Aqueous extract of Codium fragile suppressed inflammatory responses in lipopolysaccharide-stimulated RAW264.7 cells and carrageenan-induced rats

Biomedicine & Pharmacotherapy 93 (2017) 1055–1064

Available online at

ScienceDirect www.sciencedirect.com

Aqueous extract of Codium fragile suppressed inflammatory responses in lipopolysaccharide-stimulated RAW264.7 cells and carrageenan-induced rats Seul Ah Leea,1, Sung-Min Moonb,1, Yun Hee Choia , Seul Hee Hanb , Bo-Ram Parkc , Mi Suk Choic , Jae-Sung Kimd, Yong Hwan Kime , Do Kyung Kimd, Chun Sung Kima,* a

Department of Oral Biochemistry, College of Dentistry, Chosun University, 375 Seosuk-dong, Dong-gu, Gwangju, 501-759, Republic of Korea CStech Research Institute, 38 Chumdanventuresoro, Gwangju, 61007, Republic of Korea c Department of Dental Hygiene, Chodang University, Muan-ro, Muan-eup, Muan, 534-701, Republic of Korea d Oral Biology Research Institute, College of Dentistry, Chosun University, 375 Seosuk-dong, Dong-gu, Gwangju, 501-759, Republic of Korea e Department of Crop Science and Biotechnology, College of Life and Resource Science, 119 Dandae-ro, Dongnam-gu, Cheonan, Chungnam, 31116, Republic of Korea b

A R T I C L E I N F O

Article history: Received 8 May 2017 Received in revised form 28 June 2017 Accepted 6 July 2017

Keywords: Anti-inflammation Codium fragile NF-kB MAPKs Carrageenan-induced paw edema

A B S T R A C T

Codium fragile (Suringar) Hariot has been used in Oriental medicine for the treatment of enterobiasis, dropsy, and dysuria and has been shown to have various biological effects. In this study, we evaluated the anti-inflammatory effects of aqueous extract of C. fragile (AECF) using in vitro and in vivo models. Nitric oxide (NO), prostaglandin E2 (PGE2), inflammatory-related mRNAs, and proteins were determined using the Griess assay, enzyme-linked immunosorbent assay (ELISA), reverse transcription-polymerase chain reaction (RT-PCR), and western blotting, respectively. Our results indicate that pretreatment of cells with AECF (50, 100 and 200 mg/mL) significantly inhibited LPS-induced secretion of NO and PGE2 in RAW264.7 cells without cytotoxicity. We also found that AECF (100 and 200 mg/mL) inhibited LPS-induced inducible NO synthase (iNOS) and cyclooxygenase (COX)-2 expression in a dose-dependent manner. Additionally, pretreatment of cells with AECF (100 and 200 mg/mL) inhibited LPS-induced production of inflammatory cytokines including tumor necrosis factor (TNF)-a, interleukin (IL)-1b, and IL-6. It also prevented the nuclear translocation of nuclear factor (NF)-kB by suppressing the phosphorylation and degradation of inhibitor of NF-kB (IkB)-a. Furthermore, AECF (100 and 200 mg/mL) inhibited the phosphorylation of the mitogen-activated protein kinases (MAPKs) extracellular signal-regulated kinase (ERK) 1/2, c-Jun Nterminal kinase (JNK), and p38. In addition, orally administered 50, 100, and 200 mg/kg body weight of AECF dose-dependently suppressed carrageenan-induced rat paw edema thickness by 6%, 31%, and 50% respectively, after 4 h. Furthermore, the anti-inflammatory effect was comparable to that observed in animals treated with the standard drug diclofenac sodium (56%) in vivo. Collectively, our results suggest that AECF exerts potential anti-inflammatory effects by suppressing NF-kB activation and MAPKs pathways in vitro, as well as inhibiting carrageenan-induced rat paw edema thickness in vivo. These findings indicate that AECF could be further developed as an anti-inflammatory drug. © 2017 Elsevier Masson SAS. All rights reserved.

1. Introduction Green seaweeds are well-known to contain a wide range of natural products with pharmacological activities [1,2]. Sulfated polysaccharides (SPs) derived from green seaweeds have shown

* Corresponding author. E-mail address: [email protected] (C.S. Kim). These authors contributed equally to this study.

1

http://dx.doi.org/10.1016/j.biopha.2017.07.026 0753-3322/© 2017 Elsevier Masson SAS. All rights reserved.

great potential for the development of anti-inflammatory and antinociceptive drugs [3,4]. Codium fragile (Suringar) Hariot is an edible green seaweed that belongs to the Codiaceae family and is widely distributed along the shores of water bodies in East Asia, Oceania, and Northern Europe. In Korea, C. fragile is one of the most popular seaweeds used as a culinary ingredient and has been used in Oriental medicine for the treatment of enterobiasis, dropsy, and dysuria [5]. Currently, few studies have reported the numerous health benefits of C. fragile extracts including anticancer, antiangiogenic, and antioxidant properties [6–8]. Khan et al. [9]

1056

S.A. Lee et al. / Biomedicine & Pharmacotherapy 93 (2017) 1055–1064

reported that methanol extracts of various seaweed species including C. fragile inhibited mouse ear edema and erythema in vivo. In addition, ethanol or methanol extracts of C. fragile showed anti-inflammatory effects by inhibiting nuclear factor (NF)-kB activation in RAW264.7 cells without cytotoxicity [10,11]. Although some effects of C. fragile methanol or ethanol extracts have been reported, little is known about the molecular mechanisms of the anti-inflammatory effect of aqueous extracts of C. fragile (AECF). Therefore, we hypothesized that not only methanol or ethanol extracts of C. fragile, but also aqueous extracts of C. fragile may be effective in relieving inflammation. Inflammation is the first complex biological response of the immune system to exogenous pathogens, injury, and infection following exposure to biological, chemical, or physical stimuli [12]. Although inflammation is required by the body to combat bacterial and viral infections, excessive or prolonged inflammation is involved in the pathogenesis of chronic diseases such as inflammatory arthritis, atherosclerosis, and asthma [13,14]. Inflammatory processes are characterized by the recruitment of leukocytes and macrophages. Lipopolysaccharides (LPS) rapidly activate macrophages to stimulate the production pro-inflammatory cytokines such as interleukin (IL)-1b, IL-6, and tumor necrosis factor (TNF)-a, as well as inflammatory mediators such as nitric oxide (NO) and prostaglandin E2 (PGE2), produced by iNOS and COX-2, respectively. In particular, the enzyme cyclooxygenase (COX)-2 is crucial in the inflammatory response. Under normal physiological conditions, the COX-2 level is low, although it can rapidly increase in macrophages in response to factors such as LPS, pro-inflammatory cytokines, and growth factors [15,16]. The expression of these inflammatory mediators is induced by NF-kB and mitogenactivated protein kinases (MAPKs), which mediate the important molecular mechanisms of anti-inflammatory effects [17–19]. Several studies have reported that numerous substances exert anti-inflammatory effects by inhibiting the NF-kB and MAPK pathways [15,20,21]. NF-kB is a positive regulator of COX-2 expression in response to the secretion of diverse inflammatory cytokines. Under physiological conditions, NF-kB is localized in the cytoplasm as a heterodimer composed of Rel A (p65) and NF-kB1 (p50) in an inactive form through a linkage to the inhibitor of NF-kB (IkB) [22,23]. However, during inflammation, NF-kB is activated by the phosphorylation and subsequent degradation of IkB, followed by the rapid translocation of the NF-kB heterodimer into the nucleus, where it activates the expression of various genes related to the inflammatory response, such as iNOS, COX-2, and TNF-a [23]. The MAPK pathway is well known to regulate the conversion of numerous extracellular stimuli into specific cellular responses such as cell proliferation, differentiation, and survival [24,25]. The MAPK family, including extracellular signal-regulated kinase (ERK)-1/2, c-Jun N-terminal kinase (JNK), and p38, are activated by inflammatory cytokines, cellular stress, reactive oxygen species (ROS), and ultraviolet (UV) radiation [24,26]. Activation of the ERK, JNK, and p38 MAPK signaling cascades coordinates phosphorylation events that activate transcription factors such as activator protein (AP)-1 (cFos/cJun), Runt-related transcription factor (RUNX)-2, hypoxia inducible factor (HIF)-2a, and CCAAT-enhancer-binding protein (C/EBP)-b, which together with NF-kB, regulate the expression of genes involved in catabolic and inflammatory events [24,27]. Several studies have demonstrated the crucial role of MAPKs in NF-kB activation [19–21]. Therefore, the blockade of these pathways can effectively reduce the development of diseases resulting from chronic inflammation. In the present study, we investigated the anti-inflammatory effects of AECF in vitro and in vivo, and the underlying mechanisms of action. Our results suggest that AECF inhibits the production of pro-inflammatory cytokines and mediators by suppressing NF-kB

activity and MAPK phosphorylation in LPS-stimulated RAW264.7 macrophages. Additionally, orally administered AECF inhibited paw edema thickness in a rat model of carrageenan-induced paw edema. 2. Materials and methods 2.1. Preparation of AECF Fresh C. fragile (Suringar) Hariot (30 kg) was collected along the coast of Wando, Korea, in June 2016, washed thrice with tap water to remove the salt residue, epiphytes, and sand attached to the surface, and then dried using an air dryer at 50
C for 48 h (0.92 kg). The dried sample was homogenized using a grinder, extracted with 10 vol of distilled water at 95
C for 1 h, followed by centrifugation at 10,000g, and the resulting supernatant was evaporated and lyophilized (75.5 g, yield 8.2%) [28,29]. The dry extract powder was dissolved in distilled water (100 mg/mL), and the resulting solution was filtered using a 0.2-mm syringe filter before use. 2.2. Reagents LPS, 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT), sulfanilamide, N-(1-naphthyl) ethylenediamine dihydrochloride, and phosphoric acid were purchased form SigmaAldrich Corp., (St. Louis, MO, USA). Dulbecco’s modified Eagle’s medium (DMEM) and penicillin-streptomycin solution were purchased from WelGene (Daegu, Republic of Korea). Fetal bovine serum (FBS) was purchased from Corning (Corning, NY, USA). Primary and secondary antibodies were purchased from Cell Signaling Technology (Danvers, MA, USA), except for the anti-iNOS (Abcam, Cambridge, MA, USA). 2.3. Cell culture and viability assay Murine macrophage RAW264.7 cells were obtained from Korea Research Institute of Bioscience and Biotechnology (KRIBB, Daejeon, Republic of Korea) and cultured at 37
C under 5% CO2humidified incubator in Dulbecco’s Modified Eagle’s medium (DMEM) containing 10% FBS and 1% penicillin/streptomycin. For the cell viability analysis, cells were seeded at 1 106 cells/mL, incubated for 6 h, and then treated with varying concentrations of AECF (50, 100, 200, 300, and 500 mg/mL) for 24 h. Following incubation, the cell viability was determined using the MTT assay. 2.4. Measurement of nitrite and PGE2 RAW264.7 cells were seeded at 1 106 cells/mL in 12-well plates, pretreated with varying concentrations of AECF (50, 100, 200, and 300 mg/mL) for 1 h, and then subsequently cultured with LPS (0.2 mg/mL) for 24 h. For measure the nitrite concentration, 100 mL of each supernatant from the AECF-treated cells was mixed with an equal volume of Griess reagent (1% [w/v] sulfanilamide in 5% [v/v] phosphoric acid and 0.1% [w/v] naphthylethylenediamine) in a dark room for 10 min. The absorbance was then measured at 540 nm using a microplate reader (Epoch Bioteck, Bio-Tek Instruments Inc., Winooski, VT, USA). The nitrite concentration was determined by comparison to a standard curve of sodium nitrite. The production of PGE2 was measured using a ParameterTM prostaglandin E2 assay kit (R&D Systems, Minneapolis, MN, USA). 2.5. Isolation of total RNA and reverse transcription-polymerase chain reaction (RT-PCR) Total RNA was isolated from RAW264.7 cells using Trizol reagent (Invitrogen, Carlsbad, CA, USA). The cDNA was synthesized

S.A. Lee et al. / Biomedicine & Pharmacotherapy 93 (2017) 1055–1064

from 1 mg total RNA using the PrimeScriptTM first strand cDNA synthesis kit (Takara Bio Inc., Otsu, Japan). The cDNA was amplified using polymerase chain reaction (PCR) with the following primers: mouse TNF-a (283 bp), sense 50 - TGGAACTGGCAGAAGAGGCA 30 and antisense 50 -TGCTCCTCCACTTGGTGGTT-30 ; mouse IL-1b (352 bp), sense 50 -GGCAGGCAGTATCACTCATT-30 and antisense 50 -CCCAAGGCCACAGGTATTT-30 ; mouse IL-6 (359 bp), sense 50 TGCAAGAGACTTCCATCCAGTTGC-30 and antisense 50 -CCAGGTAGCTATGGTACTCCAG-30 ; mouse iNOS (732 bp), sense 50 -TTGTGCATCG ACCTAGGCTGGAA-30 and antisense 50 -GACCTTTCGCATTAGCAT GGAAGC-30 ; mouse COX-2 (395 bp), sense 50 -GTACTGGCTCATGCT GGACGA-30 and antisense 50 -CACCATACACTGCCAGGTCAGCAA-30 ; and glyceraldehyde 3-phosphate dehydrogenase (GAPDH, 382 bp), sense 50 -GGACTGTGGTCATGAGCCCTTCCA-30 and antisense 50 -ACT CACGGCAAATTCAACGGCAC-30 . The PCR results were visualized using agarose gel electrophoresis. The samples represent mean data and deviations of three independent experiments. GAPDH was used as an internal control to evaluate the relative expression of TNF-a, IL-1b, IL-6, iNOS, and COX-2. 2.6. Preparation of nuclear and cytosolic extracts RAW264.7 cells were pretreated with AECF for 1 h and subsequently cultured with LPS (0.2 mg/mL) for 24 h. The cells were harvested, washed twice with cold phosphate-buffered saline (PBS), and lysed using NEPERTM nuclear and cytoplasmic extraction reagent kits (Thermo Scientific, IL, USA) according to the manufacturer's instructions. Briefly, cells were resuspended in the reagent and centrifuged at 15,000 rpm for 5 min at 4
C, and the supernatant containing the cytosolic fraction was transferred to a clean tube. Subsequently, the nuclear pellet was washed to remove any contaminating cytoplasmic membranes, gently resuspended with NER reagent, and centrifuged at 15,000 rpm for 10 min at 4
C. The supernatant constituted the nuclear fraction. Protein concentrations in each extract were quantified using a bicinchoninic acid (BCA) protein assay kit (Pierce, Thermo Scientific, IL, USA). 2.7. Western blot analysis The cells were lysed with protein extraction reagent (iNtRON Biotechnology, Korea) for 30 min on ice. The supernatant was transferred to a new tube after centrifugation at 12,000 rpm for 15 min at 4
C (Sorvall centrifuge, Bad Homburg, Germany). Protein concentrations were quantified using the BCA protein assay (Pierce, Rockford, IL, USA) with bovine serum albumin (BSA) as a standard. Approximately 30 mg of protein from each lysate was solubilized in Laemmli sample buffer and loaded onto 3–8% or 4–20% gradient gels (Invitrogen Life Technologies). The proteins were separated using electrophoresis at 120 V for 90 min, and then they were transferred onto a polyvinylidene difluoride nanofiber membrane (Amomedi, Gwangju, Korea). Membranes were blocked for 1 h with 5% BSA at room temperature, followed by overnight incubation with primary antibodies against anti-TNF-a, anti- IL-1 b, antiIL-6, anti-iNOS, anti-COX-2, anti-total MAPKs, anti-phosphoMAPKs (all from Cell Signaling Technology, Danvers, MA, USA), and anti-b-actin (sc-47778, Santa Cruz Biotechnology, Santa Cruz, CA, USA). After washing thrice with Tris-buffered saline plus Tween (TBS-T, 0.1% Tween-20, 50 mM Tris-HCl pH 7.5, 150 mM NaCl), membranes were incubated for 1 h with secondary antibodies and washed thrice with TBS-T. Next, the proteins were detected using the WestSave Up enhanced chemiluminescence (ECL) kit (AB Frontier, Seoul, Korea) and visualized using a MicroChemi 4.2 device (DNR Bioimaging Systems, Jerusalem, Israel).

1057

2.8. Animals Male Sprague-Dawley rats (300–330 g, 10-week-old) were purchased from Damoolscience (Daejeon, Korea). They were maintained in plastic cages under controlled temperature (21 1
C), humidity (55  5%), and a reversed 12-h light-dark cycle and were supplied rat pellets and water ad libitum. The rats were acclimatized for 1 week before the experiment. All animal experimental procedures and animal handling were performed in accordance with the National Institutes of Health (NIH) Guide for the Care and Use of Laboratory Animals [30]. The experimental protocols were approved by the Chosun University Institutional Animal Care and Use Committee (CIACUC2017A0011). 2.9. Carrageenan-induced paw edema in rats The anti-inflammatory effects of AECF were investigated in a carrageenan-induced rat paw edema model using the protocol described by Omowumi et al. [31]. The animals (n = 24) were randomly divided into the following six groups of four rats each and treated as indicated: Group 1 (normal, 0.9% normal saline), Group 2 (paw edema, 0.9% normal saline), Groups 3–5 (paw edema, 50, 100, and 200 mg/kg AECF, respectively), and Group 6 (paw edema, 10 mg/kg diclofenac sodium). Rat paw edema was induced by subcutaneously injecting 1% (w/v) carrageenan suspension in 0.9% normal saline into the left hind paw of each rat. Different doses of AECF and diclofenac sodium were administered 60 min prior to the carrageenan injection. The thickness of the middle of each paw was measured using a digital caliper before (time 0) and after the carrageenan injection for 24 h. The percentage antiinflammatory activity (AA%) was calculated using the following formula [31]: AAð%Þ ¼

ðCt  C0Þcontrol  ðCt  C0Þtreated  100 ðCt  C0Þcontrol

Where, Ct = left hind paw thickness (mm) at time t. C0 = left hind paw thickness (mm) before carrageenan injection. (Ct-C0)control = increase in rat paw size after carrageenan injection at time t. (Ct-C0)treated = increase in paw size after carrageenan injection in reference or test drug-treated rats at time t. 2.10. Statistical analysis The results were expressed as the means  standard deviation (SD). A one-way analysis of variance (ANOVA), followed by Dunnett's test was used for multiple comparisons using the GraphPad Prism (GraphPad Software Inc., CA, USA). Statistical significance was set at # p < 0.05 vs. negative group, *p < 0.05, **p < 0.01, and ***p < 0.001 vs. LPS-group 3. Results 3.1. Effect of AECF on viability of RAW264.7 cells To evaluate the cytotoxicity of AECF, its effect on the viability of RAW264.7 cells was determined using an MTT assay after treatment with varying concentrations (0, 50, 100, 200, 300, and 500 mg/mL) for 24 h. As shown in Fig. 1, AECF at 50, 100, 200, and 300 mg/mL was not cytotoxic. However, the highest dose (500 mg/ mL) decreased the cell viability by approximately 40%. In all subsequent experiments, the RAW264.7 cells were treated with AECF at 300 mg/mL to avoid cytotoxicity.

1058

S.A. Lee et al. / Biomedicine & Pharmacotherapy 93 (2017) 1055–1064

Fig. 1. Effect of aqueous extract of Codium fragile (AECF) on RAW264.7 cell viability. Cells were treated with various concentration of AECF (50, 100, 200, 300, 500 mg/mL) for 24 h. Cell viability was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide MTT assay. Results were expressed as a percentage of the control. Data are means  SD of three independent experiments; **p < 0.01 compared to the control group.

3.2. Inhibitory effect of AECF on LPS-induced NO production and expression of iNOS in RAW264.7 cells To evaluate the potential anti-inflammatory effects of AECF on LPS-induced NO production and iNOS expression in RAW264.7 cells, we examined whether AECF regulates NO production and iNOS gene expression using RT-PCR and western blot analysis. The cells were pretreated with 0–300 mg/mL AECF for 1 h and treated with LPS (0.2 mg/mL) for 24 h. NO production in the culture supernatants was measured using the Griess reagent. LPS (0.2 mg/ mL) was found to significantly increase NO production by 27-fold (27.94  0.48 mM) compared with that of the control (0.599  0.495 mM, Fig. 2A). Moreover, LPS (0.2 mg/mL) alone significantly increased both the mRNA and protein expression levels of iNOS. However, as shown in Fig. 2B and D, iNOS mRNA levels were inhibited by 36% and 73% following pretreatment with 100 and 200 mg/mL AECF, respectively compared with LPS treatment alone. Additionally, the protein expression of LPSinduced iNOS significantly reduced after pretreatment with AECF 100 and 200 mg/mL by approximately 45% and 50%, respectively, compared with LPS alone (Fig. 2C and E). The results of the densitometric analysis demonstrated that AECF inhibited the mRNA and protein expression of iNOS in a dose-dependent manner (Fig. 2). Taken together, these data suggest that AECF treatment inhibited the mRNA and protein expression of iNOS, which regulates the production of NO and mediates the LPS, induced inflammatory response in RAW264.7 cells. 3.3. Inhibitory effect of AECF on LPS-induced PGE2 production via suppression of COX-2 gene expression in RAW264.7 cells PGE2 (produced by COX-2) is one of the key pro-inflammatory mediators of inflammation-related diseases. The quantitative analysis of PGE2 using ELISA showed that LPS treatment of RAW264.7 cells promoted the generation and release of PGE2 into the supernatant. Pretreatment with AECF for 1 h significantly inhibited LPS-induced PGE2 production in a dose-dependent manner (Fig. 3A). To understand the inhibitory effect of AECF on LPS-induced PGE2, we evaluated the mRNA and protein expression levels of COX-2 using RT-PCR and western blot analysis. LPS (0.2 mg/mL) alone significantly increased both the mRNA and protein expression of COX-2 (Fig. 3 B and C). However, pretreatment with AECF for 1 h reduced the mRNA levels of LPS-induced COX-2 in a dose-dependent manner (Fig. 3B and D). In particular, COX-2 mRNA levels were strongly inhibited by 65% in response to treatment with 200 mg/mL AECF compared with LPS alone (Fig. 3B and D). In addition, the COX-2 protein expression level was inhibited by 48% and 44% following exposure of cells to 100 and

200 mg/mL AECF, respectively (Fig. 3C and E). The results of the densitometric analysis demonstrated that the mRNA and protein expression levels of COX-2 were inhibited by AECF in a dosedependent manner (Fig. 3B and C). Taken together, these data suggest that AECF treatment inhibited the mRNA and protein expression of COX-2, which generates PGE2 that functions as a key mediator of inflammation in LPS-induced RAW264.7 cells. 3.4. Inhibitory effect of AECF on LPS-induced pro-inflammatory cytokines in RAW264.7 cells Because AECF was found to inhibit NO and PGE2, we investigated its effects on the expression of pro-inflammatory cytokines known to play important roles in immune responses to various inflammatory stimuli. RAW264.7 cells were pretreated with AECF for 1 h before stimulation with LPS (0.2 mg/mL) for 24 h. LPS stimulation alone markedly increased the mRNA and protein levels of TNF-a, IL-1b, and IL-6 compared with those of the control (Fig. 4). However, pretreatment with 100 mg/mL AECF inhibited mRNA expression of TNF-a, IL-1b, and IL-6 by 10%, 37%, and 26%, respectively, while the corresponding values at 200 mg/mL were 38%, 67% and 64%, respectively (Fig. 4A–D). Under the same conditions, AECF treatment also significantly inhibited the protein levels of TNF-a, IL-1b, and IL-6 in a dose-dependent manner compared to treatment with LPS alone (Fig. 4E–H). The suppression of TNF-a, IL-1b, and IL-6 production was not found to be due to cytotoxicity (Fig. 1). Therefore, these results indicate that AECF significantly suppressed LPS-induced TNF-a, IL-1b, and IL-6 production. 3.5. Suppression of MAPKs/NF-kB signaling pathway by AECF in LPSinduced RAW 264.7 cells NF-kB is a crucial transcription factor that controls LPS-induced gene expression of pro-inflammatory cytokines such as iNOS, COX2, and TNF-a. To assess NF-kB activity, we investigated the effect of AECF on LPS-induced nuclear translocation of the p65 NF-kB subunit and IkB-a phosphorylation and degradation by performing a western blot analysis. As shown in Fig. 5A, IkB-a was phosphorylated and degraded after treatment with LPS at 0.2 mg/mL for 12 h. However, pretreatment with AECF for 1 h significantly reduced the LPS-induced phosphorylation and degradation of IkB-a in RAW264.7 cells (Fig. 5A and B). To confirm this, we further assessed the nuclear translocation of p65, a component of NF-kB. LPS-stimulation for 12 h significantly increased the translocation of p65 from the cytosol to the nucleus (Fig. 5C–E). However, pretreatment with AECF for 1 h suppressed the nuclear translocation of p65 by approximately two-fold at

S.A. Lee et al. / Biomedicine & Pharmacotherapy 93 (2017) 1055–1064

1059

Fig. 2. Inhibitory effects of aqueous extract of Codium fragile (AECF) on lipopolysaccharide (LPS)-induced nitric oxide (NO) and inducible NO synthase (iNOS) levels in RAW264.7 cells. (A) AECF inhibited LPS-induced NO levels in RAW264.7 cells. Cells were pretreated with AECF (50, 100, 200, and 300 mg/mL) for 1 h, followed by LPS (0.2 mg/ mL) stimulation for 24 h. NO production in the cell culture supernatant was determined using Griess reagent after 24 h. (B and C) AECF inhibited LPS-induced mRNA and protein level of iNOS in RAW264.7 cells. Cells were pretreated with AECF (100 and 200 mg/mL) for 1 h, followed by LPS (0.2 mg/mL) stimulation for 24 h. The expression of iNOS mRNA and protein was determined using reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and b-actin served as internal controls. (D and E) Quantitative data of (B and C) were analyzed using ImageJ software. Data are means  SD of three independent experiments; # p < 0.05 compared to negative group, **p < 0.01 and ***p < compared to LPS-treated group.

200 mg/mL (Fig. 5C and D). These data suggest that AECF suppresses the NF-kB signaling pathway by preventing nuclear translocation of the p65 NF-kB subunits and inhibiting IkB-a phosphorylation and degradation (Fig. 5). Because the MAPKs are essential regulators of the inflammatory response, we evaluated the ability of AECF to stimulate LPS-induced phosphorylation of ERK1/2, JNK, and p38 MAPK in RAW264.7 cells (Fig. 6). The cells were pre-treated with AECF for 1 h and subsequently stimulated with LPS (0.2 mg/mL) for 12 h. As shown in Fig. 6, LPS stimulation alone significantly increased the phosphorylation of ERK1/2, JNK, and p38 MAPK when compared with the control levels. However, pretreatment with AECF at 100 mg/mL significantly inhibited the phosphorylation of ERK1/2, JNK, and p38 MAPK by 30%, 50%, and 50%, respectively (Fig. 6A–D). In addition, the total expression levels of the MAPK isoforms did not differ significantly between the groups. These data suggest that the AECF effectively inhibited MAPK phosphorylation during the LPS-induced inflammatory response.

3.6. Effects of AECF on carrageenan-induced rat paw edema To evaluate the anti-inflammatory effect of AECF in vivo, rats were injected with 1% carrageenan to induce edema in the left hind paw. The treatment groups were orally administered AECF (50, 100, and 200 mg/kg body weight) 60 min prior to carrageenan injection. The results shown in Fig. 7 reveal that the inhibition rate of carrageenan-induced paw edema thickness by AECF (50, 100 and 200 mg/kg) and diclofenac sodium (10 mg/kg) were significantly increased for 4 h after carrageenan injection (6%, 31%, 50% and 56%, respectively). The effect steadily increased for up to 24 h and the corresponding inhibition rates were 25%, 46%, 67%, and 75%, respectively. Additionally, the effect of AECF 200 mg/kg was comparable to that of diclofenac sodium (10 mg/kg), and the morphological characteristics are shown in Fig. 7. These results indicate that oral administration of 50, 100, and 200 mg/kg AECF significantly inhibited carrageenan-induced paw edema thickness

1060

S.A. Lee et al. / Biomedicine & Pharmacotherapy 93 (2017) 1055–1064

Fig. 3. Inhibitory effect of aqueous extract of Codium fragile (AECF) on lipopolysaccharide (LPS)-induced prostaglandin E2 (PGE2) and cyclooxygenase (COX)-2 levels in RAW264.7 cells. (A) AECF inhibited LPS-induced PGE2 in RAW264.7 cells. Cells were pretreated with AECF (50, 100, and 200 mg/mL) for 1 h, followed by LPS (0.2 mg/mL) stimulation for 24 h. PGE2 production in cell culture supernatant was determined using Griess reagent after 24 h. (B and C) AECF inhibited LPS-induced COX-2 mRNA and protein levels in RAW264.7 cells. Cells were pretreated with AECF (100 and 200 mg/mL) for 1 h, followed by LPS (0.2 mg/mL) stimulation for 24 h. Expression of COX-2 mRNA and protein were determined using reverse transcription-polymerase chain reaction (RT-PCR) and western blot analysis. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and b-actin served as internal controls. (D and E) Quantitative data of (B and C) were analyzed using ImageJ software. Data are means  SD of three independent experiments; # p < 0.05 compared to negative group, **p < 0.01 and ***p < 0.001 compared to LPS-treated group.

compared with that of the untreated paw edema group, in a doseand time-dependent manner. 4. Discussion C. fragile (Suringar) Hariot, a green seaweed from the Codiaceae family, is used in Oriental medicine to treat symptoms of edema, dysuria, and enteropathy [5]. C. fragile is also used as a culinary relish ingredient in East Asia. Recent studies have reported that the methanol extract of C. fragile (MECF) exhibits anti-edema effects in vivo and anti-allergic effects following degranulation of RBL-2H3 cells and mouse eosinophils [32]. Additionally, the ethanol extract of C. fragile exerts anti-inflammatory effects in LPS-stimulated RAW264.7 cells by modulating the NF-kB signaling pathway [10]. However, the anti-inflammatory effects of AECF were unknown. Therefore, we investigated the anti-inflammatory effects of AECF on LPS-stimulated mouse macrophages RAW264.7 and examined its potential mechanism of action. The results of the present study show that AECF suppressed the LPS-stimulated expression of

nitrite, iNOS, PGE2, COX-2, and pro-inflammatory cytokines by inhibiting NF-kB activity and suppressing the MAPK signaling pathway in RAW264.7 cells. Inflammation is the first defense response of the immune system against various external infections [12]. During inflammation, the production of the pro-inflammatory mediators NO and PGE2 is mediated by iNOS and COX-2, which is important in promoting anti-bacterial and anti-viral mechanisms [33,34]. However, excessive production of iNOS and COX-2 can lead to the development of severe inflammatory diseases [14,35]. As a result, inhibiting the expression of these pro-inflammatory mediators has been considered a potential strategy for the development of anti-inflammatory drugs and functional foods. To explore the potential anti-inflammatory effects of AECF, we first investigated its cytotoxicity on RAW264.7 cells. The results showed that AECF did not affect cell viability at concentrations below 300 mg/mL; therefore, all experiments were performed using this concentration. AECF inhibited the LPS-induced NO and PGE2 production by the suppression of iNOS and COX-2 protein and

S.A. Lee et al. / Biomedicine & Pharmacotherapy 93 (2017) 1055–1064

1061

Fig. 4. Inhibitory effect of aqueous extract of Codium fragile (AECF) on lipopolysaccharide (LPS)-induced pro-inflammatory cytokines in RAW 264.7 cells. (A and E) AECF inhibited LPS-induced tumor necrosis factor (TNF)-a, interleukin (IL)-1b, and IL-6 mRNA and protein levels in RAW264.7 cells. Cells were pretreated with AECF (100 and 200 mg/mL) for 1 h, followed by LPS (0.2 mg/mL) stimulation for 24 h. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and b-actin served as internal controls. (B-D, F, G, and H) Quantitative data of (A and E) were analyzed using ImageJ software. Data are means  SD of three independent experiments; # p < 0.05 compared to negative group, ***p < 0.001 compared to LPS-treated group.

Fig. 5. Effects of aqueous extract of Codium fragile (AECF) on lipopolysaccharide (LPS)-induced inhibitor of nuclear factor (NF)-kB (IkB)-a phosphorylation and activation of NF-kB nuclear translocation in RAW264.7 cells. (A) AECF inhibited LPS-induced phosphorylation of IkB-a. Protein levels of IkB-a and p-IkB-a were determined using western blotting. (B) Quantitative data of (A) was analyzed using ImageJ software. (C) AECF inhibited LPS-induced nuclear translocation of NF-kB. Cells were pretreated with AECF (100 and 200 mg/mL) for 1 h, followed by LPS (0.2 mg/mL) stimulation for 12 h. Expression levels of NF-kB (p65) in nuclear and cytosolic extracts were determined using western blotting. b-Actin and Lamin B1 were used as internal controls. (D and E) Quantitative data of (D) was analyzed using ImageJ software. Data are means  SD of three independent experiments; # p < 0.05 compared to negative group, **p < 0.01 and ***p < 0.001 compared to LPS-treated group.

mRNA expression in a dose-dependent manner. Pre-treatment with 200 mg/mL AECF also strongly repressed LPS-induced expression of the pro-inflammatory cytokines TNF-a, IL-1b, and IL-6 in macrophages. Similarly, ethanol extracts of C. fragile were previously reported to inhibit secretion of Nitrite, PGE2, TNF-a,

IL-b, and IL-6 in culture media of LPS-stimulated RAW264.7 cells dose-dependently (50, 100 and 200 mg/mL), and it did not show cytotoxicity up to 200 mg/mL [10]. On the other hand, methanol extracts of C. fragile (MECF) was reported to show cytotoxicity from 150 mg/mL, and Nitrite, PGE2 and TNF-a decreased at 75 mg/mL

1062

S.A. Lee et al. / Biomedicine & Pharmacotherapy 93 (2017) 1055–1064

Fig. 6. Effects of aqueous extract of Codium fragile (AECF) on lipopolysaccharide (LPS)-induced phosphorylation of extracellular signal-regulated kinase (ERK), c-Jun Nterminal kinase (JNK), p38 mitogen-activated protein kinase (MAPK) in RAW264.7 cells. (A) AECF inhibited LPS-induced phosphorylation of ERK, JNK, and p38 MAPKs. Cells were pretreated with AECF (100 and 200 mg/mL) for 1 h, followed by LPS (0.2 mg/mL) for 24 h. Total and phosphorylated ERK, JNK and p38 were determined using western blotting with specific antibodies. (B-D) Quantitative data of (A) was analyzed using ImageJ software. Data are means  SD of three independent experiments; # p < 0.05 compared to negative group, **p < 0.01 and ***p < 0.001 compared to LPS-treated group.

and 100 mg/mL dose-dependently in LPS-stimulated RAW264.7 cells [31]. In response to LPS, macrophages release TNF-a, which stimulates the release of other pro-inflammatory cytokines such as IL-1b and IL-6 [36]. IL-1b is a major pro-inflammatory cytokine that initiates and enhances the inflammatory response to microbial infection [37]. IL-6 is also crucially involved in the acute-phase of the immune response [38]. Our data suggest that the inhibitory activity of AECF against NO and COX-2 production is associated with the inhibition of iNOS and PGE2 and mediated by the production of pro-inflammatory cytokines. Thus, the obtained results support the hypothesis that AECF has anti-inflammatory activity. Specifically, Lee et al. [8] reported that the ethyl acetate fraction of the 80% methanol C. fragile extract and a single compound (CLS) exerted potential pro-inflammatory effects by suppressing the expression of COX-2, iNOS, and TNF-a in vivo [8]. Thus, further studies are needed to identify the major components that mediate the anti-inflammatory effects of AECF. To further verify the anti-inflammatory effect of AECF as a suppressor of inflammatory mediators and cytokines, we evaluated the activation of both the NF-kB and MAPK signaling pathways in LPS-stimulated macrophages. NF-kB is a well-known transcription factor that regulates the expression of numerous genes involved in immune response and inflammation such as iNOS, COX2, TNF-a, IL-1b, and IL-6 [23]. Therefore, targeting the downregulation of NF-kB could be considered a useful strategy for

treating inflammatory diseases. Activation of the NF-kB pathway by LPS induces IkB-a phosphorylation and degradation in the cytosol. This leads to the translocation of NF-kB to the nucleus, where it binds to target sites to induce the transcription of inflammatory cytokines and trigger the activation of inflammation-related enzymes [22,23,39]. Our results showed that pretreatment with AECF inhibited the translocation of NF-kB Rel A (p65) to the nucleus by suppressing IkB-a phosphorylation and degradation. These data show that the inhibitory effects of AECF on the production of inflammatory mediators and cytokines are mediated, at least in part, by the suppression of the NF-kB signaling pathway. Additionally, we investigated the effects of AECF on the activation of MAPKs including ERK1/2, JNK, and p38. The results show that pretreatment with AECF at 100 mg/mL significantly reduced the LPS-induced phosphorylation of ERK1/2, JNK, and p38. These data demonstrate that the phosphorylation of MAPKs was related to the anti-inflammatory effect of AECF on LPSstimulated RAW264.7 cells. Therefore, we suggest that the antiinflammation activity of AECF may be explained by the inhibition of the MAPK and NF-kB signaling pathways. Carrageenan is a strong stimulant that induces inflammatory and pro-inflammatory mediators. Carrageenan-induced inflammation in the rat paw is a classical model of edema and hyperalgesia [40,41]. Orally administered of 50, 100, and 200 mg/kg AECF inhibited carrageenan-induced paw thickness in a dose-dependent manner, and the effect at 200 mg/kg was

S.A. Lee et al. / Biomedicine & Pharmacotherapy 93 (2017) 1055–1064

1063

Fig. 7. Anti-inflammatory effects of aqueous extract of Codium fragile (AECF) on carrageenan-induced left hind paw edema. Rat paw edema was induced by subcutaneously injecting 1% carrageenan solution (100 mL/animal) into left hind paw, 1 h after oral administration of AECF (50, 100, and 200 mg/kg) or diclofenac (10 mg/kg). (A) Morphological characteristics of left hind paw of each rat 24 h after carrageenan injection. (B) Thickness of paw edema was measured for 24 h after carrageenan injection. Data are means  SD of four animals; *p < 0.05, **p < 0.01, and ***p < 0.001 compared to carrageenan group at the corresponding time-point.

comparable to that of diclofenac sodium (10 mg/kg). Rat paw edema induced by carrageenan occurs biphasically over time [42], and the anti-inflammatory reaction is usually assessed for 6 h. This is because after this time frame, kininogen (an inflammatory cofactor) is depleted, and then, the inflammatory reaction cannot be accounted for. The early phase (immediately after the injection and for up to 1 h) is mainly mediated by the release of proinflammatory mediators such as histamine and serotonin [38] while the late phase (the first 3–4 h) is mediated by the release of PGE2 and production of COX-2 [38,40]. Thus, the late phase is considerably important for the inflammatory reaction, and typical anti-inflammatory agents respond to this phase [43]. AECF inhibited carrageenan-induced paw edema for up to 4 h after the carrageenan injection, suggesting that its anti-inflammatory mechanism was related to the inhibition of PGE2 and COX-2. This result is consistent with the in vitro results. Additionally, the effect of AECF was comparable to that of diclofenac sodium (a standard agent for treating osteoarthritis and inflammation), which indicates that AECF may be an effective anti-inflammatory drug. These results suggest that AECF is a potential candidate for the development of anti-inflammatory drugs and functional foods. Finally, although our data validate the anti-inflammatory effects of AECF in vitro and in vivo, further studies need to be performed to identify the active components of AECF that contribute to its antiinflammatory activity. Conflict of interest The authors declare that they have no conflict of interest.

Acknowledgements This research was financially supported by the Ministry of Trade, Industry, and Energy (MOTIE), Korea, under the “Regional Specialized Industry Development Program” supervised by the Korea Institute for Advancement of Technology (KIAT) References [1] J.W. Blunt, B.R. Copp, M.H. Munro, P.T. Northcote, M.R. Prinsep, Marine natural products, Nat. Prod. Rep. 27 (2) (2010) 165–237. [2] A.R. Kim, T.S. Shin, M.S. Lee, K.E. Park, N.Y. Yoon, J.S. Kim, J.S. Choi, B.C. Jang, D.S. Byun, N.K. Park, H.R. Kim, Isolation and identification of phlorotannins from Ecklonia stolonifera with antioxidant and anti-inflammatory properties, J. Agric. Food Chem. 57 (9) (2009) 3483–3489. [3] L. Wang, X. Wang, H. Wu, R. Liu, Overview on biological activities and molecular characteristics of sulfated polysaccharides from marine green algae in recent years, Mar. Drugs 12 (9) (2014) 4984–5020. [4] C.L. Pires, S.D. Rodrigues, D. Bristot, H.H. Gaeta, D.O. de Toyama, W.R. Lobo Farias, M.H. Toyama, Evaluation of macroalgae sufated polysaccharides on the Leishmania (L.) amazonensis promasigote, Mar. Drugs 11 (3) (2013) 934–943. [5] J.B. Lee, Y. Ohta, K. Hayashi, T. Hayashi, Immnunostimulating effects of a sulfated galactan from Codium fragile, Carbohydr. Res. 345 (10) (2010) 1452–1454. [6] M.G. Dilshara, R.G. Jayasooriya, C.H. Kang, U.H. Choi, G.Y. Kim, Methanol extract of Codium fragile inhibits tumor necrosis factor- a-induced matrix metalloproteinase-9 and invasiveness of MDA-MB-231 cells by suppressing nuclear factor-kB activation, Asian Pac. J. Trop. Med. 9 (6) (2016) 535–541. [7] P. Ganesan, K. Matsubara, T. Ohkubo, Y. Tanada, K. Noda, T. Suqawara, T. Hirata, Anti-angiogenic effect of siphonaxanthin from green alga, Codium fragile, Phytomedicine 17 (14) (2010) 1140–1144. [8] C. Lee, G.H. Park, E.M. Ahn, B.A. Kim, C.I. Park, J.H. Jang, Protective effect of Codium fragile against UVB-induced pro-inflammatory and oxidative damages in HaCaT cells and BALB/c mice, Fitoterapia 86 (2013) 54–63. [9] M.N. Khan, J.S. Choi, M.C. Lee, E. Kim, T.J. Nam, H. Fujii, Y.K. Hong, Antiinflammatory activities of methanol extracts from various seaweed species, J. Environ. Biol. 29 (4) (2008) 465–469.

1064

S.A. Lee et al. / Biomedicine & Pharmacotherapy 93 (2017) 1055–1064

[10] H.D. Yoon, E.J. Jeong, J.W. Choi, M.S. Lee, M.A. Park, N.Y. Yoon, Y.K. Kim, D.M. Cho, J.I. Kim, H.R. Kim, Anti-inflammatory effects of ethanolic extracts from codium fragile on LPS-stimulated RAW 264.7 macrophages via nuclear factor kappaB inactivation, Fish. Aquat. Sci. 14 (4) (2011) 267–274. [11] C.H. Kang, Y.H. Choi, S.Y. Park, G.Y. Kim, Anti-inflammatory effects of methanol extract of Codium fragile in lipopolysaccharide-stimulated RAW264.7 cells, J. Med. Food 15 (1) (2012) 44–50. [12] R. Medzhitov, Origin and physiological roles of inflammation, Nature 454 (7203) (2008) 428–435. [13] J.A. Rankin, Biological mediators of acute inflammation, AACN Clin. 15 (1) (2004) 3–17. [14] R.P. Packard, R. Libby, Inflammation in atherosclerosis: from vascular biology to biomarker discovery and risk prediction, Clin. Chem. 54 (1) (2008) 24–38. [15] G.W. Fan, Y. Zhang, X. Jiang, Y. Zhu, B. Wang, L. Su, W. Cao, H. Zhang, X. Gao, Anti-inflammatory activity of baicalein in LPS-stimulated RAW 264.7 macrophages via estrogen receptor and NF-kB-dependent pathways, Inflammation 36 (6) (2013) 1584–1591. [16] W. Hu, X. Yang, C. Zhe, Q. Zhang, L. Sun, K. Cao, Puerarin inhibits iNOS, COX-2 and CRP expression via suppression of NF-kB activation in LPS-induced RAW 264.7 macrophage cells, Pharmacol. Rep. 63 (3) (2011) 781–789. [17] M. Aga, J.J. Watters, Z.A. Pfeiffer, G.J. Wiepz, J.A. Sommer, P.J. Bertics, Evidence for nucleotide receptor modulation of cross talk between MAP kinase and NF??B signaling pathways in murine RAW 264.7 macrophages, Am. J. Physiol. Cell Physiol. 286 (4) (2004) C923–C930. [18] J. Shao, T. Liu, Q.R. Xie, T. Zhang, H. Yu, B. Wang, W. Ying, D.D. Mruk, B. Silvestrini, C.Y. Cheng, W. Xia, Adjudin attenuates lipopolysaccharide (LPS)and ischemia-induced microglial activation, J. Neuroimmunol. 254 (1–2) (2013) 83–90. [19] D.W. Hommes, M.P. Peppelenbosch, S.J. van Deventer, Mitogen activated protein (MAP) kinase signal transduction pathways and novel antiinflammatory targets, Gut 52 (1) (2003) 144–151. [20] H.Y. Zhou, E.M. Shin, L.Y. Guo, U.J. Youn, K. Bae, S.S. Kang, L.B. Zou, Y.S. Kim, Anti-inflammatory activity of 4-methoxyhonokiol is a function of the inhibition of iNOS and COX-2 expression in RAW 264.7 macrophages via NF-(B, JNK and p38 MAPK inactivation, Eur. J. Pharmacol. 586 (1–3) (2008) 340–349. [21] Y.H. Jeoun, Y.C. Oh, W.K. Cho, N.H. Yim, J.Y. Ma, Anti-inflammatory effect of Rhapontici Radix ethanol extract via inhibition of NF-kB and MAPK and induction of HO-1 in macrophages, Mediat. Inflamm. 2016 (2016), doi:http:// dx.doi.org/10.1155/2016/7216912. [22] N.H. Nam, Naturally occurring NF-kappaB inhibitors, Mini Rev. Med. Chem. 6 (8) (2006) 945–951. [23] T.D. Gilmore, Introduction to NF-Kb: players, pathways, perspectives, Oncogene 25 (51) (2006) 6680–6684. [24] J.M. Kyriaki, J. Avruch, Mammalian MAPK signal transduction pathways activated by stress and inflammation: a 10-year update, Physiol. Rev. 92 (2) (2012) 689–737. [25] D.W. Gilroy, T. Lawrence, M. Perretti, A.G. Rossi, Inflammatory resolution: new opportunities for drug discovery, Nat. Rev. Drug Discov. 3 (5) (2004) 401–416. [26] T. Uto, M. Fujii, D.X. Hou, 6-(Methylsulfinyl)hexyl isothiocyanate suppresses inducible nitric oxide synthase expression through the inhibition of Janus

[27]

[28]

[29]

[30] [31]

[32]

[33] [34]

[35]

[36] [37] [38] [39]

[40] [41]

[42] [43]

kinase 2-mediated JNK pathway in lipopolysaccharide-activated murine macrophages, Biochem. Pharmacol. 70 (8) (2005) 1211–1221. D.A. Maclntyre, Y.S. Lee, R. Migale, B.R. Herbert, S.N. Waddington, D. Peebles, H. Haqberg, M.R. Johnson, P.R. Bennett, Activator protein 1 is a key terminal mediator of inflammation-induced preterm labor in mice, FASEB J. 28 (5) (2014) 2358–2368. D.W. Seo, Y.I. Cho, D.H. Kim, J.H. Park, Y.J. Yi, S.M. Lee, A hot water extracts of Aralia cordata activates bone marrow-derived macrophages via a MyD88dependent pathways and protects mice from bacterial infection, Microbiol. Immunol. 60 (5) (2016) 343–355. K.K. Li, X. Zhou, H.L. Wong, C.F. Ng, W.M. Fu, P.C. Leung, G. Peng, C.H. Ko, In vivo and in vitro anti-inflammatory effects of Zao-Jiao-Ci (the spine of Gleditsia sinensis Lam.) aqueous extract and its mechanisms of action, J. Ethnopharmacol. 192 (4) (2016) 192–200. National Research Council, Guide for the Care and Use of Laboratory Animals, eight ed., National Academies Press, Washington, D.C, 2011. O.O. Akinnawo, G.N. Anyasor, O. Osilesi, Aqueous fraction of Alstonia boonei de Wild leaves suppressed inflammatory responses in carrageenan and formaldehyde induced arthritic rats, Biomed. Pharmacother. 86 (2017) 95–101. T. Kimiya, K. Ohtani, S. Satoh, Y. Abe, Y. Ogita, H. Kawakita, H. Hamada, Y. Konishi, S. Kubota, A. Tominaga, Inhibitory effects of edible marine algae extracts on degranulation of RBL-2H3 cells and mouse eosinophils, Fish. Sci. 74 (2008) 1157–1165. G. Kolios, V. Valatas, S.G. Ward, Nitric oxide in inflammatory bowel disease: a universal messenger in an unsolved puzzle, Immunology 113 (4) (2004) 427–437. M. Korotkova, M. Westman, K.R. Gheorghe, E. af Klint, C. Trollmo, A.K. Ulfgren, L. Klareskog, P.J. Jakobsson, Effects of antirheumatic treatments on the prostaglandin E2 biosynthetic pathway, Arthritis Rheum. 52 (11) (2005) 3439–3447. G. Solinas, F. Marchesi, C. Garlanda, A. Mantovani, P. Allavena, Inflammationmediated promotion of invasion and metastasis, Cancer Metastasis Rev. 29 (2) (2010) 243–248. B. Beutler, A. Cerami, The biology of cachectin/TNF-a primary mediator of the host response, Annu. Rev. Immunol. 7 (1989) 625–655. E.Y. Kim, K.D. Moudgil, Regulation of autoimmune inflammation by proinflammatory cytokines, Immunol. Lett. 120 (1) (2008) 1–5. A. Yoshimura, Signal transduction of inflammatory cytokines and tumor development, Cancer Sci. 97 (6) (2006) 439–447. Y.J. Surh, K.S. Chun, H.H. Cha, S.S. Han, Y.S. Keum, K.K. Park, S.S. Lee, Molecular mechanisms underlying chemopreventive activities of anti-inflammatory phytochemicals: down-regulation of COX-2 and iNOS through suppression of NF- kB activation, Mutat. Res. 1 (480–481) (2001) 243–268. P. Crunkhorn, S.C. Meacock, Mediators of the inflammation induced in the rat paw by carrageenan, Br. J. Pharmacol. 42 (3) (1971) 392–402. R. Kumar, V. Nair, Y.K. Gupta, S. Singh, Anti-inflammatory and anti-arthritic activity of aqueous extract of Rosa centifolia in experimental models in rats, Int. J. Rheum. Dis. (2015), doi:http://dx.doi.org/10.1111/1756-185X. R. Vinegar, W. Schreiber, R. Hugo, Biphasic development of carrageenan edema in rats, J. Pharmacol. Exp. Ther. 166 (1) (1969) 96–103. S.S. Chaudhari, S.R. Chaudhari, M.J. Chavan, Analgesic, anti-inflammatory and anti-arthritic activity of Cassia uniflora Mill, Asian Pac. J. Trop. Biomed. 2 (1) (2012) 181–186.