- Email: [email protected]
Cloning and expression of Thermobifida xylanase gene in the methylotrophic yeast Pichia pastoris
Enzyme and Microbial Technology 37 (2005) 541–546
Cloning and expression of Thermobifida xylanase gene in the methylotrophic yeast Pichia pastoris Yi-Fang Cheng, Chao-Hsun Yang, Wen-Hsiung Liu ∗ Institute of Microbiology and Biochemistry, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei, Taiwan Received 16 November 2004; received in revised form 31 March 2005; accepted 7 April 2005
Abstract A gene (xyl11) encoding xylanase from Thermobifida fusca NTU22 was cloned, sequenced and expressed in Escherichia coli. The gene consists of 1014 base pairs and encodes a protein of 338 amino acids. The gene was then cloned into and secretively expressed in Pichia pastoris under the control of the AOX1 promoter. The xylanase productivity of the P. pastoris transformant (pPIC␣XYL) was about 67-fold higher than that of T. fusca NTU22 cultured in a 5-liter fermentor. The purified xylanase showed a single band at about 36 kDa by SDS-polyacrylamide gel electrophoresis after being treated with endo--N-acetylglycosaminidase H. The optimal pH and temperature of the purified xylanase were 7.0 and 70 ◦ C, respectively. About 70% of original activity remained after heat treatment at 70 ◦ C for 3 h. © 2005 Elsevier Inc. All rights reserved. Keywords: Xylanase; Thermobifida fusca; Escherichia coli; Pichia pastoris
1. Introduction 1,4--d-Xylan xylanohydrolases (EC 3.2.1.8), commonly called xylanases, catalyze the hydrolysis of -1,4 linkage of xylan to release d-xylose as product [1]. They have widespread potential for biotechnological applications, including the improvement of physical properties of foods and nutrient value of forage, degrading agricultural wastes and paper industry bleaching [2,3]. It is particularly important in pulp bleaching because the biobleaching process uses xylanase to remove lignin by altering the structure of pulp fiber. This has replaced the need for alkaline and chlorine in conventional bleaching process [4–6]. An ideal xylanase should equip with specific properties. For example, they need to be highly active and stable at high temperature (70 ◦ C) or at high pH (pH 8.0). If such properties are available, they are of greater practical use in pulp industry. Several xylanases produced from bacteria, actinomycetes and fungi have been examined for this purpose including Bacillus [7–9], Clostridium [10], Thermomonospora [11–14], Ther∗
Corresponding author. Tel.: +886 2 33664517; fax: +886 2 23640961. E-mail address: [email protected] (W.-H. Liu).
0141-0229/$ – see front matter © 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.enzmictec.2005.04.006
mobifida [11], Thermotoga [15], Streptomyces [16,17], Aspergillus [18,19], Trichoderma [20], Thermomyces [21], etc. Several strains of fungi are widely used for xylanase production, however, thermophilic actinomycetes are considered to also be the more superior sources. It was reported that Thermomonospora fusca YX, a thermophilic actinomycete, produced an extracellular xylanase with useful properties for industrial purpose. The xylanase gene of T. fusca YX named as xynA has been cloned and expressed in Streptomyces lividans and E. coli even though the xylanase expression levels in S. lividans and E. coli were lower than in T. fusca YX [22]. In the light of economic benefits, several thermostable enzymes cloned from thermophilic microorganisms have been expressed in mesophilic microorganisms to reduce the energy needed for cultivation [23]. Recently, among many mesophile host systems, Pichia pastoris, methylotrophic yeast with capability to perform many eukaryotic posttranslational modifications, has been considered as an excellent host system for heterologous proteins expression. It is well known that the expression can be driven by strong alcohol oxidase I (AOX1) promoter under methanol induction [24]. In addition, a high level of protein production can be achieved by a high cell density culture of P. pastoris [25].
542
Y.-F. Cheng et al. / Enzyme and Microbial Technology 37 (2005) 541–546
For developing enzymatic degradation of renewable lignocellulose, a potent extracellular lignocellulolytic enzymeproducing thermophilic actinomycete, Thermobifida fusca NTU22, was isolated from compost soils collected in Taiwan [26]. The enzyme properties and culture conditions for the extracellular xylanase of T. fusca NTU22 were investigated. The present paper discusses the cloning and expression of the xylanase from T. fusca NTU22 in P. pastoris. Some properties of the purified xylanase were also determined.
100 g/ml ampicillin, 40 g/ml IPTG, and 5 mg/mL oat-spelt xylan at 30 ◦ C for 14 days. The recombinant plasmid of the E. coli transformant giving the highest xylanase activity was sequenced in Applied Biosystem 3730 DNA analyzer (Applied Biosystems, CA, USA). The resulted sequence data was uploaded to the NCBI (National Center for Biotechnology Information) website to search for similarity to known DNA and protein sequences. 2.4. Construction of the plasmid for secreted xylanase expression
2. Materials and methods 2.1. Microorganisms and vectors A thermophilic actinomycete isolated from compost soils collected in Taiwan, Thermobifida fusca NTU22, was used in this study [26]. For cloning of the xylanase gene from T. fusca NTU22, Escherichia coli DH5␣ and pUC19 (Boehringer Mannheim, Germany) were used as the host-vector system. Pichia pastoris KM71H (arg4 aox1::ARG4) (Invitrogen, Sandiego, USA) and secretive expression vector pPICZ␣A (Invitrogen, Sandiego, USA) were used for protein expression, and plasmid propagation in the expression work was accomplished with E. coli DH5␣. 2.2. Materials Czapek-dox powder, yeast extract, casamino acids, peptone, tryptone, yeast nitrogen base (YNB) without amino acids and agar were purchased from Difco (Detroit, MI, USA). Zeocin was obtained from Cayla (Toulouse, France). Restriction endonucleases and T4 DNA ligation kit were purchased from Roche (Mannheim, Germany). For polymerase chain reactions, the Vio Twin Pack Kit comprising VioTag DNA polymerase, polymerase chain reaction buffer and deoxynucleotides was obtained from Viogene (Sunnyvale, CA, USA). Sepharose CL-6B and the low molecular weight electrophoresis calibration kit were supplied by Amersham Bioscience (New Territories, HK). The protein assay kit was obtained from Bio-Rad Laboratories (Hercules, CA, USA). Endo--N-acetylcosaminidase H was purchased from New England Biolabs Inc. (Beverly, MA, USA). Oat spelt xylan, ampicillin, inorganic salts and all other chemicals were purchased from Sigma (St. Louis, MO, USA). 2.3. Cloning of the xyl11 gene from a T. fusca NTU22 genomic DNA library The genomic DNA of T. fusca NTU22 was isolated based on the methods described by Hopwood et al. [27]. Genomic DNA from T. fusca NTU22 was partial digested by BamHI, and fragments of 2–10 kb were cloned into pUC19/E. coli DH5␣ to construct the genomic DNA library. The transformants were screened on the LB agar plates, which contained
To achieve secretive expression, the E. coli/P. pastoris shuttle vector pPICZ␣A was used. The vector pPICZ␣A is based on the tightly regulated AOX1 promoter and the presence of the Saccharomyces cerevisiae ␣-factor secretion signal located immediately upstream of the latter’s multiple cloning sites [28]. The entire coding region of cloned xylanase gene, designated xyl11, was amplified by PCR with EXYLF (5 CCGGAATTCATGAACCATGCCCCC3 ) as forward primer and the underlined sequence indicated an EcoRI restriction site immediately followed by the transcriptional start codon ATG of xyl11, which is in-framed with the start codon of ␣-factor secretion signal on pPICZ␣A. The reverse primer was EXYLR (5 GCTCTAGACTAGTTGGCGCTGCAG3 ) with an XbaI restriction site denoted as the underline, too. The amplification was carried out in a Gene Amp® PCR System 2400 (Perkin-Elmer, USA) under the following conditions: the first step was initiated at 94 ◦ C for 5 min, followed by 30 cycles of 94 ◦ C for 1 min, 55 ◦ C for 1 min and 72 ◦ C for 1 min, and the final extension was carried out at 72 ◦ C for 10 min. A 1.0 kb PCR product was recovered from the agarose gel and cloned into EcoRI and XbaI digested pPICZ␣A. After being transformed into E. coli DH5␣, one recombinant plasmid designated as pPIC␣XYL was selected on low salt LB agar plates (5 g/L yeast extract, 10 g/L tryptone, 5 g/L NaCl, 15 g/L agar, and adjusted pH to 7.5) containing 25 g/mL Zeocin. The proper insert orientation was checked by restriction analysis and sequencing as described above. 2.5. Transformation and screening of P. pastoris An amount of 10 g recombinant plasmid (pPIC␣XYL) was linearized with SacI, and electroporated into P. pastoris KM71H under the following conditions: 1.5 kV, 25 F, 200 , 5 ms, using a GenePulser (Bio-Rad, CA, USA). The transformants were selected at 28 ◦ C on the YPDS agar plates (10 g/L yeast extract, 20 g/L peptone, 20 g/L dextrose, 20 g/L agar and 1 M sorbitol) containing 100 g/mL Zeocin for 4-6 days. Screening for high level expression transformants was done by replicating the colonies obtained from the YPDS agar plates containing 100 g/mL Zeocin onto YPDS agar plates with a higher Zeocin concentration (2000 g/mL). Transformants with higher Zeocin-resistance were obtained
Y.-F. Cheng et al. / Enzyme and Microbial Technology 37 (2005) 541–546
and checked for the integration of the construct into the P. pastoris KM71H genome by genomic PCR [29] using EXYLR and EXYLR as the primers. 2.6. Xylanase activity assay Xylanase activity was determined by measuring the release of reducing sugar from oat spelt xylan. The reaction mixture contained 0.1 ml of appropriately diluted crude enzyme and 0.9 ml of 100 mM sodium-phosphate buffer (pH 7.0) containing 2% (w/v) of oat spelt xylan. After incubated at 65 ◦ C for 20 min, the reaction was stopped by chilling the mixture on ice, followed by centrifugation at 3000 × g for 1 min. The amount of reducing sugar released in the mixture was determined by the dinitrosalicylic acid method [30], and d-xylose was used as a standard. Absorbance of the mixture was measured at 540 nm. One unit of enzyme activity was defined as the amount of enzyme releasing 1 mole d-xylose per minute under the assay condition. All analytical measurements were performed at least in triplicate. 2.7. Cultivation in shaken flask For screening of the xylanase productivity, P. pastoris transformants with high Zeocin-resistance (2000 g/mL) were cultured in shaken flasks to differentiate the various levels of expression. A seed culture of the transformants and P. pastoris KM71H/pPICZ␣A (P. pastoris KM71H transformed with pPICZ␣A, as a control strain) were prepared by culturing the colony in YPD medium for 24 h, then 0.2% of inoculums were inoculated into 100 mL BMGY medium (10 g/L yeast extract, 20 g/L peptone, 100 mM potassium phosphate (pH 6.0), 13.4 g/L YNB, 4 × 10−4 g/L biotin, and 1% (v/v) glycerol) in 500 mL Hinton flasks and shaken (250 rpm) at 28 ◦ C for 16 h. Then, the cells were harvested by centrifugation (3000 × g, 5 min) and resuspended in 10 mL BMGY medium (10 g/L yeast extract, 20 g/L peptone, 100 mM potassium phosphate (pH 6.0), 13.4 g/L YNB, 4 × 10−4 g/L biotin, and 0.5% (v/v) methanol) in 50 mL Hinton flasks and shaken (250 rpm) for 120 h. To maintain induction, 100% methanol was supplemented every 24 h to a final concentration of 0.5% throughout the induction phase. 2.8. Cultivation in fermentor The P. pastoris transformant giving the highest expression of xylanase activity was selected and cultivated in a 5liter fermentor (M205, HOTECH, Taiwan). A 500 mL Hinton flask containing 100 mL YPD medium inoculated with pellet of P. pastoris transformant scraped from a maintenance agar plate was cultured at 28 ◦ C and shaken (250 rpm) for 24 h, and this was used as the seed culture. The 5-liter fermentor was loaded with 2 liter basal medium consisting of 40.0 g glycerol, 0.93 g CaSO4 ·2H2 O, 18.2 g K2 SO4 , 14.9 g
543
MgSO4 ·7H2 O, 4.13 g KOH, 26.7 mL 85% H3 PO4 per liter of distilled water, and 2 mL/L PTM1 (6 g CuSO4 ·5H2 O, 0.5 g CaSO4 ·2H2 O, 65 g FeSO4 ·7H2 O, 3 g MnSO4 ·H2 O, 0.8 g KI, 0.2 g Na2 MoO4 ·2H2 O, 0.2 g H3 BO3 , 0.2 g biotin, 20 g ZnCl2 , and 5 mL H2 SO4 per liter of distilled water) was added after sterilization. The fermentation process was divided into two phases, the biomass accumulation phase and the methanol induction phase. In the first phase, glycerol was the sole carbon source for biomass accumulation. When the initial glycerol in the medium was exhausted, as indicated by a D.O. spike, a glycerol fed-batch phase was initiated by feeding glycerol (5 ml/h/L) into the fermentor. The biomass was accumulated until a second D. O. spike observed, and immediately the methanol induction phase was started by feeding methanol (2.5 mL/h/L) into the fermentor. The crude culture supernatant was used to determine xylanase activity. 2.9. Enzyme purification All purification procedures were done at 4 ◦ C in 50 mM phosphate buffer (pH 7.0) unless otherwise stated. After 120 h methanol induction cultivation of the P. pastoris transformant in a 5-liter fermentor, the fermentation broth was centrifuged by 3000 ×g for 5 min to remove cell. The supernatant was concentrated by ultrafiltration with a 5.0 kDa molecular weight cut-off membrane (Amicon Ultra-15 centrifugal filter device, Millipore, Ireland). The concentrated enzyme solution was then applied to a Sepharose CL-6B column (1.6 c × 100 cm) pre-equilibrated with the same buffer. The eluted enzymatically active fractions were pooled and used as purified enzyme. 2.10. SDS-polyacrylamide gel electrophoresis (SDS-PAGE) The molecular mass of the purified enzyme was determined by using SDS-PAGE (12.5% polyacrylamide). Phosphorylase b (94 kDa), bovine serum albumin (67 kDa), ovalbumin (43 kDa), carbonic anhydrase (30 kDa), trypsin inhibitor (20 kDa) and ␣-lacalbumin (14 kDa) were used as molecular mass standards. The electrophoresis was carried out at 150 V for 1 h. The gel was stained with 0.27% Coomassie Brilliant Blue R-250, and destained by washing overnight with a mixture of acetic acid–methanol–water (10:20:70, v/v/v). 2.11. Deglycosylation of xylanase from P. pastoris transformant The purified xylanase from P. pastoris transformant was deglycosylated by denaturing the glycoprotein at 100 ◦ C for 10 min, and then endo--N-acetylglycos- aminidase H was added to perform deglycosylation at 37 ◦ C for 1 h. All manipulations followed the manufacturer’s instructions.
544
Y.-F. Cheng et al. / Enzyme and Microbial Technology 37 (2005) 541–546
Fig. 1. Alignment of the xylanase coding sequence between xyl11 from T. fusca NTU22 and xynA from T. fusca YX. There is only one mismatch in amino acid sequence and this is located at the 234th amino acid, which was boxed.
3. Results 3.1. Cloning and sequence analysis of xylanase gene (xyl11) from T. fusca NTU22 After partial digestion of genomic DNA using BamHI, a genomic library of T. fusca NTU22 was created using the E. coli DH5␣-pUC19 host–vector system. About 8000 transformants on the LB-Ap-IPTG-X-gal agar plates were isolated, and screened for their xylanase activity on the LB-Ap-IPTGxylan agar plates. Three positive transformants were selected and the expression of xylanase actvity by these strains was tested in 50 mL shaken flask cultures. A plasmid containing a 6.0 kb insert was selected because it expressed the highest xylanase activity and was denoted as pXYL11. The DNA sequence of the 6.0 kb insert revealed that an open reading frame of 1014 base pairs encodes a protein of 338 amino acids, and was named xyl11 (accession no: AY795559). The base composition of the xyl11 coding sequence is 66% G + C with a calculated molecular weight of 36 kDa. Alignment of the nucleotide sequence with NCBI database resulted in a 99.7% identity to the xynA from T. fusca YX [32]. Mismatch in the amino acid sequence between xyl11 and xynA occurs only at the 234th amino acid (Fig. 1). 3.2. Expression of xylanase gene (xyl11) in P. pastoris The xyl11 coding sequence was cloned into the pPICZ␣A vector at the EcoRI/XbaI restriction sites as described earlier. This construction allowed xyl11 coding sequence to be theoretically in-frame with the ␣-factor secretion signal in pPICZ␣A. Following a sequence check, the construct denoted as pPIC␣XYL was SacI-linearized and electroporated into P. pastoris KM71H. Nine transformants were selected for high resistance to Zeocin (2000 g/mL). The genomic PCR assay revealed that all the transformants contained an integrated xyl11 coding sequence in genomic DNA. One
Fig. 2. Time course for the expression of xylanase activity by P. pastoris transformant in a 5-liter fermentor. (A) glycerol batch phase; (B) glycerol fed-batch phase; (C) methanol induction phase; (䊉) xylanase activity; () OD600 nm ; (—) DO value; (↓) start of methanol induction. The culture conditions were: temperature, 30 ◦ C; aeration rate, 1.5 vvm and agitation speed, 500 rpm. The pH was kept at 5.0 with concentrated ammonium hydroxide.
P. pastoris transformant (pPIC␣XYL) was selected for the highest xylanase activity (88.29 U/mL) in a culture of 50 mL Hinton flask after methanol induction. No xylanase activity was detected in the culture of the control strain, P. pastoris (pPICZ␣A), under the same culture conditions. Culture conditions for the expression of xylanase activity were investigated in a 5-liter fermentor. The cultivation was initiated with a 40 g/L glycerol batch culture for about 16 h up to the first D.O. spike. Then, a glycerol fed-batch phase was initiated by feeding of glycerol (5 mL/h/L) to accumulate the biomass. When the biomass (OD600 nm ) reached approximately 380, a second D.O. spike occurred indicating the commencement of the methanol induction phase. As shown in Fig. 2, the expression of xylanase activity in the culture broth first appeared at the methanol induction phase. The maximum xylanase activity was about 324.2 U/mL in the culture broth after 144 h of methanol induction. The xylanase productivity of P. pastoris transformant was about 67-fold higher than that of T. fusca NTU22. 3.3. Purification of xylanase from P. pastoris transformant The purification of the xylanase was performed as described earlier. The results of the purification are summarized in Table 1. The purified enzyme obtained exhibited 23% of the total initial activity and there was a 6.9-fold increase in specific activity compared with the crude culture supernatant. SDS-PAGE of the purified xylanase showed there were at least three forms of the xylanase with molecular
Table 1 Summary of the purification of xylanase from P. pastoris transformant Step
Total protein (mg)
Total activity (U)
Specific activity (U/mg)
Purification (fold)
Yield (%)
Crude culture supernatant Ultrafiltration Sepharose CL-6B
31.6 15.1 1.0
35491.2 27373.5 8160.0
1124.9 1809.2 7846.2
1.0 1.6 6.9
100 77 23
Y.-F. Cheng et al. / Enzyme and Microbial Technology 37 (2005) 541–546
545
for 3 h (Fig. 4). It is apparent that the properties of purified xylanase from P. pastoris transformant are similar to that of xylanase from T. fusca NTU22.
4. Discussion
Fig. 3. SDS-PAGE of the purified xylanase from P. pastoris transformant. Lane M: low molecular mass standard protein: phosphorylase b (94 kDa), bovine serum albumin (67 kDa), ovalbumin (43 kDa), carbonic anhydrase (30 kDa), trypsin inhibitor (20 kDa) and ␣-lacalbumin (14 kDa). Lane 1: the purified xylanase deglycosylated with Endo H. Lane 2: the purified xylanase from Sepharose CL-6B column chromatography. Lane 3: crude culture supernatant. Electrophoresis conditions: 150 V, 1 h.
masses close to 43 kDa (Fig. 3). After treated with endo--Nacetylglycosaminidase H to remove carbohydrate moieties, only a single band located at about 36 kDa was obtained. It was identical to the calculate molecular mass based on the amino acid base composition of the xyl11 gene inserted into the P. pastoris transformant. The optimal pH and temperature of the purified xylanase were 7.0 and 70 ◦ C, respectively. The purified enzyme was stable at 60 ◦ C for 3 h. About 70% of the original activity remained after heat treatment at 70 ◦ C
Fig. 4. Thermal stability of the xylanases from T. fusca NTU22 and the P. pastoris transformant. The enzyme was incubated at various temperatures for 30–180 min, and residual enzyme activity was determined. T. fusca NTU22: (䊉) 60 ◦ C, () 70 ◦ C, () 80 ◦ C; P. pastoris transformant: () 60 ◦ C, () 70 ◦ C, ( ) 80 ◦ C.
We are interested in the production of lignocellulolytic enzyme from local thermophilic actinomycetes to explore their use in novel biotechnological applications. By using bagasse as carbon source, ligonocellulolytic enzymes such as xylanases, cellulases, esterases and peroxidases were simultaneously accumulated in the culture broth of T. fusca NTU22 [26]. For several years, a number of xylanase-producing microorganisms including fungi, yeasts and bacteria have been reported. It was reported that the xylanase gene (xynA) from T. fusca YX could be expressed in E. coli and S. lividans. The xylanase activity produced by S. lividans transformants was 10- to 20-fold higher than that produced by E. coli transformants but only one-fourth the level produced by induced T. fusca YX [22]. As shown in Fig. 2, the maximum xylanase activity of P. pastoris transformant was about 324.2 U/mL in the culture broth after 144 h of methanol induction. The xylanase productivity of P. pastoris transformant was thus about 67-fold higher than that of T. fusca NTU22. It is apparent that the expression system of P. pastoris would seem to be superior to those of S. lividans and E. coli. In addition, the amount of extracellular proteins in the culture of the P. pastoris transformant was fewer than that in the culture of T. fusca NTU22. This will facilitate the application of xylanase in an industrial process immediately without complicated purification procedures [31]. As shown in Fig. 1, the xylanase gene (xyl11) from T. fusca NTU22 consisted of 1014 base pairs. The nucleotide sequence of xyl11 is 99.7% identical to the xynA from T. fusca YX. One mismatched amino acid occurs between xyl11 and xynA and this is the replacement with aspartate of a glycine at the 234th amino acid. The xynA was reported to comprise an open reading frame coding 32 kDa mature protein preceded by a leader sequence (42-aa). The mature protein of xynA can be divided into three domains: the catalytic domain (189-aa), the linker region (21-aa), and the binding domain (86-aa) [32]. We concluded that the xylanase gene (xyl11) encodes a 36 kDa protein including a leader sequence (42-aa) and mature protein (296-aa). The only mismatch in the amino acid sequence between xyl11 and xynA was located in the linker region, and this should result in no obvious effect on the catalytic and binding properties of xylanase. SDS-PAGE of the purified xylanase from P. pastoris transformant showed at least three forms of xylanase. However, only one single 36 kDa protein was obtained after being treated with endo--N-acetylglycosaminidase H to remove carbohydrate moieties (Fig. 3). These results revealed that various degrees of glycosylation occurred during the expression of xylanase in P. pastoris transformant. However, the
546
Y.-F. Cheng et al. / Enzyme and Microbial Technology 37 (2005) 541–546
properties of xylanase from T. fusca NTU22 were not greatly changed by the glycosylation in P. pastoris (Fig. 4). Acknowledgement Financial support for this study from the National Science Council of the Republic of China (NSC92-2313-B-002-112) is gratefully acknowledged. References [1] Biely P. Microbial xylanolytic systems. Trends Biotechnol 1985;3: 286–90. [2] Beg QK, Kapoor M, Mahajan L, Hoondal GS. Microbial xylanases and their industrial applications: a review. Appl Microbiol Biotechnol 2001;56:326–38. [3] Subramaniyan S, Prema P. Bio/Technology of microbial xylanases: enzymology, molecular biology, and application. Crit Rev Biotechnol 2002;22:33–64. [4] Coughlan MP, Hazlewood GP. -1,4-Xylan degrading enzyme systems: biochemistry, molecular biology and application. Biotechnol Appl Biochem 1993;17:259–89. [5] Viikari L, Kantelinen A, Sundquist J, Linko M. Xylanases in bleaching: from an idea to the industry. FEMS Microbiol Rev 1994;13:335–50. [6] Techapun C, Poosaran N, Watanabe M, Sasaki K. Thermostable and alkaline-tolerant microbial cellulose-free xylanases produced from agricultural wastes and the properties required for use in pulp bleaching bioprocesses: a review. Process Biochem 2003;38:1327–40. [7] Bataillon M, Cardinali APN, Castillon N, Duchiron F. Purification and characterization of a moderately thermostable xylanase from Bacillus sp. Strain SPS-0. Enzyme Microb Technol 2000;26:187–92. [8] Duillon A, Gupta JK, Khanna S. Enhanced production, purification and characterization of a novel cellulase-poor thermostable, alkalitolerant xylanase from Bacillus circulans AB16. Process Biochem 2000;35:849–56. [9] Tseng M, Yap M, Ratanakanokchai K, Kyu KL, Chen S. Purification and characterization of two cellulose-free xylanase from an alkalophilic Bacillus firmus. Enzyme Microb Technol 2002;30:590–5. [10] Rani DS, Nand K. Production of thermostable cellulose-free xylanase by Clostridium absonum CFR-702. Process Biochem 2000;36:355–62. [11] McCarthy AJ, Peace E, Broda P. Studies on the extracellular xylanase activity of some thermophilic actinomycetes. Appl Microbiol Biotechnol 1985;21:238–44. [12] Blanco J, Coque JJR, Velasco J, Martin JF. Cloning expression in Streptomyces lividans and biochemical characterization of a thermostable endo--1,4-d-xylanase of Thermomonospora alba ULJB1 with cellulose-binding ability. Appl Microbiol Biotechnol 1997;48:208–17. [13] George SP, Ahmad A, Rao MB. A novel thermostable xylanase from Thermomonospora sp.: influence of additives on thermostability. Bioresource Technol 2001;78:221–4. [14] Tuncer M, Ball AS. Degradation of lignocellulose by extracellular enzymes produced by Thermomonospora fusca BD25. Appl Microbiol Biotechnol 2002;58:608–11.
[15] Christoph W, Wolfgang L. Two extremely thermostable xylanase of the hyperthermophilic bacterium Thermotoga maritima MSB8. Appl Environ Microbiol 1995;61:1810–5. [16] Antonopoulos VT, Hernandez M, Arias ME, Mavrakos E, Ball AS. The use of extracellular enzyme from Streptomyces albus ATCC3005 for the bleaching of eucalyptus kraft pulp. Appl Microbiol Biotechnol 2001;54:92–7. [17] Techapun C, Chareonrat T, Watanabe M, Poosaran N, Sasaki K. Thermostable and alkaline-tolerant cellulase-free xylanases produced from thermotolerant Streptomyces sp. Ab106. J Biosci Bioeng 2002;93:431–3. [18] Khanna P, Sundari SS, Kumar NJ. Production, isolation and partial purification of xylanase from an Aspergillus sp. World J Microbiol Biotechnol 1995;11:242–3. [19] Christov LP, Szakacs G, Balakrishnan H. Production partial characterization and use of fungal cellulase-free xylanases in pulp bleaching. Process Biochem 1999;64:511–7. [20] Poutanen K, Puls J. Characterization of Trichoderma reesei xylosidase and its use in the hydrolysis of solubilized xylans. Appl Microbiol Biotechnol 1988;28:425–32. [21] Singh S, Reddy P, Haarhoff J, Biely P, Janse B, Pillay B, et al. Relatedness of Thermomyces lanuginosus strains producing a thermostable xylanase. J Biotechnol 2000;81:119–28. [22] Ghangas GS, Hu YJ, Wilson DB. Cloning of a Thermomonospora fusca xylanase gene and its expression in Escherichia coli and Streptomyces lividans. J Bacteriol 1989;171:2963–9. [23] Zamost BL, Nielsen HK, Starnes RL. Thermostable enzymes for industrial application. J Ind Microbiol 1991;8:71–82. [24] Cereghino JL, Cregg JM. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol Rev 2000;24:45–66. [25] Cereghino GPL, Cereghino JL, Llgen C, Cregg JM. Production of recombinant proteins in fermenter cultures of the yeast Pichia pastoris. Curr Opin Biotechnol 2002;13:329–32. [26] Liu WH, Yang CH. The isolation and identification of a lignocellulollyltic and thermophilic actinomycete. Food Sci Agric Chem 2002;4:89–94. [27] Hopwood DA, Bibb MJ, Chater KF, Kieser T, Bruton CJ, Kieser HM, et al. Preparation of chromosomal, plasmid and phage DNA. In: Genetic manipulation of streptomyces: a laboratory manual. Norwich, UK: John Innes Foundation; 1985. p. 70– 102. [28] Higgins DR, Busser K, Comiskey J, Whittier PS, Purcell TJ, Hoeffler JP. Small vectors for expression based on dominant drug resistance with direct multicopy selection. In: Higgins DR, Cregg JM, editors. Methods in molecular biology: pichia protocols. Totowa, New Jersey: Humana press; 1998. p. 28–41. [29] Reddy ST, Kumar SN, Haas AL, Dahms NM. Biochemical and functional properties of the full-length cation-dependent mannose 6phosphate receptor expressed in Pichia pastoris. Biochem Biophys Res Commun 2003;309:643–51. [30] Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 1959;31:426–8. [31] Damaso MCT, Almeida MS, Kurtenbach E, Martins Jr OB, Andrade CMMC NP, Albano RM. Optimized expression of a thermostable xylanase from Thermomyces lanuginosus in Pichia pastoris. Appl Environ Microbiol 2003;69:6064–72. [32] Irwin D, Jung ED, Wilson DB. Characterization and sequence of a Thermomonospora fusca xylanase. Appl Environ Microbiol 1994;60:763–70.
Cloning and expression of Thermobifida xylanase gene in the methylotrophic yeast Pichia pastoris Yi-Fang Cheng, Chao-Hsun Yang, Wen-Hsiung Liu ∗ Institute of Microbiology and Biochemistry, National Taiwan University, No. 1, Sec. 4, Roosevelt Road, Taipei, Taiwan Received 16 November 2004; received in revised form 31 March 2005; accepted 7 April 2005
Abstract A gene (xyl11) encoding xylanase from Thermobifida fusca NTU22 was cloned, sequenced and expressed in Escherichia coli. The gene consists of 1014 base pairs and encodes a protein of 338 amino acids. The gene was then cloned into and secretively expressed in Pichia pastoris under the control of the AOX1 promoter. The xylanase productivity of the P. pastoris transformant (pPIC␣XYL) was about 67-fold higher than that of T. fusca NTU22 cultured in a 5-liter fermentor. The purified xylanase showed a single band at about 36 kDa by SDS-polyacrylamide gel electrophoresis after being treated with endo--N-acetylglycosaminidase H. The optimal pH and temperature of the purified xylanase were 7.0 and 70 ◦ C, respectively. About 70% of original activity remained after heat treatment at 70 ◦ C for 3 h. © 2005 Elsevier Inc. All rights reserved. Keywords: Xylanase; Thermobifida fusca; Escherichia coli; Pichia pastoris
1. Introduction 1,4--d-Xylan xylanohydrolases (EC 3.2.1.8), commonly called xylanases, catalyze the hydrolysis of -1,4 linkage of xylan to release d-xylose as product [1]. They have widespread potential for biotechnological applications, including the improvement of physical properties of foods and nutrient value of forage, degrading agricultural wastes and paper industry bleaching [2,3]. It is particularly important in pulp bleaching because the biobleaching process uses xylanase to remove lignin by altering the structure of pulp fiber. This has replaced the need for alkaline and chlorine in conventional bleaching process [4–6]. An ideal xylanase should equip with specific properties. For example, they need to be highly active and stable at high temperature (70 ◦ C) or at high pH (pH 8.0). If such properties are available, they are of greater practical use in pulp industry. Several xylanases produced from bacteria, actinomycetes and fungi have been examined for this purpose including Bacillus [7–9], Clostridium [10], Thermomonospora [11–14], Ther∗
Corresponding author. Tel.: +886 2 33664517; fax: +886 2 23640961. E-mail address: [email protected] (W.-H. Liu).
0141-0229/$ – see front matter © 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.enzmictec.2005.04.006
mobifida [11], Thermotoga [15], Streptomyces [16,17], Aspergillus [18,19], Trichoderma [20], Thermomyces [21], etc. Several strains of fungi are widely used for xylanase production, however, thermophilic actinomycetes are considered to also be the more superior sources. It was reported that Thermomonospora fusca YX, a thermophilic actinomycete, produced an extracellular xylanase with useful properties for industrial purpose. The xylanase gene of T. fusca YX named as xynA has been cloned and expressed in Streptomyces lividans and E. coli even though the xylanase expression levels in S. lividans and E. coli were lower than in T. fusca YX [22]. In the light of economic benefits, several thermostable enzymes cloned from thermophilic microorganisms have been expressed in mesophilic microorganisms to reduce the energy needed for cultivation [23]. Recently, among many mesophile host systems, Pichia pastoris, methylotrophic yeast with capability to perform many eukaryotic posttranslational modifications, has been considered as an excellent host system for heterologous proteins expression. It is well known that the expression can be driven by strong alcohol oxidase I (AOX1) promoter under methanol induction [24]. In addition, a high level of protein production can be achieved by a high cell density culture of P. pastoris [25].
542
Y.-F. Cheng et al. / Enzyme and Microbial Technology 37 (2005) 541–546
For developing enzymatic degradation of renewable lignocellulose, a potent extracellular lignocellulolytic enzymeproducing thermophilic actinomycete, Thermobifida fusca NTU22, was isolated from compost soils collected in Taiwan [26]. The enzyme properties and culture conditions for the extracellular xylanase of T. fusca NTU22 were investigated. The present paper discusses the cloning and expression of the xylanase from T. fusca NTU22 in P. pastoris. Some properties of the purified xylanase were also determined.
100 g/ml ampicillin, 40 g/ml IPTG, and 5 mg/mL oat-spelt xylan at 30 ◦ C for 14 days. The recombinant plasmid of the E. coli transformant giving the highest xylanase activity was sequenced in Applied Biosystem 3730 DNA analyzer (Applied Biosystems, CA, USA). The resulted sequence data was uploaded to the NCBI (National Center for Biotechnology Information) website to search for similarity to known DNA and protein sequences. 2.4. Construction of the plasmid for secreted xylanase expression
2. Materials and methods 2.1. Microorganisms and vectors A thermophilic actinomycete isolated from compost soils collected in Taiwan, Thermobifida fusca NTU22, was used in this study [26]. For cloning of the xylanase gene from T. fusca NTU22, Escherichia coli DH5␣ and pUC19 (Boehringer Mannheim, Germany) were used as the host-vector system. Pichia pastoris KM71H (arg4 aox1::ARG4) (Invitrogen, Sandiego, USA) and secretive expression vector pPICZ␣A (Invitrogen, Sandiego, USA) were used for protein expression, and plasmid propagation in the expression work was accomplished with E. coli DH5␣. 2.2. Materials Czapek-dox powder, yeast extract, casamino acids, peptone, tryptone, yeast nitrogen base (YNB) without amino acids and agar were purchased from Difco (Detroit, MI, USA). Zeocin was obtained from Cayla (Toulouse, France). Restriction endonucleases and T4 DNA ligation kit were purchased from Roche (Mannheim, Germany). For polymerase chain reactions, the Vio Twin Pack Kit comprising VioTag DNA polymerase, polymerase chain reaction buffer and deoxynucleotides was obtained from Viogene (Sunnyvale, CA, USA). Sepharose CL-6B and the low molecular weight electrophoresis calibration kit were supplied by Amersham Bioscience (New Territories, HK). The protein assay kit was obtained from Bio-Rad Laboratories (Hercules, CA, USA). Endo--N-acetylcosaminidase H was purchased from New England Biolabs Inc. (Beverly, MA, USA). Oat spelt xylan, ampicillin, inorganic salts and all other chemicals were purchased from Sigma (St. Louis, MO, USA). 2.3. Cloning of the xyl11 gene from a T. fusca NTU22 genomic DNA library The genomic DNA of T. fusca NTU22 was isolated based on the methods described by Hopwood et al. [27]. Genomic DNA from T. fusca NTU22 was partial digested by BamHI, and fragments of 2–10 kb were cloned into pUC19/E. coli DH5␣ to construct the genomic DNA library. The transformants were screened on the LB agar plates, which contained
To achieve secretive expression, the E. coli/P. pastoris shuttle vector pPICZ␣A was used. The vector pPICZ␣A is based on the tightly regulated AOX1 promoter and the presence of the Saccharomyces cerevisiae ␣-factor secretion signal located immediately upstream of the latter’s multiple cloning sites [28]. The entire coding region of cloned xylanase gene, designated xyl11, was amplified by PCR with EXYLF (5 CCGGAATTCATGAACCATGCCCCC3 ) as forward primer and the underlined sequence indicated an EcoRI restriction site immediately followed by the transcriptional start codon ATG of xyl11, which is in-framed with the start codon of ␣-factor secretion signal on pPICZ␣A. The reverse primer was EXYLR (5 GCTCTAGACTAGTTGGCGCTGCAG3 ) with an XbaI restriction site denoted as the underline, too. The amplification was carried out in a Gene Amp® PCR System 2400 (Perkin-Elmer, USA) under the following conditions: the first step was initiated at 94 ◦ C for 5 min, followed by 30 cycles of 94 ◦ C for 1 min, 55 ◦ C for 1 min and 72 ◦ C for 1 min, and the final extension was carried out at 72 ◦ C for 10 min. A 1.0 kb PCR product was recovered from the agarose gel and cloned into EcoRI and XbaI digested pPICZ␣A. After being transformed into E. coli DH5␣, one recombinant plasmid designated as pPIC␣XYL was selected on low salt LB agar plates (5 g/L yeast extract, 10 g/L tryptone, 5 g/L NaCl, 15 g/L agar, and adjusted pH to 7.5) containing 25 g/mL Zeocin. The proper insert orientation was checked by restriction analysis and sequencing as described above. 2.5. Transformation and screening of P. pastoris An amount of 10 g recombinant plasmid (pPIC␣XYL) was linearized with SacI, and electroporated into P. pastoris KM71H under the following conditions: 1.5 kV, 25 F, 200 , 5 ms, using a GenePulser (Bio-Rad, CA, USA). The transformants were selected at 28 ◦ C on the YPDS agar plates (10 g/L yeast extract, 20 g/L peptone, 20 g/L dextrose, 20 g/L agar and 1 M sorbitol) containing 100 g/mL Zeocin for 4-6 days. Screening for high level expression transformants was done by replicating the colonies obtained from the YPDS agar plates containing 100 g/mL Zeocin onto YPDS agar plates with a higher Zeocin concentration (2000 g/mL). Transformants with higher Zeocin-resistance were obtained
Y.-F. Cheng et al. / Enzyme and Microbial Technology 37 (2005) 541–546
and checked for the integration of the construct into the P. pastoris KM71H genome by genomic PCR [29] using EXYLR and EXYLR as the primers. 2.6. Xylanase activity assay Xylanase activity was determined by measuring the release of reducing sugar from oat spelt xylan. The reaction mixture contained 0.1 ml of appropriately diluted crude enzyme and 0.9 ml of 100 mM sodium-phosphate buffer (pH 7.0) containing 2% (w/v) of oat spelt xylan. After incubated at 65 ◦ C for 20 min, the reaction was stopped by chilling the mixture on ice, followed by centrifugation at 3000 × g for 1 min. The amount of reducing sugar released in the mixture was determined by the dinitrosalicylic acid method [30], and d-xylose was used as a standard. Absorbance of the mixture was measured at 540 nm. One unit of enzyme activity was defined as the amount of enzyme releasing 1 mole d-xylose per minute under the assay condition. All analytical measurements were performed at least in triplicate. 2.7. Cultivation in shaken flask For screening of the xylanase productivity, P. pastoris transformants with high Zeocin-resistance (2000 g/mL) were cultured in shaken flasks to differentiate the various levels of expression. A seed culture of the transformants and P. pastoris KM71H/pPICZ␣A (P. pastoris KM71H transformed with pPICZ␣A, as a control strain) were prepared by culturing the colony in YPD medium for 24 h, then 0.2% of inoculums were inoculated into 100 mL BMGY medium (10 g/L yeast extract, 20 g/L peptone, 100 mM potassium phosphate (pH 6.0), 13.4 g/L YNB, 4 × 10−4 g/L biotin, and 1% (v/v) glycerol) in 500 mL Hinton flasks and shaken (250 rpm) at 28 ◦ C for 16 h. Then, the cells were harvested by centrifugation (3000 × g, 5 min) and resuspended in 10 mL BMGY medium (10 g/L yeast extract, 20 g/L peptone, 100 mM potassium phosphate (pH 6.0), 13.4 g/L YNB, 4 × 10−4 g/L biotin, and 0.5% (v/v) methanol) in 50 mL Hinton flasks and shaken (250 rpm) for 120 h. To maintain induction, 100% methanol was supplemented every 24 h to a final concentration of 0.5% throughout the induction phase. 2.8. Cultivation in fermentor The P. pastoris transformant giving the highest expression of xylanase activity was selected and cultivated in a 5liter fermentor (M205, HOTECH, Taiwan). A 500 mL Hinton flask containing 100 mL YPD medium inoculated with pellet of P. pastoris transformant scraped from a maintenance agar plate was cultured at 28 ◦ C and shaken (250 rpm) for 24 h, and this was used as the seed culture. The 5-liter fermentor was loaded with 2 liter basal medium consisting of 40.0 g glycerol, 0.93 g CaSO4 ·2H2 O, 18.2 g K2 SO4 , 14.9 g
543
MgSO4 ·7H2 O, 4.13 g KOH, 26.7 mL 85% H3 PO4 per liter of distilled water, and 2 mL/L PTM1 (6 g CuSO4 ·5H2 O, 0.5 g CaSO4 ·2H2 O, 65 g FeSO4 ·7H2 O, 3 g MnSO4 ·H2 O, 0.8 g KI, 0.2 g Na2 MoO4 ·2H2 O, 0.2 g H3 BO3 , 0.2 g biotin, 20 g ZnCl2 , and 5 mL H2 SO4 per liter of distilled water) was added after sterilization. The fermentation process was divided into two phases, the biomass accumulation phase and the methanol induction phase. In the first phase, glycerol was the sole carbon source for biomass accumulation. When the initial glycerol in the medium was exhausted, as indicated by a D.O. spike, a glycerol fed-batch phase was initiated by feeding glycerol (5 ml/h/L) into the fermentor. The biomass was accumulated until a second D. O. spike observed, and immediately the methanol induction phase was started by feeding methanol (2.5 mL/h/L) into the fermentor. The crude culture supernatant was used to determine xylanase activity. 2.9. Enzyme purification All purification procedures were done at 4 ◦ C in 50 mM phosphate buffer (pH 7.0) unless otherwise stated. After 120 h methanol induction cultivation of the P. pastoris transformant in a 5-liter fermentor, the fermentation broth was centrifuged by 3000 ×g for 5 min to remove cell. The supernatant was concentrated by ultrafiltration with a 5.0 kDa molecular weight cut-off membrane (Amicon Ultra-15 centrifugal filter device, Millipore, Ireland). The concentrated enzyme solution was then applied to a Sepharose CL-6B column (1.6 c × 100 cm) pre-equilibrated with the same buffer. The eluted enzymatically active fractions were pooled and used as purified enzyme. 2.10. SDS-polyacrylamide gel electrophoresis (SDS-PAGE) The molecular mass of the purified enzyme was determined by using SDS-PAGE (12.5% polyacrylamide). Phosphorylase b (94 kDa), bovine serum albumin (67 kDa), ovalbumin (43 kDa), carbonic anhydrase (30 kDa), trypsin inhibitor (20 kDa) and ␣-lacalbumin (14 kDa) were used as molecular mass standards. The electrophoresis was carried out at 150 V for 1 h. The gel was stained with 0.27% Coomassie Brilliant Blue R-250, and destained by washing overnight with a mixture of acetic acid–methanol–water (10:20:70, v/v/v). 2.11. Deglycosylation of xylanase from P. pastoris transformant The purified xylanase from P. pastoris transformant was deglycosylated by denaturing the glycoprotein at 100 ◦ C for 10 min, and then endo--N-acetylglycos- aminidase H was added to perform deglycosylation at 37 ◦ C for 1 h. All manipulations followed the manufacturer’s instructions.
544
Y.-F. Cheng et al. / Enzyme and Microbial Technology 37 (2005) 541–546
Fig. 1. Alignment of the xylanase coding sequence between xyl11 from T. fusca NTU22 and xynA from T. fusca YX. There is only one mismatch in amino acid sequence and this is located at the 234th amino acid, which was boxed.
3. Results 3.1. Cloning and sequence analysis of xylanase gene (xyl11) from T. fusca NTU22 After partial digestion of genomic DNA using BamHI, a genomic library of T. fusca NTU22 was created using the E. coli DH5␣-pUC19 host–vector system. About 8000 transformants on the LB-Ap-IPTG-X-gal agar plates were isolated, and screened for their xylanase activity on the LB-Ap-IPTGxylan agar plates. Three positive transformants were selected and the expression of xylanase actvity by these strains was tested in 50 mL shaken flask cultures. A plasmid containing a 6.0 kb insert was selected because it expressed the highest xylanase activity and was denoted as pXYL11. The DNA sequence of the 6.0 kb insert revealed that an open reading frame of 1014 base pairs encodes a protein of 338 amino acids, and was named xyl11 (accession no: AY795559). The base composition of the xyl11 coding sequence is 66% G + C with a calculated molecular weight of 36 kDa. Alignment of the nucleotide sequence with NCBI database resulted in a 99.7% identity to the xynA from T. fusca YX [32]. Mismatch in the amino acid sequence between xyl11 and xynA occurs only at the 234th amino acid (Fig. 1). 3.2. Expression of xylanase gene (xyl11) in P. pastoris The xyl11 coding sequence was cloned into the pPICZ␣A vector at the EcoRI/XbaI restriction sites as described earlier. This construction allowed xyl11 coding sequence to be theoretically in-frame with the ␣-factor secretion signal in pPICZ␣A. Following a sequence check, the construct denoted as pPIC␣XYL was SacI-linearized and electroporated into P. pastoris KM71H. Nine transformants were selected for high resistance to Zeocin (2000 g/mL). The genomic PCR assay revealed that all the transformants contained an integrated xyl11 coding sequence in genomic DNA. One
Fig. 2. Time course for the expression of xylanase activity by P. pastoris transformant in a 5-liter fermentor. (A) glycerol batch phase; (B) glycerol fed-batch phase; (C) methanol induction phase; (䊉) xylanase activity; () OD600 nm ; (—) DO value; (↓) start of methanol induction. The culture conditions were: temperature, 30 ◦ C; aeration rate, 1.5 vvm and agitation speed, 500 rpm. The pH was kept at 5.0 with concentrated ammonium hydroxide.
P. pastoris transformant (pPIC␣XYL) was selected for the highest xylanase activity (88.29 U/mL) in a culture of 50 mL Hinton flask after methanol induction. No xylanase activity was detected in the culture of the control strain, P. pastoris (pPICZ␣A), under the same culture conditions. Culture conditions for the expression of xylanase activity were investigated in a 5-liter fermentor. The cultivation was initiated with a 40 g/L glycerol batch culture for about 16 h up to the first D.O. spike. Then, a glycerol fed-batch phase was initiated by feeding of glycerol (5 mL/h/L) to accumulate the biomass. When the biomass (OD600 nm ) reached approximately 380, a second D.O. spike occurred indicating the commencement of the methanol induction phase. As shown in Fig. 2, the expression of xylanase activity in the culture broth first appeared at the methanol induction phase. The maximum xylanase activity was about 324.2 U/mL in the culture broth after 144 h of methanol induction. The xylanase productivity of P. pastoris transformant was about 67-fold higher than that of T. fusca NTU22. 3.3. Purification of xylanase from P. pastoris transformant The purification of the xylanase was performed as described earlier. The results of the purification are summarized in Table 1. The purified enzyme obtained exhibited 23% of the total initial activity and there was a 6.9-fold increase in specific activity compared with the crude culture supernatant. SDS-PAGE of the purified xylanase showed there were at least three forms of the xylanase with molecular
Table 1 Summary of the purification of xylanase from P. pastoris transformant Step
Total protein (mg)
Total activity (U)
Specific activity (U/mg)
Purification (fold)
Yield (%)
Crude culture supernatant Ultrafiltration Sepharose CL-6B
31.6 15.1 1.0
35491.2 27373.5 8160.0
1124.9 1809.2 7846.2
1.0 1.6 6.9
100 77 23
Y.-F. Cheng et al. / Enzyme and Microbial Technology 37 (2005) 541–546
545
for 3 h (Fig. 4). It is apparent that the properties of purified xylanase from P. pastoris transformant are similar to that of xylanase from T. fusca NTU22.
4. Discussion
Fig. 3. SDS-PAGE of the purified xylanase from P. pastoris transformant. Lane M: low molecular mass standard protein: phosphorylase b (94 kDa), bovine serum albumin (67 kDa), ovalbumin (43 kDa), carbonic anhydrase (30 kDa), trypsin inhibitor (20 kDa) and ␣-lacalbumin (14 kDa). Lane 1: the purified xylanase deglycosylated with Endo H. Lane 2: the purified xylanase from Sepharose CL-6B column chromatography. Lane 3: crude culture supernatant. Electrophoresis conditions: 150 V, 1 h.
masses close to 43 kDa (Fig. 3). After treated with endo--Nacetylglycosaminidase H to remove carbohydrate moieties, only a single band located at about 36 kDa was obtained. It was identical to the calculate molecular mass based on the amino acid base composition of the xyl11 gene inserted into the P. pastoris transformant. The optimal pH and temperature of the purified xylanase were 7.0 and 70 ◦ C, respectively. The purified enzyme was stable at 60 ◦ C for 3 h. About 70% of the original activity remained after heat treatment at 70 ◦ C
Fig. 4. Thermal stability of the xylanases from T. fusca NTU22 and the P. pastoris transformant. The enzyme was incubated at various temperatures for 30–180 min, and residual enzyme activity was determined. T. fusca NTU22: (䊉) 60 ◦ C, () 70 ◦ C, () 80 ◦ C; P. pastoris transformant: () 60 ◦ C, () 70 ◦ C, ( ) 80 ◦ C.
We are interested in the production of lignocellulolytic enzyme from local thermophilic actinomycetes to explore their use in novel biotechnological applications. By using bagasse as carbon source, ligonocellulolytic enzymes such as xylanases, cellulases, esterases and peroxidases were simultaneously accumulated in the culture broth of T. fusca NTU22 [26]. For several years, a number of xylanase-producing microorganisms including fungi, yeasts and bacteria have been reported. It was reported that the xylanase gene (xynA) from T. fusca YX could be expressed in E. coli and S. lividans. The xylanase activity produced by S. lividans transformants was 10- to 20-fold higher than that produced by E. coli transformants but only one-fourth the level produced by induced T. fusca YX [22]. As shown in Fig. 2, the maximum xylanase activity of P. pastoris transformant was about 324.2 U/mL in the culture broth after 144 h of methanol induction. The xylanase productivity of P. pastoris transformant was thus about 67-fold higher than that of T. fusca NTU22. It is apparent that the expression system of P. pastoris would seem to be superior to those of S. lividans and E. coli. In addition, the amount of extracellular proteins in the culture of the P. pastoris transformant was fewer than that in the culture of T. fusca NTU22. This will facilitate the application of xylanase in an industrial process immediately without complicated purification procedures [31]. As shown in Fig. 1, the xylanase gene (xyl11) from T. fusca NTU22 consisted of 1014 base pairs. The nucleotide sequence of xyl11 is 99.7% identical to the xynA from T. fusca YX. One mismatched amino acid occurs between xyl11 and xynA and this is the replacement with aspartate of a glycine at the 234th amino acid. The xynA was reported to comprise an open reading frame coding 32 kDa mature protein preceded by a leader sequence (42-aa). The mature protein of xynA can be divided into three domains: the catalytic domain (189-aa), the linker region (21-aa), and the binding domain (86-aa) [32]. We concluded that the xylanase gene (xyl11) encodes a 36 kDa protein including a leader sequence (42-aa) and mature protein (296-aa). The only mismatch in the amino acid sequence between xyl11 and xynA was located in the linker region, and this should result in no obvious effect on the catalytic and binding properties of xylanase. SDS-PAGE of the purified xylanase from P. pastoris transformant showed at least three forms of xylanase. However, only one single 36 kDa protein was obtained after being treated with endo--N-acetylglycosaminidase H to remove carbohydrate moieties (Fig. 3). These results revealed that various degrees of glycosylation occurred during the expression of xylanase in P. pastoris transformant. However, the
546
Y.-F. Cheng et al. / Enzyme and Microbial Technology 37 (2005) 541–546
properties of xylanase from T. fusca NTU22 were not greatly changed by the glycosylation in P. pastoris (Fig. 4). Acknowledgement Financial support for this study from the National Science Council of the Republic of China (NSC92-2313-B-002-112) is gratefully acknowledged. References [1] Biely P. Microbial xylanolytic systems. Trends Biotechnol 1985;3: 286–90. [2] Beg QK, Kapoor M, Mahajan L, Hoondal GS. Microbial xylanases and their industrial applications: a review. Appl Microbiol Biotechnol 2001;56:326–38. [3] Subramaniyan S, Prema P. Bio/Technology of microbial xylanases: enzymology, molecular biology, and application. Crit Rev Biotechnol 2002;22:33–64. [4] Coughlan MP, Hazlewood GP. -1,4-Xylan degrading enzyme systems: biochemistry, molecular biology and application. Biotechnol Appl Biochem 1993;17:259–89. [5] Viikari L, Kantelinen A, Sundquist J, Linko M. Xylanases in bleaching: from an idea to the industry. FEMS Microbiol Rev 1994;13:335–50. [6] Techapun C, Poosaran N, Watanabe M, Sasaki K. Thermostable and alkaline-tolerant microbial cellulose-free xylanases produced from agricultural wastes and the properties required for use in pulp bleaching bioprocesses: a review. Process Biochem 2003;38:1327–40. [7] Bataillon M, Cardinali APN, Castillon N, Duchiron F. Purification and characterization of a moderately thermostable xylanase from Bacillus sp. Strain SPS-0. Enzyme Microb Technol 2000;26:187–92. [8] Duillon A, Gupta JK, Khanna S. Enhanced production, purification and characterization of a novel cellulase-poor thermostable, alkalitolerant xylanase from Bacillus circulans AB16. Process Biochem 2000;35:849–56. [9] Tseng M, Yap M, Ratanakanokchai K, Kyu KL, Chen S. Purification and characterization of two cellulose-free xylanase from an alkalophilic Bacillus firmus. Enzyme Microb Technol 2002;30:590–5. [10] Rani DS, Nand K. Production of thermostable cellulose-free xylanase by Clostridium absonum CFR-702. Process Biochem 2000;36:355–62. [11] McCarthy AJ, Peace E, Broda P. Studies on the extracellular xylanase activity of some thermophilic actinomycetes. Appl Microbiol Biotechnol 1985;21:238–44. [12] Blanco J, Coque JJR, Velasco J, Martin JF. Cloning expression in Streptomyces lividans and biochemical characterization of a thermostable endo--1,4-d-xylanase of Thermomonospora alba ULJB1 with cellulose-binding ability. Appl Microbiol Biotechnol 1997;48:208–17. [13] George SP, Ahmad A, Rao MB. A novel thermostable xylanase from Thermomonospora sp.: influence of additives on thermostability. Bioresource Technol 2001;78:221–4. [14] Tuncer M, Ball AS. Degradation of lignocellulose by extracellular enzymes produced by Thermomonospora fusca BD25. Appl Microbiol Biotechnol 2002;58:608–11.
[15] Christoph W, Wolfgang L. Two extremely thermostable xylanase of the hyperthermophilic bacterium Thermotoga maritima MSB8. Appl Environ Microbiol 1995;61:1810–5. [16] Antonopoulos VT, Hernandez M, Arias ME, Mavrakos E, Ball AS. The use of extracellular enzyme from Streptomyces albus ATCC3005 for the bleaching of eucalyptus kraft pulp. Appl Microbiol Biotechnol 2001;54:92–7. [17] Techapun C, Chareonrat T, Watanabe M, Poosaran N, Sasaki K. Thermostable and alkaline-tolerant cellulase-free xylanases produced from thermotolerant Streptomyces sp. Ab106. J Biosci Bioeng 2002;93:431–3. [18] Khanna P, Sundari SS, Kumar NJ. Production, isolation and partial purification of xylanase from an Aspergillus sp. World J Microbiol Biotechnol 1995;11:242–3. [19] Christov LP, Szakacs G, Balakrishnan H. Production partial characterization and use of fungal cellulase-free xylanases in pulp bleaching. Process Biochem 1999;64:511–7. [20] Poutanen K, Puls J. Characterization of Trichoderma reesei xylosidase and its use in the hydrolysis of solubilized xylans. Appl Microbiol Biotechnol 1988;28:425–32. [21] Singh S, Reddy P, Haarhoff J, Biely P, Janse B, Pillay B, et al. Relatedness of Thermomyces lanuginosus strains producing a thermostable xylanase. J Biotechnol 2000;81:119–28. [22] Ghangas GS, Hu YJ, Wilson DB. Cloning of a Thermomonospora fusca xylanase gene and its expression in Escherichia coli and Streptomyces lividans. J Bacteriol 1989;171:2963–9. [23] Zamost BL, Nielsen HK, Starnes RL. Thermostable enzymes for industrial application. J Ind Microbiol 1991;8:71–82. [24] Cereghino JL, Cregg JM. Heterologous protein expression in the methylotrophic yeast Pichia pastoris. FEMS Microbiol Rev 2000;24:45–66. [25] Cereghino GPL, Cereghino JL, Llgen C, Cregg JM. Production of recombinant proteins in fermenter cultures of the yeast Pichia pastoris. Curr Opin Biotechnol 2002;13:329–32. [26] Liu WH, Yang CH. The isolation and identification of a lignocellulollyltic and thermophilic actinomycete. Food Sci Agric Chem 2002;4:89–94. [27] Hopwood DA, Bibb MJ, Chater KF, Kieser T, Bruton CJ, Kieser HM, et al. Preparation of chromosomal, plasmid and phage DNA. In: Genetic manipulation of streptomyces: a laboratory manual. Norwich, UK: John Innes Foundation; 1985. p. 70– 102. [28] Higgins DR, Busser K, Comiskey J, Whittier PS, Purcell TJ, Hoeffler JP. Small vectors for expression based on dominant drug resistance with direct multicopy selection. In: Higgins DR, Cregg JM, editors. Methods in molecular biology: pichia protocols. Totowa, New Jersey: Humana press; 1998. p. 28–41. [29] Reddy ST, Kumar SN, Haas AL, Dahms NM. Biochemical and functional properties of the full-length cation-dependent mannose 6phosphate receptor expressed in Pichia pastoris. Biochem Biophys Res Commun 2003;309:643–51. [30] Miller GL. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Anal Chem 1959;31:426–8. [31] Damaso MCT, Almeida MS, Kurtenbach E, Martins Jr OB, Andrade CMMC NP, Albano RM. Optimized expression of a thermostable xylanase from Thermomyces lanuginosus in Pichia pastoris. Appl Environ Microbiol 2003;69:6064–72. [32] Irwin D, Jung ED, Wilson DB. Characterization and sequence of a Thermomonospora fusca xylanase. Appl Environ Microbiol 1994;60:763–70.