the MIC-1 sequence. Primer 2: 5∞-ATATGCGGCCGCTCATATGCAGTGGCAGT-

Fig. 1. Sequence arrangement of MIC-1 constructs. The amino acid sequences (single letter code) of the various plasmid constructs are shown in the region of the signal peptide/MIC-1. The signal peptide is shown overscored, MIC-1 is in bold lettering, lowercase lettering indicates the amino acids added due to insertion at the EcoRI site of the pPIC9K plasmid, the hexahistidine tag is boxed, the FLAG epitope is italicised and the PKA site is underlined. Arrows indicate the cleavage sites for the KEX2 and STE13 gene products.

W.D. Fairlie et al. / Gene 254 (2000) 67–76

CTTTGGC-3∞ which added the NotI restriction site (underlined) to the 3∞ end of MIC-1. To facilitate purification and detection of MIC-1, a hexahistidine (6HIS ) tag followed by the synthetic FLAG epitope was added to the amino-terminus of the protein (‘HF–MIC-1’ construct, Fig. 1). This was achieved by extending the 5∞ end of the MIC-1 cDNA by a two-step PCR using three oligonucleotides primers: primer 2 from construct 1 described above; primer 3: 5∞-AAGGACGACGACGACAAGGCGCGCAAC-3∞ which created most of the FLAG epitope; and primer 4: 5∞-TATAGAATTCCACCACCACCACCACCACGACTACAAGGACG-3∞ which created the rest of the FLAG epitope plus the 6HIS tag and added an EcoRI restriction site (underlined) to the 5∞ end of the construct for cloning into the pPIC9K vector. The first round of PCR utilised primer 3 as the forward primer and primer 2 as the reverse primer. The second round of PCR used primer 4 as the forward primer and primer 2 again as the reverse primer. Another construct with a protein kinase A (PKA) phosphorylation site in addition to the 6HIS tag and FLAG epitope (‘HFP–MIC-1’ construct, Fig. 1) was also made to enable radioisotope labelling of the protein with 32P. It was constructed in a similar two-step fashion as the HF–MIC-1 construct, however, in the first round of PCR the oligonucleotide primer 5: 5∞-AAGGACGACGACGACAAGCTTCGCCGCGCCTCCGTGGCGCGCAACGGG-3∞, which added both the PKA site and part of the FLAG epitope to the 5∞ end of MIC-1, was used in place of primer 3. A murine MIC-1 construct (‘murMIC-1’ construct, Fig. 1) was also made with an amino-terminal FLAG epitope and cloned into the XhoI/NotI sites of the pPIC9K vector. To obtain this construct murine MIC-1 sequence was amplified using a two-step PCR. The first step involved the forward primer 6: 5∞-GACTACAAGGACGACGACGACAAGAGCGCGCATGCGCACC-3∞ which added the FLAG epitope to the 5∞ end of murine MIC-1; and primer 7: 5∞-TATATGCGGCCGCTCAAGCGCAGTGGCAGCCCCGGGCCAC-3∞ which added the NotI restriction site (underlined) to the 3∞ end. The second round of PCR involved primer 7 and primer 8: AGTCCTCGAGAAAAGAGAGGCTGAAGCTAGCGCGCATGCG which regenerated part of the secretion signal sequence (bold) and added an XhoI restriction site (underlined) to the 5∞ end of the murine MIC-1 sequence. 2.3. Transformation and selection of MIC-1 secreting P. pastoris clones Prior to transformation of the P. pastoris GS115 (his4) host strain, the various constructs in the pPIC9K vector were linearised with SacI to direct integration of the expression vector into the AOX1 locus, resulting in a methanol-utilisation positive (Mut+) phenotype. The

69

P. pastoris host strain was then transformed by electroporation essentially according to the Invitrogen guidelines. Transformants (His+/Mut+) were selected for multiple integrated copies of the vector as described previously ( Fairlie et al., 1999) by transferring, 24 h after transformation, His+ colonies grown on nylon membranes onto YPD (1% yeast extract, 2% bactopeptone, 2% dextrose) agar plates containing G418 at concentrations of 1–4 mg/ml. Colonies found to grow on these plates were picked for expression in shake flasks. 2.4. Shake flask expression of MIC-1 Expression of MIC-1 in shake flasks was undertaken essentially as per the instructions provided by Invitrogen. Overnight cultures were grown in 5 ml YPD medium from either glycerol stocks or colonies picked from plates. This culture was then used to inoculate 500 ml of BMGY [1% (w/v) yeast extract, 2% (w/v) peptone, 1.34% (w/v) yeast nitrogen base, 0.00004% (w/v) biotin, 100 mM potassium phosphate pH 6.0, 1% (v/v) glycerol ] which was grown for a further 24 h at 30°C with vigorous shaking in baffled flasks to an approximate OD =20. The cells were then pelleted by centrifu600 gation and resuspended in a total of 3 l of BMMY [exactly the same as BMGY except the glycerol was replaced with methanol at concentrations ranging from 0.5 to 3.0% (v/v) and 1.5% casamino acids (w/v) was also added ] and grown for a further 72 h. Additional methanol [0.5–3.0% (v/v)] was added daily. Supernatants containing the secreted MIC-1 were collected following removal of the cells by centrifugation. 2.5. Purification and enterokinase cleavage of MIC-1 The purification of histidine-tagged MIC-1 (i.e. the proteins derived from the HF–MIC-1 and HFP–MIC-1 constructs) from P. pastoris supernatants was achieved using a three-step process: hydrophobic interaction chromatography (HIC ), metal affinity chromatography, then reversed-phase HPLC. Initially NaCl was added to the supernatants to a final concentration of 1.5 M. Phenylsepharose ( lo sub) (Pharmacia) was then added and incubated in a batch mode for 2 h at room temperature on a rolling rocker. The phenyl-sepharose was then packed into a column and the proteins eluted with 10 mM Tris–Cl, pH 8.0. Ni–NTA agarose (Qiagen) and imidazole to a final concentration of 10 mM were then added to the eluate and incubated overnight in batch mode. The resin was then packed into a column and washed with five bed volumes of 20 mM Tris–Cl, 50 mM imidazole, 300 mM NaCl, pH 8.0. MIC-1 was eluted with two bed volumes of 20 mM Tris–Cl, 250 mM imidazole, pH 8.0, 0.1% (w/v) CHAPS. The protein was then loaded directly onto an Aquapore RP-300 C8

70

W.D. Fairlie et al. / Gene 254 (2000) 67–76

(220×4.6 mm2, 7 mm particle size) reversed-phase HPLC column (Brownlee Labs) equilibrated with 0.1% (v/v) trifluoroacetic acid ( TFA) at a flow rate of 1 ml/min and eluted with a 60 min linear gradient of 0– 65% acetonitrile in 0.09% (v/v) TFA. Fractions corresponding to MIC-1, as determined by UV absorbance at 280 nm, were collected manually and stored at 4°C, or lyophilised. To remove the FLAG epitope and 6HIS tag, the fraction containing MIC-1 eluted from the Ni– NTA agarose column was dialysed against 20 mM Tris pH 7.4, 50 mM NaCl, 2 mM CaCl , 0.2% CHAPS. 2 Enterokinase (Novagen) (10 U ) was then added and the sample incubated overnight at room temperature with mixing. The cleaved protein was purified by reversed-phase HPLC as described above. For proteins without a histidine tag (i.e. the proteins derived from the wtMIC-1 and murMIC-1 constructs) an identical purification scheme was used except that the metal affinity chromatography step was replaced by cation exchange chromatography. In this procedure, the HIC eluate was adjusted to pH 5.0 by the addition of acetic acid to a final concentration of 0.1% (v/v), then pumped overnight across a column (HR 5/10, Pharmacia) packed with SP Sepharose Fast-flow (Pharmacia). The column was then washed with 10 volumes of 50 mM sodium acetate, 50 mM NaCl, pH 5.0 and the protein eluted with 10 ml of 50 mM sodium acetate, 400 mM NaCl, pH 6.4. This eluate was then chromatographed by reversed-phase HPLC as for the histidine-tagged proteins. 2.6. Gel electrophoresis and Western blotting Purified proteins and culture supernatants were electrophoresed on 15% sodium dodecyl sulphate-polyacrylamide gels (SDS-PAGE), under non-reducing conditions or reduced with 2-mercaptoethanol. Proteins were either stained directly with Coomassie Brilliant Blue or blotted onto nitrocellulose membranes for Western blot analysis. Western blots were probed using either the commercially available anti-FLAG M2 monoclonal antibodies (Sigma), sheep anti-MIC-1 polyclonal antibodies, or mouse anti-MIC-1 monoclonal antibody-secreting hybrioma supernatants. Blots were developed using either biotinylated anti-mouse IgG, or anti-sheep IgG antibodies (Amersham), strepavidin-biotinylated horseradish peroxidase complex (Amersham) and chemiluminescence reagents (DuPont/NEN ). 2.7. N-terminal sequencing MIC-1 was absorbed onto a PVDF membrane using a ProSorb Sample Preparation Cartridge (Perkin-Elmer Applied Biosystems) then sequenced by Edman degradation on a Procise 494 Protein Sequencer (Applied

Biosystems) using standard PVDF blot cycles at the Australian Proteome Analysis Facility. 2.8. Reduction and alkylation of MIC-1 MIC-1 (20 mg) was reduced by incubation for 20 min at 50°C in 100 mM ammonium bicarbonate containing 8 M urea and 100 mM dithiothreitol then carboxymethylated by the addition of 200 mM iodoacetic acid. The protein was isolated by precipitation in 4% (v/v) trichloroacetic acid and resuspended in 4 mM HCl. 2.9. Mass spectrometry A 1 ml sample of reduced and alkylated MIC-1 was analysed in linear mode on a MALDI mass spectrometer (PerSeptive Biosystems DE-STR) using the sinapinic acid matrix [10 mg/ml in 0.1% (v/v) TFA/50% (v/v) acetonitrile] at the Australian Proteome Analysis Facility. 2.10. Radioimmuno assay Purified MIC-1 derived from the HFP–MIC-1 construct was radiophosphorylated to a specific activity of 4000 Ci/mmol using 32P-cATP and protein kinase A (Sigma) as described previously ( Kemp and Pearson, 1991). This radiolabelled MIC-1 (approximately 30,000 cpm) plus unlabelled yeast-derived or CHOderived MIC-1 and polyclonal antiserum (diluted 1:250,000) were incubated in a total volume of 300 ml phosphate-buffered saline containing 0.1% (w/v) bovine serum albumin for 2 h at room temperature with constant mixing. The immune complexes were isolated by the addition of Protein G-Sepharose Fast-flow (Pharmacia). Following incubation for a further 90 min at room temperature, the beads were pelleted by centrifugation and bound counts determined by counting in a b-counter. MIC-1 protein concentrations were determined by amino acid analysis.

3. Results 3.1. Optimisation of expression of MIC-1 by P. pastoris The expression of four different MIC-1 constructs was assessed in P. pastoris. These included a wild-type mature human MIC-1 construct, a hMIC-1 construct with an N-terminal hexahistidine (6HIS ) tag and FLAG epitope, a construct with a protein kinase A (PKA) site in addition to both the 6HIS tag and FLAG epitope, and a murine MIC-1 construct with a FLAG epitope. The essential elements of the various constructs are shown in Fig. 1. For each construct, colonies found to grow on plates containing G418 were screened for

W.D. Fairlie et al. / Gene 254 (2000) 67–76

71

expression levels, and the highest expressing clone used in all subsequent experiments. The expression levels of MIC-1 secreted by P. pastoris were influenced by a number of factors. No protein was detected when minimal medium (i.e. BMMY without yeast extract, peptone or casamino acids) was used (data not shown). Adding casamino acids to the already complex BMMY medium used also increased the levels of MIC-1 observed in the supernatant. Furthermore, the levels of MIC-1 detected in the supernatant were influenced by the methanol concentration used to induce expression (discussed in Section 3.4). An estimated 3–8 mg of MIC-1 per litre of supernatant was obtained following optimisation experiments, with the murine construct consistently giving the highest expression levels. Western blot analysis of the supernatants from each of the four constructs is shown in Fig. 2. A major band of 25–31 kDa was observed in each case which corresponds to the various untagged and tagged forms of MIC-1. The construct-to-construct variation in sizes is related to the presence (or absence) of the different tags used. An additional major band of 14– 16 kDa, most probably corresponding to MIC-1 monomer, is also apparent in the supernatants from the HF– MIC-1 and murMIC-1 constructs (Fig. 2, lanes 2 and 4).

step. Metal affinity chromatography on Ni–NTA agarose was used as the second step for the 6HIS tagged proteins, and cation exchange chromatography for untagged proteins. Very low levels of MIC-1 (<10% of the total ) were found to bind to the Ni–NTA agarose when it was added directly to the culture supernatant. The protein was significantly concentrated (about 100-fold ) in the metal affinity step and about 30-fold in the cation exchange step. Any existing contaminants following step 2 were essentially completely removed by reversed-phase HPLC. The final products are shown in Fig. 3. Bands of approximately 15 kDa, and corresponding to small amounts of monomeric MIC-1, are still apparent in both preparations when electrophoresed under non-reducing conditions ( Fig. 3, lanes 1 and 2). The reduced proteins migrate with an apparent molecular mass consistent with that of the monomeric MIC-1. A final yield of 25–30% representing approximately 1– 2 mg of pure MIC-1 per litre of supernatant was obtained using this strategy for the wtMIC-1, HF– MIC-1 and murMIC-1 constructs. A yield of approximately 300 mg per litre was achieved for the HFP– MIC-1 construct.

3.2. Purification of MIC-1

Amino-terminal sequencing and mass spectrometry were further used to confirm the identity and characterise the purified products described above. The results for the amino-terminal sequencing of all the human constructs are summarised in Table 1. For the wtMIC-1 construct, two major sequences were determined. The sequence ARNGD corresponds to the true amino-terminus of the mature MIC-1 peptide, as would be expected for this construct which was cloned into the XhoI site

Alternative purification schemes were devised for the untagged and 6HIS-tagged MIC-1 from the P. pastoris supernatants. Both schemes involved an initial hydrophobic interaction chromatography (HIC ) step which was included both as an enrichment procedure and as a means of buffer exchanging for the following purification

Fig. 2. Western blot analysis of MIC-1 P. pastoris supernatants. Supernatants (10 ml ) obtained following methanol induction [0.5% (v/v) during the first 24 h, and with 3.0% methanol added daily during the final 48 h] for 72 h were electrophoresed under non-reducing conditions then immunoblotted using an anti-MIC-1 polyclonal antiserum. Lane 1, wtMIC-1; lane 2, HF–MIC-1; lane 3, HFP–MIC-1; lane 4, murMIC-1.

3.3. N-terminal sequencing and mass spectrometry

Fig. 3. Purification of untagged and 6HIS-tagged MIC-1. Proteins obtained following purification of untagged MIC-1 derived from the wtMIC-1 construct ( lanes 1 and 3), and 6HIS-tagged MIC-1 derived from the HF–MIC-1 construct ( lanes 2 and 4) were electrophoresed under non-reducing ( lanes 1 and 2) or reducing ( lanes 3 and 4) conditions and stained with Coomassie Brilliant Blue.

72

W.D. Fairlie et al. / Gene 254 (2000) 67–76

Table 1 Amino-terminal sequencing results obtained for the various human MIC-1 constructs expressed in P. pastoris. The values beside each sequence indicates the yield of the amino acid on the first sequencing cycle Construct

N-terminal sequence (yield)

wtMIC-1

EAARN (70 pmol ), ARNGD (64 pmol )

HF–MIC-1 Enterokinase-digested HF–MIC-1

YVEFH (200 pmol ), EAEAY (34 pmol ) ARNGD (89 pmol ), NG (4 pmol )

HFP–MIC-1 Enterokinase-digested HFP–MIC-1

YVEFHH (375 pmol ), ASVARN (135 pmol ), EAEAYV (66 pmol ) LRRASV (128 pmol ), ASVARN (64 pmol ), NGDHAP (63 pmol )

of the vector (Fig. 1). The second sequence EAARN includes two addition amino acids on the amino-terminus indicating incomplete processing of the signal peptide by the STE13 gene product. The major sequence YVEFH determined for both HF–MIC-1 and HFP–MIC-1 constructs corresponds to the amino acids added to the amino-terminus of the construct as a result of insertion of the construct into the EcoRI site of the vector, plus the first amino acid residue of the 6HIS tag (Fig. 1). Therefore, this is the correctly processed product. Both constructs also had a minor sequence ( EAEAY ) which corresponds to partially processed protein, again indicating incomplete cleavage by the STE13 gene product. A third sequence (ASVARN ) was also present in HFP–MIC-1 protein, which is indicative of a proteolytic cleavage within the PKA site (Fig. 1). The results of SDS-PAGE are consistent with these sequencing results, in that two bands are clearly visible for the HF–MIC-1 protein (Fig. 3, lanes 2 and 4) and three bands are apparent for the HFP– MIC-1 protein (Fig. 1, lane 3). The results for the enterokinase-digested constructs indicated that the majority of the protein has been correctly digested. In the case of the HF–MIC-1 construct, the major sequence corresponded to the first five amino acids of the mature MIC-1 peptide, as would be expected following cleavage of this construct. With the HFP–MIC-1 construct the major sequence corresponded to the first five amino acids of the PKA site, which was also as expected for this construct. A minor component (5% for construct 1 and 25% for construct 2) was also observed, which indicates additional cleavage occurred following the first two amino acids of MIC-1. Construct 2 also had an additional minor sequence corresponding to the previously identified cleavage within the PKA site of the undigested protein. Mass spectrometry was also performed on the purified and reduced and alkylated form of the enterokinasedigested protein expressed from the HF–MIC-1 construct to determine whether there were any internal cleavages and that the full-length protein is produced. An average mass of 12,812 (calculated mass 12,810) was consistent with the protein being fully synthesised and with no internal cleavages.

3.4. Effect of methanol concentration on MIC-1 expression The effect of the concentration of methanol used to induce expression of MIC-1 was examined to determine whether expression levels could be improved by increasing methanol concentrations above the 0.5% (v/v) recommended in the manufacturer’s guidelines. Western blot analysis was performed on the supernatants from cultures induced with methanol at concentrations ranging from 0.5 to 3.0% (v/v) from 24 to 72 h after induction ( Fig. 4). All flasks were induced with 0.5% methanol during the first 24 h. The results demonstrated a significant increase in the total amount of MIC-1-related protein with increasing methanol concentrations. However, the majority of the additional protein produced appears to be MIC-1 monomer, as determined by the increase in the band corresponding to a protein migrating with an apparent molecular weight of 15 kDa. No monomeric MIC-1 was observed in the culture induced with 0.5% (v/v) methanol (Fig. 4, lane 1), but high levels were observed in the flasks in which 1.0– 3.0% (v/v) ( Fig. 4, lanes 2–4) methanol was added daily.

Fig. 4. Effect of methanol concentration on MIC-1 expression. Supernatants (25 ml ) were collected following induction of the murMIC-1 construct for 72 h and immunoblotted with anti-FLAG M2 antiserum. The methanol concentration in all flasks was 0.5% (v/v) during the first 24 h, then varying concentrations [ lane 1, 0.5% (v/v); lane 2, 1.0% (v/v); lane 3, 2.0% (v/v); lane 4, 3.0% (v/v)] were added daily during the final 48 h.

W.D. Fairlie et al. / Gene 254 (2000) 67–76

73

Very little difference was observed in the amount of dimeric MIC-1 secreted over the concentration range. 3.5. Immunoreactivity of yeast and CHO-derived MIC-1 The MIC-1 derived from P. pastoris was used to raise anti-MIC-1 polyclonal antiserum in sheep. This was then used in a competitive RIA to compare binding of both the yeast and mammalian derived proteins. The purified protein produced from the HFP–MIC-1 construct, which has a PKA site at its amino-terminus, was successfully radiophosphorylated with 32P and used as the tracer in the assay. Purified protein from the wtMIC-1 construct produced in yeast, and purified MIC-1 derived from a full-length MIC-1 construct (i.e. a construct with both propeptide and mature regions) expressed in CHO cells, were used as competitors. The results indicated that both proteins behaved identically in the assay as judged by the binding curves obtained (Fig. 5a). This suggests that the yeast MIC-1 is immunogenically identical to mammalian-derived MIC-1. In order to further demonstrate this point, the cross-reactivity of the yeast and CHO cell MIC-1 was examined by Western blot analysis using a panel of four monoclonal antibodies raised to the yeast protein ( Fig. 5b). Each monoclonal antibody, which recognises separate and distinct, conformation-dependent epitopes, reacted equally with both the yeast and CHO cell proteins ( Fig. 5b, lanes 1 and 2). However, no binding was observed for MIC-1 which was reduced/denatured (Fig. 5b, lane 3). These combined results strongly support the view that the yeast protein is correctly folded.

4. Discussion In this paper we have reported for the first time the expression of a TGF-b superfamily protein in the methylotrophic yeast, P. pastoris. MIC-1 is probably the ideal family member for expression in this system as it is the only one described to date which does not require its propeptide for correct folding and secretion. This precludes the requirement for complex intracellular processing to remove the propeptide. P. pastoris does actually possess a furin-like protease, kexin, encoded by the KEX2 gene (Nakayama, 1997), however, the yeast recognition sequence (R/K–R) is different from that of the mammalian protease recognition sequence (RXXR) involved in the processing of the TGF-b superfamily proteins. In addition, the various TGF-b superfamily protein propeptides (including MIC-1) are glycosylated and these carbohydrates play a role in the folding and secretion of TGF-b1 and 2 (Brunner et al., 1992). The mature peptides of the TGF-b superfamily proteins, however, do not have any N-linked glycosylation sites. Therefore the expression of just the mature peptide

Fig. 5. Comparison of immunoreactivity of yeast and CHO-derived MIC-1. (a) MIC-1 derived from yeast ($) or CHO cells (#) was assayed by RIA using polyclonal anti-(yeast) MIC-1 antiserum and 32P-MIC-1 as a tracer. Results were combined from three separate assays with duplicate data points. Error bars indicate standard deviations at each point. (b) Purified MIC-1 derived from yeast ( lane 1, non-reduced and lane 3, reduced) or CHO cells ( lane 2, non-reduced) was electrophoresed then immunoblotted with one of four anti-MIC-1 monoclonal antibodies (I, MAb 10; II, MAb 26; III, MAb 13; IV, MAb 14).

region excludes any potential problems which may occur due to the differences in carbohydrate structure previously noted in proteins expressed in P. pastoris compared with mammalian glycoproteins (Cregg et al., 1993). Several lines of evidence indicate that the MIC-1 produced in P. pastoris is correctly folded. Firstly, it is expressed predominantly as a dimer with monomer only being present under certain conditions (e.g. when high methanol concentrations were used for induction). It is highly unlikely that a dimer would be the predominant form between misfolded subunits, therefore this is an excellent assay for the folding of these proteins. Secondly, the protein is being secreted at relatively high levels. Misfolded proteins are generally not secreted due to intracellular degradation pathways which rapidly eliminate any misfolded products ( Kopito, 1999). In regard to this point, we have attempted to express

74

W.D. Fairlie et al. / Gene 254 (2000) 67–76

hTGF-b1 in P. pastoris from a construct in which the propeptide region was deleted (i.e. a construct which would not be expected to result in an expressed protein), and were unable to detect any secreted TGF-b1 (data not shown). Finally, the protein is immunogenically identical to MIC-1 derived from a mammalian expression system, suggesting that the surface structures are identical. As protein derived from mammalian cells can be considered a ‘gold standard’ for protein folding, this result provides strong evidence that the yeast derived MIC-1 is correctly folded. In addition, the above antibodies have been successfully used for the detection of MIC-1 in human serum and cell lines which endogenously produce MIC-1 as well as MIC-1 in human tissue sections (data not shown). The Saccharomyces cerevisiae a-factor signal sequence appeared to be effective in directing secretion of MIC-1, however, it may also be of value to evaluate the natural MIC-1 leader sequence when scaling-up production of the protein. The P. pastoris expressed MIC-1, however, appears to be somewhat heterogeneous at its amino-terminus as a result of partial processing of the signal peptide by the STE13 gene product, and the protein most probably exists as both hetero- and homodimers of partially and completely processed forms. Similar incomplete processing has been described previously (e.g. Vozza et al., 1996; Samaddar et al., 1997). Vozza et al. (1996) have reported that this heterogeneity can be eliminated by simply omitting the Glu–Ala repeat following the KEX2 cleavage. The protein derived from the HFP–MIC-1 construct had an extra degree of heterogeneity as a result of a partial cleavage within the PKA site which was engineered onto the amino-terminus of the protein. This cleavage occurred after the dibasic Arg–Arg sequence within the PKA site, which is very similar to the dibasic Lys–Arg sequence which constitutes part of the KEX2 cleavage site, and is a known recognition sequence for kexin. Cleavage at this point within this particular MIC-1 construct results in the removal of the 6HIS tag from the amino-terminus, therefore any of the protein in which both subunits have been proteolysed within the PKA site will not be purified using the present scheme. This may account for the lower yields of the HFP– MIC-1 protein despite similar initial expression levels. The expression levels obtained for MIC-1, although low by comparison with some proteins produced in P. pastoris, were significantly greater than that achieved in CHO cells (up to 10-fold higher). MIC-1 has a highly complex structure involving a cystine knot motif, the formation of which possibly affects the rate of synthesis. Another cystine knot, (hetero)dimeric protein, folliclestimulating hormone has also been expressed in P. pastoris using shake flasks ( Fidler et al., 1998) at levels somewhat lower than that obtained for MIC-1. It is anticipated that significantly higher levels of production

could be achieved in fermenters where much higher cell densities can be obtained. It is noteworthy that the murine MIC-1 protein consistently gave higher levels of expression than the human MIC-1 proteins. One possibility is that the murine MIC-1 strain contained a greater number of copies of the expression vector. Alternatively, this may be the result of a more favourable codon usage in the murine protein. The murine MIC-1 cDNA contains a total of 20/112 rarely used codons (i.e. codons which occur with a frequency of less than eight per 1000) compared with 36/112 in human MIC-1 (Fig. 6). Perhaps more significant is a cluster of six consecutive rare codons near the 5∞ end of the human MIC-1 sequence corresponding to the mature peptide, and nine out of the first 13 codons of human mature MIC-1 are unfavourable for translation in P. pastoris. Resynthesis of at least part of the human MIC-1 mature peptide sequence with P. pastoris-preferred codons may lead to a further increase in expression levels. An interesting observation was made regarding the effects of methanol concentration used for induction of expression. Higher concentrations [up to 3% (v/v)] gave rise to significantly higher levels of MIC-1-related protein being secreted, however, the majority of the additional protein secreted was monomeric MIC-1. This result has a number of important implications. Firstly, it suggests that increased methanol concentrations may be able to drive higher levels of expression in shake flasks. This may simply be a consequence of the fact that methanol can readily evaporate in shake flasks and, therefore, in flasks with higher initial concentrations of

Fig. 6. Comparison of codon usage in human and murine MIC-1. An alignment of the sequences of the mature peptide regions of human and murine MIC-1 proteins. Codons which are rarely used (frequency of less than eight per 1000) by P. pastoris are shown boxed.

W.D. Fairlie et al. / Gene 254 (2000) 67–76

methanol, induction occurs over a longer duration between feeding times (i.e. every 24 h). Studies utilising a probe for the on-line monitoring and control of methanol concentrations (Guarna et al., 1997) have shown that when 0.5% (v/v) methanol was added daily to shake flasks in the production phase, it was rapidly consumed following each addition and was consistently exhausted before 24 h. Furthermore, production was significantly increased by maintaining the methanol concentration at a constant concentration. The generation of a Muts strain, which metabolises methanol more slowly, may be useful for the further investigation of this phenomenon. Another implication of this result is that the dimerisation of MIC-1 may involve an additional factor which was exhausted when production levels were increased. This limiting factor is possibly a protein not found in high levels in yeast. To the best of our knowledge, this is the first indication that a co-factor may be involved in the folding/assembly of a TGF-b superfamily protein. One possibility is protein disulphide isomerase (PDI ), which has been shown to catalyse the in vitro assembly of the a and b subunits of hCG (Huth et al., 1993). Furthermore, co-transformation of Sacchromyces cerevisiae with platelet-derived growth factor (PDGF ), another cystine knot protein and PDI resulted in significantly higher levels of PDGF secretion (Robinson et al., 1994). Alternatively, some other protein, perhaps the recently identified Ero1 which is essential for disulphide bond formation in the endoplasmic reticulum (Debarbieux and Beckwith, 1999), may be important for MIC-1 dimerisation. It is noteworthy that very high level expression (>200 mg/l in a fermenter) in P. pastoris of at least one other multimeric protein, the trimeric CD40 ligand, has been reported in which no monomer was detected (McGrew et al., 1997). An additional possibility that should be considered is that the monomeric form observed is misfolded and secreted only because of overwhelming of the intracellular quality control mechanisms for eliminating misfolded proteins. Given the large number of cysteine residues in MIC-1, it is more likely that a relatively higher proportion of high molecular weight aggregates would be observed, therefore this scenario is considered less likely. However, it should be noted that Brierley (1998) has also described the secretion of misfolded forms of insulin-like growth factor-1 in addition to the correctly folded form. The expression levels of MIC-1 obtained from P. pastoris and the amounts recovered using the purification schemes described above have enabled useful amounts of MIC-1 to be produced for such purposes as structure/function studies and antibody production. This would otherwise have been significantly more difficult and expensive using other eukaryotic expression systems. It has also provided us with the basis for scale-up to fermenter-scale expression of MIC-1 which, it is antici-

75

pated, will enable production of the protein at levels which makes commercial production a feasible proposition.

Acknowledgements This work has been funded in part by grants from St. Vincent’s Hospital and by Meriton Apartments Pty Ltd. through an R&D syndicate arranged by Macquarie Bank Limited. In addition, this project was partially funded by a New South Wales Health Research and Development infrastructure grant. This research has been facilitated by access to the Australian Proteome Analysis Facility established under the Australian Government Major National Research Facilities Program.

References Archer, S.J., Bax, A., Roberts, A.B., Sporn, M.B., Ogawa, Y., Piez, K.A., Weatherbee, J.A., Tsang, M.L.-S., Lucas, R., Zheng, B.-L., Wenker, J., Torchia, D.A., 1993. Transforming growth factor b1: NMR signal assignments of the recombinant protein expressed and isotopically enriched using Chinese hamster ovary cells. Biochemistry 32, 1152–1163. Bauskin, A.R., Zhang, H.-P., Fairlie, W.D., He, X., Russell, P.K., Moore, A.G., Brown, D.A., Stanley, K.K., Breit, S.N., 2000. The propeptide of macrophage inhibitory cytokine-1 (MIC-1), a TGF-b superfamily member, acts as a quality control determinant for correctly folded MIC-1. EMBO J. 19, 2212–2220. Bootcov, M.R., Bauskin, A.R., Valenzuela, S.M., Moore, A.G., Bansal, M., He, X.Y., Zhang, H.-P., Donnellan, M., Mahler, S., Pryor, K., Walsh, B.J., Nicholson, R.C., Fairlie, W.D., Por, S.B., Robbins, J.M., Breit, S.N., 1997. MIC-1, a novel macrophage inhibitory cytokine, is a divergent member of the TGF-b superfamily. Proc. Natl. Acad. Sci. USA 94, 11,514–11,519. Bo¨ttner, M., Suter-Crazzolara, C., Schober, A., Unsicker, K., 1999a. Expression of a novel member of the TGF-b superfamily, growth/ differentiation factor-15/macrophage inhibitory cytokine-1 (GDF-15/MIC-1) in adult rat tissues. Cell Tissue Res. 297, 103–110. Bo¨ttner, M., Laaff, M., Schechinger, B., Rappold, G., Unsicker, K., Suter-Crazzolara, C., 1999b. Characterization of the rat, mouse and human genes of growth/differentiation factor-15/macrophage inhibitory cytokine-1 (GDF-15/MIC-1). Gene 237, 105–111. Brierley, R.A., 1998. Secretion of recombinant human insulin-like growth factor 1 (IGF-1). In: Higgins, D.R., Cregg, J.M. ( Eds.), Methods in Molecular Biology: Pichia Protocols. Humana Press, Totowa, NJ, pp. 149–177. Brunner, A.M., Lioubin, M.N., Marquardt, H., Malacko, A.R., Wang, W.-C., Shapiro, R.A., Neubauer, M., Cook, J., Madisen, L., Purchio, A.F., 1992. Site-directed mutagenesis of glycosylation sites in the transforming growth factor-b1 ( TGFb1) and TGFb2 (414) precursors and of cysteine residues within mature TGFb1: effects on secretion and bioactivity. Mol. Endocrinol. 6, 1691–1700. Cregg, J.M., Vedvick, T.S., Rashke, W.C., 1993. Recent advances in the expression of foreign genes in Pichia pastoris. Bio/Technology 11, 905–910. Debarbieux, L., Beckwith, J., 1999. Electron avenue: pathways of disulphide bond formation and isomerization. Cell 99, 117–119.

76

W.D. Fairlie et al. / Gene 254 (2000) 67–76

Fairlie, W.D., Russell, P.K., Zhang, H.-P., Breit, S.N., 1999. Screening procedure for Pichia pastoris clones containing multiple copy gene inserts. Biotechniques 26, 1042–1043. Fidler, A.E., Lun, S., Young, W., McNatty, K.P., 1998. Expression and secretion of a biologically active glycoprotein hormone, ovine follicle stimulating hormone by Pichia pastoris. J. Mol. Endocrinol. 21, 327–336. Gray, A.M., Mason, A.J., 1990. Requirement for activin A and transforming growth factor-b1 pro-region for homodimer assembly. Science 247, 1328–1330. Guarna, M.M., Lesnicki, G.J., Tam, B.M., Robinson, J., Radziminski, C.Z., Hasenwinkle, D., Boraston, A., Jervis, E., MacGillivray, R.T.A., Turner, R.F.B., Kilburn, D.G., 1997. On-line monitoring and control of methanol concentration in shake-flask cultures of Pichia pastoris. Biotechnol. Bioeng. 56, 279–286. Han, B., Hall, F.L., Nimmi, M.E., 1997. Refolding of a recombinant collagen-targeted TGF-b2 fusion protein expressed in Escherichia coli. Protein Express. Purif. 11, 169–178. Hollenberg, C.P., Gellisen, G., 1997. Production of recombinant proteins by methylotrophic yeasts. Curr. Opin. Biotech. 8, 554–560. Hromas, R., Hufford, M., Sutton, J., Xu, D., Li, Y., Lu, L., 1997. PLAB, a novel placental bone morphogenetic protein. Biochim. Biophys. Acta 1354, 40–44. Hu¨sken-Hindi, P., Tsuchida, K., Park, M., Corrigan, A.Z., Vaughan, J.M., Vale, W.W., Fischer, W.H., 1994. Monomeric activin A retains high receptor binding affinity but exhibits low biological activity. J. Biol. Chem. 269, 19,380–19,384. Huth, J.R., Perini, F., Lockridge, O., Bedows, E., Ruddon, R.W., 1993. Protein folding and assembly in vitro parallel intracellular folding and assembly. J. Biol. Chem. 268, 16,472–16,482. Kemp, B.E., Pearson, R.B., 1991. Design and use of peptide substrates for protein kinases. Methods Enzymol. 200, 121–134.

Kopito, R.R., 1999. ER quality control: the cytoplasmic connection. Cell 88, 427–430. Lawton, L.N., Bonaldo, M. de F., Jelenc, P.C., Qui, L., Baumes, S.A., Marcelino, R.A., de Jesus, G.M., Wellington, S., Knowles, J.A., Warburton, D., Brown, S., Bento Soares, M., 1997. Identification .of a novel member of the TGF-beta superfamily highly expressed in human placenta. Gene 203, 17–26. McGrew, J.T., Leiske, D., Dell, B., Klinke, R., Krasts, D., Wee, S., Abbott, N., Armitage, R., Harrington, K., 1997. Expression of trimeric CD40 ligand in Pichia pastoris: use of a rapid method to detect high-level expressing transformants. Gene 187, 193–200. Nakayama, K., 1997. Furin: a mammalian subtilisin/Kex2p-like endoprotease involved in processing a wide variety of precursor proteins. Biochem. J. 327, 625–635. Paralkar, V.M., Vail, A.L., Grasser, W.A., Brown, T.A., Xu, H., Vukicevic, S., Ke, H.Z., Qi, H., Owen, T.A., Thompson, D.D., 1998. Cloning and characterization of a novel member of the transforming growth factor-b/bone morphogenetic protein family. J. Biol. Chem. 273, 13,760–13,767. Robinson, A.S., Hines, V., Wittrup, K.D., 1994. Protein disulphide isomerase overexpression increases secretion of foreign proteins in Saccharomyces cerevisiae. Bio/Technology 12, 381–384. Romanos, M., 1995. Advances in the use of Pichia pastoris for highlevel gene expression. Curr. Opin. Biotech. 6, 527–533. Samaddar, M., Catteral, J.F., Dighe, R.R., 1997. Expression of biologically active b subunit of bovine follicle-stimulating hormone in the methylotrophic yeast Pichia pastoris. Protein Express. Purif. 10, 345–355. Vozza, L.A., Wittwer, L., Higgins, D.R., Purcell, T.J., Bergeid, M., Collins-Racie, L.A., LaVallie, E.R., Hoeffler, J.P., 1996. Production of a recombinant bovine enterokinase catalytic subunit in the methylotrophic yeast Pichia pastoris. Bio/Technology 14, 77–81.