- Email: [email protected]
Arbuscular mycorrhizal protein mRNA over-expression in bread wheat seedlings by Trichoderma harzianum Raifi (KRL-AG2) elicitation
Gene 494 (2012) 209–213
Contents lists available at SciVerse ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Short Communication
Arbuscular mycorrhizal protein mRNA over-expression in bread wheat seedlings by Trichoderma harzianum Raifi (KRL-AG2) elicitation Adnan A.S. Al-Asbahi Department of biology, University of Sana'a, Sana'a, P. O. Box 14686, Yemen
a r t i c l e
i n f o
Article history: Accepted 15 December 2011 Available online 28 December 2011 Keywords: Arbuscular mycorrhizal fungi (AMF) Trichoderma harzianum Symbiotic organisms Differential display
a b s t r a c t Association between arbuscular mycorrhizal fungi (AMF) and majority of terrestrial plant species provides many benefits to plants that range from stress alleviation and bioremediation in soils polluted with heavy metals to plant growth promotion and yield quantity. Some non-arbuscular mycorrhizal fungi such as, Trichoderma harzianum, are known to enhance the AMF symbiosis with vascular plants. However, information about their role in AMF symbiosis is still limited. Shoots of (Avocet S) wheat seedlings were sprayed with the fungal culture filtrate and gene expression patterns were analyzed in the treated tissues. An increase in the level of mRNA of arbuscular mycorrhizal protein comparing with control was found. The over-expression of this protein in wheat tissues might contribute in initiation of AMF colonization in wheat tissues. The result of this study can spark future researches to elucidate possible role of this protein in the symbiotic interaction mechanisms between soil AMF and various plant roots. © 2012 Elsevier B.V. All rights reserved.
1. Introduction Recent crop grain breeding programs have made steady improvements in yield quantity and quality along with biotic and abiotic stress toleration that changed the scope and efficiency of wheat breeding strategies (Araus et al., 2008; Reynolds et al., 2011). Usually high productivity of crop grains is accompanied with extensive utilization of agrochemicals for improvement of soil fertility and controlling of plant diseases causing drastic effects on environment and public health. In order to reduce the negative effects of toxic chemicals, there is a globally continual emphasis on sustainable and less chemical dependent organic agriculture. For example, applications of various soil microbial inoculants are one of the most promising alternatives for chemical fertilizers (Arpana and Bagyaraj, 2007). Many fungi and bacteria existing in rhizoshere area of some plant roots are known for their biocontrol activity and bio-fertilization potential (Pandya and Saraf, 2009). Plant roots' association with AMF helps these plants to capture macronutrients and micronutrients from soil, particularly phosphorus (Altomare et al., 1999; Bever et al., 2001; Davies-Jr et al., 2002; Elad and Kapat, 1999; Howell et al., 2000). In addition, AMF increase plant access to and absorption of scarce or immobile soil minerals such as, potassium, calcium, magnesium (Liu et al., 2002), copper, (Chen et al., 2003), iron (Caris et al., 1998), cadmium, nickel (Guo et al., 1996) cadmium (Gonzalez-Chavez et al., 2002), uranium (Rufyikiri et al., 2002) as well as N from ammonium NH4+ (Johansen et al., 1993), and from nitrate ion NO3− under drought conditions (Subramanian and Charest,
E-mail address: [email protected]. 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2011.12.030
1999). Moreover, many studies have confirmed that, AMF are beneficial in biological nitrogen fixation of Rhizobium, biological control of root pathogens (Champavat, 1990) as well as toleration to environmental salinity in some plant species (Ruiz-Lozano et al., 1996) They can also enhance water use efficiency, quality of the fruit in watermelon plants (Kaya et al., 2003), cytokinins and gibberellins level in other plants (Allen et al., 1980, 1982). However, there are many accounts of null or even negative effects on growth rate (Koide and Dickiel, 2002). In addition, high levels of colonization by AMF did not protect crop roots from damage by root pathogens in wheat (Ryan et al., 2002). Applications of the fungicide as a soil drench can reduce AMF colonization in field plots (O'Connor et al., 2002), although in wild cardoon survived AMF to pesticide employed in commercial nursery can enhance plant productivity (Marin et al., 2002). On the other hand, this mutualistic association can provide mycorrhizal fungi with a relatively constant and direct access to carbohydrates, such as, glucose and sucrose supplied by the colonized plant roots (Broeckling et al., 2008; Czarnes et al., 2000). AMF members of Zygomycota class are not able to grow in the absence of their host plant and this has hampered their mass production and utilization within crop systems (Harrison, 1999). However, it is possible to grow AMF in sterile culture with plant root explants, because AMF are obligatory biotrophs (Harrier, 2001). It is believed that development of AMF symbiosis plays a crucial role in the initial colonization of land by plants and in the evolution of the vascular plants (Brundrett, 2002). Although, arbuscular mycorrhizal fungi (AMF) symbiotic mechanism is the most common underground symbiosis, in which around 80% of terrestrial plant species are able to associate with members of fungal phylum Glomeromycota (Glassop et al., 2005), much less is known about the signaling pathways involved
210
A.A.S. Al-Asbahi / Gene 494 (2012) 209–213
in colonization stimulation. In addition, development of AMF symbiosis in plant is thought to be initiated via reciprocal signal exchange by coordination (Liu et al., 2002). Upon physical attachment between the two partners, a complex sequence of biochemical and cytological events and intracellular modification are associated with penetration and intercellular growth of AM fungi into cortical cells of the root plant forming branched hyphens called arbuscule ((Liu et al., 2002; Quilambo, 2003). However, accurate mechanism and associated signaling pathways are largely unknown. For example, information about interaction mechanisms and mutual signals is rare (Camprubia et al., 1995; McAllister et al., 1994; Tarafdar and Marschner, 1995). Very little is known about how AMF detect the presence of their host plant and how they set up symbiotic relationships with them (Giovannetti et al., 1996). Since, understanding of these effects as part of ecosystem processes is essential for obtaining the maximum benefit for plant growth and health in the context of soil–plant system sustainability, the purpose of the current study was to determine the relationships between some of these soil saprophytic fungi in plant–microbe interaction initiation at the level of gene expression. Because, elicitors involved in initiating of gene expression and cellular signaling are important for understanding of AMF colonization mechanisms which in turn can lead to extension of this association to the other plant species that have not convincingly demonstrated. To achieve this goal, we have used mRNA differential display (DD) approach to detect the genes involved in this mechanism. ‘Avocet S’ wheat variety has been utilized for differential display analysis for detection and identification of the induced genes by Trichoderma harzianum culture filtrate spray. 2. Materials and methods 2.1. Plant materials and growth conditions Bread wheat (Avocet S) seeds obtained from the International Center of Aagricultural Research in Dry Area (ICARDA), Syria were germinated under dark conditions. Seedlings were transferred into a seven liter hydroponic medium containing all necessary macro and micronutrients. The final concentrations were; 2 mM calcium (Ca), 4 mM nitrate (NO3), 1 mM magnesium (Mg), 2 mM potassium (K), 0.2 mM phosphorus (P), 1 μM boron (B), 1 μM manganese (Mn), 0.2 μM copper (Cu), 100 μM iron (Fe), 10 μM ammonium (NH4). Nutrient solutions were aerated and changed every 2 days. Plants were grown in growth chamber at 18 °C, light period for 12 h, and 12 °C at dark period for 12 h. Humidity was kept covalent as 40% during light and dark periods. 2.2. Plant treatments with Trichoderma T. harzianum Raifi strain (KRL-AG2) fungal spores were used to inoculate the surface of 100 ml potato dextrose broth (PDB) which was contained in 500 ml conical flask and were allowed to grow at room temperature with shaking in dark conditions for 10 days. The culture was then filtered through filter paper to separate the mycelia mat
from the culture that was diluted with distilled water (1:1) and was used to spray two week grown wheat plants. Upon treatments, leave tissues of treated and control plants were collected after 4 and 10 days and stored at −80 °C for further studies. 2.3. RNA extraction and first strand cDNA synthesis Total RNA from wheat leaves, about 100 mg, was extracted using TRIzol reagent method according to the manufacturer. Synthesis of the first strand is achieved by using Superscript III reverse transcriptase (Invitrogen) according to the manufacturer's procedure. 2.4. mRNA differential display PCR amplification and autoradiography The mRNA differential display (DD) molecular approach was applied according to Clontech's Delta DD method in which the single strand cDNA (ss-cDNA) is used as template in DD analysis. Ploymerase chain reaction (PCR) cycles were optimized by varying the annealing temperature according to primer pair's combinations of forward (P) and reverse (T) primers listed in (Table 1). PCR was performed in MJ Research PTC 100 type thermal cycler in a 200 μl sterile PCR tube, the following components were mixed; 1 × PCR Buffer (75 mM Tris–HCl with pH 8.8 at 25 °C, 20 mM (NH4)2SO4, 0.01% (v/v) Tween 20), 0.25 mM dNTP mix (DNA Amp), 1.5 mM MgCl2 (DNA Amp), 2 u of Taq DNA polymerase, 15 pmol of each primer pair and sterile distilled water up to 20 μl volume were mixed in a 200 μl PCR tube. PCR cycling conditions were 94 °C for 2 min as initial denaturation, 35 cycles of three steps as denaturation at 94 °C for 1 min, annealing at 42–55 °C for 1 min and extension at 72 °C for 1 min and 1 cycle of 5 min extension at 72 °C. Reactions were terminated by adding 4 μl of stop solution (95% formamide, 20 mM EDTA, 0.25% bromophenol blue and 0.025% xylene cyanol). More than 40 different (P–T) primer combinations were used for DD/RT PCR analysis. However, due to the less homology between P primers with the 5′ region of the mRNA, a few primer pairs resulted in PCR amplification. PCR products labeled with α- 33P dCTP, were separated by electrophoresis on denaturing 6% polyacrylamide sequencing gels and visualized by autoradiography. 2.5. Cloning and sequencing All of the differentially expressed bands that were detected by autoradiographs are precisely cut from denaturing gels and then were eluted for 30 min in 10 μl of H2O followed by boiling for 2 min. This differentially expressed band was re-amplified in a second PCR using the same corresponding P9&T2 primer and following the same protocol. Amplified band was electrophoretically separated on run on 1% agarose gel, and then was cut and cloned in pTZ57RT-Easy vector and transformed to E. coli (Dh5-α cells) for enrichment to be ready for sequencing. Cloned band was manually sequenced by the dideoxy sequencing method using primers annealing to M13 sites of the cloning vector. The obtained sequence data of the differentially expressed band was searched in the Genbank databases of the
Table 1 List of the random primers sequences used in differential display PCR reactions and their corresponding melting temperatures (Tm) measured in degree Celsius (°C). Forward primers (P primers)
Primer sequence
Tm, (°C)
Reverse primer (T primers)
Primer sequence
P1 P2 P3 P4 P5 P6 P7 P8 P9
ATTAACCCTCACTAAATGCTGGGGA ATTAACCCTCACTAAATCGGTCATAG ATTAACCCTCACTAAATGCTGGTGG ATTAACCCTCACTAAATGCTGGTAG ATTAACCCTCACTAAAGATCTGACTG ATTAACCCTCACTAAATGCTGGGTG ATTAACCCTCACTAAATGCTGTATG ATTAACCCTCACTAAATGGAGCTGG ATTAACCCTCACTAAATGTGGCAGG
66.1 63.7 61.3 59.7 60.1 61.3 58.1 61.3 61.3
T1 T2 T3 T4 T5 T6 T7 T8 T9
CAT TAT CAT TAT CAT TAT CAT TAT CAT TAT CAT TAT CAT TAT CAT TAT CAT TAT
GCT GCT GCT GCT GCT GCT GCT GCT GCT
GAG GAG GAG GAG GAG GAG GAG GAG GAG
Tm, (°C) TGA TGA TGA TGA TGA TGA TGA TGA TGA
TAT CT (9) AA CT (9) AC TAT CT (9) AG TAT CT (9) CA TAT CT (9) CC TAT CT (9) CG TAT CT (9) GA TAT CT (9) GC TAT CT (9) GG
65.1 64.9 65.0 67.0 67.8 68.5 67.0 68.6 68.5
A.A.S. Al-Asbahi / Gene 494 (2012) 209–213
National Center for Biotechnology Institute (NCBI), Blastn software, for existence of homologous sequences.
2.6. Real time qRT-PCR analysis The differentially expressed gene band was confirmed by a Stratagene MX3005p qPCR System using the Brilliant SYBR Green qPCR Master mix (Stratagene, Cat no, 600548) based on the available sequence data of the gene that were used to design real time PCR primers through Primer3 software (Rozen and Skaletsky, 2000), which are (5′-CAGGCTGGAGTGC AGAGGTAC-3′ and 5′-ACAGACATGCAC CACCACATC-3′) respectively. The amounts of RNA in each qRT-PCR reaction were normalized using a constitutively expressed wheat actin-1 gene specific primers 5′-AATGGTCAAGGCTGGTTTCGC-3′ and 5′-CTGCG CCTCATCACCAACATA-3′ forward and reverse, respectively. qRT-PCR was performed in triple replicates for each RNA sample per primer pair. At the end of cycling, about 36 cycles, fluorescence intensity values were detected by using REST software (Bustin et al., 2005) that was also used to draw amplification plots showing expression levels of Trichoderma-treated tissues in comparison to control (Fig. 1) which are reflected by change in fluorescence during cycling.
211
3. Results and discussion Comparison of mRNA expression levels in Trichoderma-treated and untreated Avocet S wheat seedlings, the differentially expressed gene fragment shown by differential display (DD) autoradiography in Supplemental Fig. 1 is homologous with Arbuscular mycorrhiza protein according to homology alignment searched result as shown in Supplemental Fig. 2. Real time PCR that verified expression differences observed between treated and untreated plants showed positive effect of T. harzianum in induction of mRNA expression of the arbuscular mycorrhiza protein by 2.5 folds comparing with the untreated control plant tissues as it is illustrated by the amplification plots in (Fig. 1). Previous studies on T. harzianum fungi were mainly concerning in their biological role as; 1) plant biocontrol agent involved in diseases systemic acquired resistance for many plant species (Bais et al., 2005; Camprubia et al., 1995; Deshwal et al., 2003; Dhillion, 1994; Sharma and Dohroo, 1996; Siddiqui and Mahmood, 1996; Yedidia et al., 1999) and 2) plant growth stimulation and yield promotion (Fehlberg et al., 2004; Mohammed et al., 2008). Since, T. harzianum have significant effects on mycorrhizal development and symbiosis of AMF in many investigated vascular plant species, they are now
Fig. 1. Real time PCR profile illustrating the expression level differences of arbuscular mycorrhizal gene homolog reflected by the fluorescence changes versus amplification cycles of Trichoderma harzianum-treated and untreated control Avocet S seedlings in comparison with normalized fluorescence data of the constitutively expressed actin1 gene that have not been changed in both treated and control tissues. A: Expression level differences observed for Triticum aestivum arbuscular mycorrhizal protein mRNA between the treated and untreated samples. B: Normalization of mRNA levels using actin1 gene expression with triplicates for treated and untreated samples. C & D are the real time PCR dissociation phases of A & B respectively. The accumulation of dsDNA can be assessed by the incorporation of SYBR Green I dye into a PCR reaction. SYBR Green experiment has two major phases: Amplification phase corresponds to the PCR portion of the experiment and results in the generation of dsDNA (A &B), and dissociation phase typically displayed in (C &D) amplification plots. Dissociation curves shown here confirm the absence of primer–dimers and sample contamination in the amplification plots shown in C and D, so that, majority of fluorescence detected can be attributed to the labeling of specific PCR products.
212
A.A.S. Al-Asbahi / Gene 494 (2012) 209–213
known as plant growth promoting rhizomicroorganisms (PGPR) (Dubsky et al., 2002). Similarly, many soil bacterial species were also known as PGPR enhancing mycorrhizal colonization of AMF such as, Glomus mosseae in rhizosphere area of plant roots leading to mutual effects with other microbial populations in the rhizosphere region (Vázquez et al., 2000). The effects of these PGPR bacteria such as, Bacillus coagulans on mycorrhization, plant growth, biomass yield, and nutrient uptake by host plant become much higher when combined with PGPR fungi such as Trichoderma viride (Selvaraj et al., 2008). Replicate combinations of (Trichoderma, Bacillus, Azospirillum and Pseudomonas) have also shown better results with respect to mycorrhizal colonization of AMF with host roots (Vázquez et al., 2000). Plant-growth-promoting organisms were previously stated as mycorrhizal helper organisms MHO (Srinath et al., 2003), including mycorrhizal helper bacteria (MHB) and mycorrhizal helper fungi (MHF) (Duponnois and Plenchette, 2003). MHO seems to have synergistic effects on AMF, enhancing their mycorrhization with vascular plant roots. Nonetheless, plant response mechanisms to signals from AMF, MHB and MHF haven't been identified yet and, the reason why some plants do not form mycorrhizas is still fully unknown. However, some recent research studies have reported that, volatile and soluble exudates produced by PGPR fungi such as T. harzianum are strongly related to mycorrhization phenomenon in plant (Camprubia et al., 1995; Chandanie et al., 2009; Martinez et al., 2003). On the other hand, plant secondary metabolites such as phenolic compounds, especially the flavonoids, stimulate spore germination, micelial growth and ramification of several arbuscular mycorrhizal fungi-AMF (Aikawa et al., 2000; Becard et al., 1992; Romero and Siqueira, 1996), as well as the development of root colonization (Vierheilig et al., 1998). In addition, identified root exudates of many plant roots such as, amino acids, organic acids, sugars, vitamins, purines, nucleosides, enzymes, hormones, inorganic ions, and CO2, and terpenoids secondary metabolites (Walker et al., 2003) might serve as early chemical mediators of more specific plant microbe interactions (Dakora and Phillips, 2002), act as chemoattractants (Bais et al., 2004; vanWest et al., 2003), and/or as root signals that specifically induce microbial genes necessary for the establishment of compatible associations with plants (Hirsch et al., 2003). In addition, in 2004 evidence has been provided that fungal signals activate plant gene expression before occurrence of physical contact with AM fungi (Harrison and Baldwin, 2004). The findings of the current study support previous studies that reported the existence of the host plant response reflected by production of one or more of their enzymes, protein and/or extracellular metabolites that can play a key role in AM fungal colonization and compatibility with host plant (Artursson et al., 2006; Garrido and Ocampo, 2002; McAllister et al., 1994). Our study suggests that volatile biomolecules released by T. harzianum Raifi KRL-AG2 indirectly enhance AM fungi association with Avocet S wheat plant roots through over-expression of host plant protein that is homologous to arbuscular mycorrhizal protein which might be involved in AM–plant interaction. The putative protein, will attract attentions of interests for exploitation all of rhizosphere microorganisms in biological interaction advantages that are associated with symbiotic mechanisms to enhance plant accessibility to nutrients and toleration to biotic and abiotic stresses that will emerge the transformation of the world toward the forthcoming organic agriculture era that will stand on safe and cheap organic inputs for cultivation of all the economically known plant species including non-legume and non-AMF symbiotic plant species. 4. Conclusion In conclusion, T. harzianum Raifi (KRL-AG2) can be regarded to be a mycorrhiza helper fungus by increasing the expression of AM protein in the inoculated tissues demonstrated that it might play crucial
role in mycorrhizal establishment. However, interaction between AMF and helper organisms and consequent developmental changes need further investigation. Acknowledgments The author gratefully acknowledge the financial support from the Turkish BAP institution (fund number, BAP-2005-07-02-002) and Middle East Technical University in Ankara, Turkey (METU Research Fund). The author offers great thanks to the Science and Technological Research Council (TÜBİTAK) for the 16 month fellowship award. Appendix A. Supplementary data Supplementary data to this article can be found online at doi:10. 1016/j.gene.2011.12.030. References Aikawa, J., Ishii, T., Kuramoto, M., Kadoya, K., 2000. Growth stimulants for vesicular-AMF in Satsuma mandarin pomace. J. Jpn. Soc. Hortic. Sci. 69, 385–389. Allen, M.F., Moore, T.S., Christensen, M., 1980. Phytohormone changes in Bouteolua gracils infected by vesicular-arbuscular mycorrhizae, II. Altered levels of gibberellin-like substances and abscisic acid in the host plant. Can. J. Bot. 60, 468–471. Allen, M., Moore Jr., T.S., Christensen, M., 1982. Phytohormone changes in Bouteloua gracilis infected by vesicular-arbuscular mycorrhizae: I. Cytokinin increases in the host plant. Can. J. Bot. 58, 371–374. Altomare, C., Norvell, A., Bjorkman, T., Harman, G.E., 1999. Solubilization of phosphates and micronutrients by the plant-growth promoting and biocontrol fungus, Trichoderma harzianum Rifai. Appl. Environ. Microbiol. 65, 2926–2933. Araus, J.L., Slafer, G.A., Royo, C., Serret, M.D., 2008. Breeding for yield potential and stress adaptation in cereals. Crit. Rev. Plant Sci. 27, 377–412. Arpana, J., Bagyaraj, D.J., 2007. Response of kalmegh to an arbuscular mycorrhizae fungus and a growth promoting rhizomicroorganism at two levels of phosphorus fertilizer. Am. Eurasian J. Agric. Environ. Sci. 2, 33–38. Artursson, V., Finlay, R.D., Jansson, J.K., 2006. Minireview: Interactions between arbuscular mycorrhizal fungi and bacteria and their potential for stimulating plant growth. Environ. Microbiol. 8, 1–10. Bais, H.P., Park, S.W., Weir, T.L., Callaway, R.M., Vivanco, J.M., 2004. How plants communicate using the underground information superhighway. Trends Plant Sci. 9, 26–32. Bais, H.P., Prithiviraj, B., Jha, A.K., Ausubel, F.M., Vivanco, J.M., 2005. Mediation of pathogen resistance by exudation of antimicrobials from roots. Nature 434, 217–221. Becard, G., Douds, D.D., Pfeffer, P.E., 1992. Extensive in vitro growth of vesicular-AMF in the presence of CO2 and flavonoides. Appl. Environ. Microbiol. 58, 821–825. Bever, J.D., Schultz, P.A., Pringle, A., Morton, J.B., 2001. Arbuscular mycorrhizal fungi: more diverse than meets the age, and the ecological tale of why. Bioscience 51, 923–931. Broeckling, C.D., Broz, A.K., Bergelson, J., Manter, D.K., Vivanco, J.M., 2008. Root exudates regulate soil fungal community composition and diversity. Appl. Environ. Microbiol. 74, 738–774. Brundrett, M.C., 2002. Coevolution of roots and mycorrhiza of land plants. New Phytol. 154, 275–304. Bustin, A., Benes, V., Nolan, T., Pfaffl, W., 2005. Quantitative real time RT-PCR-perspective. J. Mol. Endocrinol. 34, 597–601. Camprubia, A., Calvet, C., Estaun, V., 1995. Growth enhancement of Citrus reshni after inoculation with Glomus intraradices and Trichoderma auroviride, and associated effects on microbial populations and enzyme activity in potting mixes. Plant Soil 173, 233–238. Caris, C., Hoerdt, W., Hwkins, H.J., Roenheld, V., George, E., 1998. Studies on the iron transport by arbuscular mycorrhizal hyphae from soil to peanut and sorghum plants. Mycorrhiza 8, 35–39. Champavat, R.S., 1990. Response of chickpea (Cicer arietinum) to Rhizobium and vesicular arbuscular mycorrhiza dual inoculation. Acta Microbiol. Polonica 39, 163–169. Chandanie, W.A., Kubota, M., Hyakumachi, M., 2009. Interactions between the arbuscular mycorrhizal fungus Glomus mosseae and plant growth-promoting fungi and their significance for enhancing plant growth and suppressing damping-off of cucumber (Cucumis sativus L.). Appl. Soil Ecol. 41, 336–341. Chen, B.D., Li, X.L., Tao, H.Q., Christie, P., Wong, M.H., 2003. The role of arbuscular mycorrhiza in zinc uptake by red clover growing in calcareous soil spiked with various quantities of zinc. Chemosphere 50, 839–846. Czarnes, S., Hallett, P.D., Bengough, A.G., Young, I.M., 2000. Root-and microbial-derived mucilages affect soil structure and water transport. Eur. J. Soil Sci. 51, 435–443. Dakora, F.D., Phillips, D.A., 2002. Root exudates as mediators of mineral acquisition in low-nutrient environments. Plant Soil 245, 35–47. Davies Jr., F.T., Portugal-Olalde, V., Aguilera-Gomez, L., Alvarado, M.J., Ferrera-Cerrato, R.C., Bouton, T.W., 2002. Alleviation of drought stress of Chile ancho pepper (Capsicum annuum cv San Luis) with arbuscular mycorrhiza indigenous to Mexico. Sci. Hortic. 92, 347–359.
A.A.S. Al-Asbahi / Gene 494 (2012) 209–213 Deshwal, V.K., Dubey, R.C., Maheshwari, D.K., 2003. Isolation of plant growthpromoting strains of this would limit the colonization of Bradyrhizobium (Arachis) sp. with biocontrol potential against Macrophomina phaseolina causing charcoal rot of peanut. Curr. Sci. 84, 443–448. Dhillion, S.S., 1994. Effects of Trichoderma-harzianum, Beijerinckia_mobilis and Aspergilus-niger on Arbuscular mycorrhizal infection and sporulation in maize, wheat, millet sorghum, barley and oats. Z. Pflanzenk. Pflanzen. 101, 272–277. Dubsky, M., Sramek, F., Vosatka, M., 2002. Inoculation of cyclamen (Cyclamen persicum) and poinsettia (Euphorbia pulcherrima) with arbuscular mycorrhizal fungi and Trichoderma harzianum. Rost. Vyroba 48, 63–68. Duponnois, R., Plenchette, C.A., 2003. Mycorrhiza helper bacterium enhances ectomycorrhizal and endomycorrhizal symbiosis of Australian Acacia species. Mycorrhiza 13, 85–91. Elad, Y., Kapat, A., 1999. Role of Trichoderma harzianum protease in the biocontrol of Botrytis cinerea. Eur. J. Plant Pathol. 105, 177–189. Fehlberg, V., et al., 2004. The promoter of lehaemoglobin gene VfLb29. functional analysis and identification of molecules necessary for its activation in the infected cells of root nodules and in the arbuscule-containing cells of mycorrhizal roots. J. Exp. Bot. 56, 799–806. Garrido, J.M., Ocampo, J.A., 2002. Regulation of the plant defence response in arbuscular mycorrhizal symbiosis. J. Exp. Bot. 53, 1377–1386. Giovannetti, M., Sbrana, C., Citernesi, A.S., Avio, L., 1996. Analysis of factors involved in fungal recognition responses to host-derived signals by arbuscular mycorrhizal fungi. New Phytol. 133, 65–71. Glassop, D., Smith, E., Smith, F.W., 2005. Cereal phosphate transporter associated with the mycorrhizal pathway of phosphate uptake into roots. Planta 222, 688–698. Gonzalez-Chavez, C., D'Haen, J., Vangronsveld, J., Dodd, J.C., 2002. Copper soprtion and accumulation by the extraradical mycelium of different Glomus spp (arbuscular mycorrhizal fungi) isolated from the same pollued soil. Plant Soil 240, 287–297. Guo, Y., George, E., Marschner, H., 1996. Contribution of arbuscular mycorrhizal fungus to uptake of Cadmnium and Nickel in bean and maize plants. Plant Soil 184, 195–205. Harrier, L.A., 2001. Arbuscular mycorrhizal symbiosis: a molecular review of fungal dimension. J. Exp. Bot. 52, 469–478. Harrison, M.J., 1999. Molecular and cellular aspects of the arbuscular mycorrhizal symbiosis. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 361–389. Harrison, M.J., Baldwin, I., 2004. Biotic interactions: poly and counter-poly in the biotic interactions of plants. Curr. Opin. Plant Biol. 7, 353–355. Hirsch, A.M., Bauer, W.D., Bird, D.M., Cullimore, J., Tyler, B., Yoder, J.I., 2003. Molecular signals and receptors: controlling rhizosphere interactions between plants and other organisms. Ecology 84, 858–868. Howell, C.R., Hanson, L.E., Stiponavic, R.D., Puckhaber, L.S., 2000. Induction of Ferperiod synthesis in cotton roots and control of Rhizoctonia solani by seed treatment with Trichoderma virens. Psychopathology 90, 248–252. Johansen, A., Jakobsen, I., Jessen, E.S., 1993. External hyphae of vesicular-arbuscular mycorrhizal fungi associated with Trifolium subterraneum L. 3. Hyphal transport of 32P and 15N. New Phytol. 124, 61–68. Kaya, C., Higgs, D., Kirnak, H., Tas, I., 2003. Mycorrhizal colonization improves fruit yield and water use efficiency in water melon (Citrullus lanatus Thunb) grown under well-watered and water-stressed conditions. Plant Soil 253, 287–292. Koide, R.T., Dickiel, I.A., 2002. Effects of mycorrhizal fungi on plant populations. Plant Soil 244, 307–317. Liu, A., Hamel, C., Elmi, A., Costa, C., Ma, B., Smith, D.L., 2002. Concentrations of K, Ca and Mg in maize colonised by arbuscular mycorrhizal fungi under field conditions. Can. J. Soil Sci. 82, 271–278. Marin, M., Ybarra, M., Fe, A., Garcia-Ferriz, L., 2002. Effect of arbuscular mycorrhiza fungi and pesticides on Cyanara cardunculatus growth. Agric. Food Sci. Finland 11, 245–251. Martinez, A., Obertello, M., Ocampo, A., Juan, A., Godeas, A., 2003. Interaction between Trichoderma pseudokoningii strains and the arbuscular mycorrhizal Glomus mossea and Gigaspora rosea. Mycorrhiza 14, 79–84.
213
McAllister, C.B., García-Romera, I., Godeas, A., Ocampo, J.A., 1994. Interaction between Trichoderma koningii, Fusarium solani and Glomus mosseae: effect on plant growth, arbuscular mycorrhizas and saprohytic population. Soil Biol. Biochem. 26, 1363–1367. Mohammed, A.S., El Hassan, S.M., Elballa, M.M., Elsheikh, E.A., 2008. The role of Trichoderma, VA mycorrhiza and dry yeast in the control of rhizoctonia disease of potato (Solanum tuberosum L.) U. of K. J. Agric. Sci. 16, 285–301. O'Connor, P.J., Smith, S.E., Smith, E.A., 2002. Arbuscular mycorrhizas influence plant diversity and community structure in semi-arid herbland. New Phytol. 154, 209–218. Pandya, U., Saraf, M., 2009. Application of fungi as a biocontrol agent and their biofertilizer potential in agriculture. J. Adv. Dev. Res. 1, 90–99. Quilambo, O.A., 2003. Review: The vesicular-arbuscular mycorrhizal. Afr. J. Biotechnol. 2, 539–546. Reynolds, M., et al., 2011. Raising yield potential of wheat. I. Overview of a consortium approach and breeding strategies. J. Exp. Bot. 62, 439–452. Romero, A.G.F., Siqueira, J.O., 1996. Activity of flavonoids on spores of the mycorrhizal fungus Gigaspora gigantean in vitro. Pesqui. Agropecu. Bras. 31, 517–522. Rozen, Skaletsky, 2000. Primer 3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 132, 365–386. Rufyikiri, G., Thiry, Y., Wang, L., Delvaux, B., Declerck, S., 2002. Uranium uptake and translocation by the arbuscular mycorrhizal fungus, Glomus intraradices, under root-organ culture conditions. New Phytol. 156, 275–281. Ruiz-Lozano, J.M., Azcon, R., Gomez, M., 1996. Alleviation of salt stress by arbuscular mycorrhizal Glomus species in Lactuca sativa plants. Plant Physiol. 98, 767–772. Ryan, M.H., Norton, R.M., Kirkegaard, J.A., McCormick, K.M., Knights, S.E., Angus, J.F., 2002. Increasing mycorrhizal colonisation does not improve growth and nutrition of wheat on vertsols in south-eastern Australia. J. Agric. Res. 53, 1173–1181. Selvaraj, T., Rajeshkumar, S., Nisha, M.C., Wondimu, L., Tesso, M., 2008. Effect of Glomus mosseae and plant growth promoting rhizomicroorganisms (PGPR's) on growth, nutrients and content of secondary metabolites in Begonia malabarica Lam. Maejo Int. J. Sci. Technol. 2, 516–525. Sharma, S., Dohroo, N.P., 1996. Vesiculararbuscular mycorrhizae in plant health and disease management. Int. J. Trop. Plant Dis. 14, 147–155. Siddiqui, Z.A., Mahmood, I., 1996. Biological control of Heterodera cajani and Fusarium udum on pigeonpea by Glomus mosseae., Trichoderma harzianum., and Verticillium chlamydosporium. Isr. J. Plant Sci. 44, 49–56. Srinath, J., Bagyaraj, D.J., Satyanarayana, B.N., 2003. Enhanced growth and nutrition of micropropagated Ficus benjamina to Glomus mosseae co inoculated with Trichoderma harzianum and Bacillus coagulans. World J. Microbiol. Biotechnol. 19, 69–72. Subramanian, K.S., Charest, C., 1999. Acquisition of N by external hyphae of an arbuscular mycorrhizal fungus and its impact on physiological responses in maize under drought-stressed and well watered conditions. Mycorrhiza 9, 69–75. Tarafdar, J.C., Marschner, H., 1995. Dual inoculation with Aspergillus fumigatus and Glomus mosseae enhances biomass production and nutrient uptake in wheat (Triticum aestivum L.) supplied with organic phosphorus as Na-phytate. Plant Soil 173, 92–102. vanWest, P., Appiah, A.A., Gow, N.A.R., 2003. Advances in research on oomycete root pathogens physiology. Mol. Plant Pathol. 62, 99–113. Vázquez, M.M., César, S., Azcón, R., Barea, J.M., 2000. Interactions between arbuscular mycorrhizal fungi and other microbial inoculants (Azospirillum, Pseudomonas, Trichoderma) and their effects on microbial population and enzyme activities in the rhizosphere of maize plants. Appl. Soil Ecol. 15, 261–272. Vierheilig, H., Bago, B., Albrecht, C., Poulin, M.J., Piché, Y., 1998. Flavonoids and arbuscular-mycorrhizal fungi. Adv. Exp. Med. Biol. 439, 9–33. Walker, T.S., Bais, H.P., Grotewold, E., Vivanco, J.M., 2003. Root exudation and rhizosphere biology. Plant Physiol. 132, 44–51. Yedidia, I., Benhamou, N., Chet, I., 1999. Induction of defense responses in cucumber plants (Cucumis sativus L.) by the biocontrol agent Trichoderma harzianum. Appl. Environ. Microbiol. 65, 1061–1070.
Contents lists available at SciVerse ScienceDirect
Gene journal homepage: www.elsevier.com/locate/gene
Short Communication
Arbuscular mycorrhizal protein mRNA over-expression in bread wheat seedlings by Trichoderma harzianum Raifi (KRL-AG2) elicitation Adnan A.S. Al-Asbahi Department of biology, University of Sana'a, Sana'a, P. O. Box 14686, Yemen
a r t i c l e
i n f o
Article history: Accepted 15 December 2011 Available online 28 December 2011 Keywords: Arbuscular mycorrhizal fungi (AMF) Trichoderma harzianum Symbiotic organisms Differential display
a b s t r a c t Association between arbuscular mycorrhizal fungi (AMF) and majority of terrestrial plant species provides many benefits to plants that range from stress alleviation and bioremediation in soils polluted with heavy metals to plant growth promotion and yield quantity. Some non-arbuscular mycorrhizal fungi such as, Trichoderma harzianum, are known to enhance the AMF symbiosis with vascular plants. However, information about their role in AMF symbiosis is still limited. Shoots of (Avocet S) wheat seedlings were sprayed with the fungal culture filtrate and gene expression patterns were analyzed in the treated tissues. An increase in the level of mRNA of arbuscular mycorrhizal protein comparing with control was found. The over-expression of this protein in wheat tissues might contribute in initiation of AMF colonization in wheat tissues. The result of this study can spark future researches to elucidate possible role of this protein in the symbiotic interaction mechanisms between soil AMF and various plant roots. © 2012 Elsevier B.V. All rights reserved.
1. Introduction Recent crop grain breeding programs have made steady improvements in yield quantity and quality along with biotic and abiotic stress toleration that changed the scope and efficiency of wheat breeding strategies (Araus et al., 2008; Reynolds et al., 2011). Usually high productivity of crop grains is accompanied with extensive utilization of agrochemicals for improvement of soil fertility and controlling of plant diseases causing drastic effects on environment and public health. In order to reduce the negative effects of toxic chemicals, there is a globally continual emphasis on sustainable and less chemical dependent organic agriculture. For example, applications of various soil microbial inoculants are one of the most promising alternatives for chemical fertilizers (Arpana and Bagyaraj, 2007). Many fungi and bacteria existing in rhizoshere area of some plant roots are known for their biocontrol activity and bio-fertilization potential (Pandya and Saraf, 2009). Plant roots' association with AMF helps these plants to capture macronutrients and micronutrients from soil, particularly phosphorus (Altomare et al., 1999; Bever et al., 2001; Davies-Jr et al., 2002; Elad and Kapat, 1999; Howell et al., 2000). In addition, AMF increase plant access to and absorption of scarce or immobile soil minerals such as, potassium, calcium, magnesium (Liu et al., 2002), copper, (Chen et al., 2003), iron (Caris et al., 1998), cadmium, nickel (Guo et al., 1996) cadmium (Gonzalez-Chavez et al., 2002), uranium (Rufyikiri et al., 2002) as well as N from ammonium NH4+ (Johansen et al., 1993), and from nitrate ion NO3− under drought conditions (Subramanian and Charest,
E-mail address: [email protected]. 0378-1119/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2011.12.030
1999). Moreover, many studies have confirmed that, AMF are beneficial in biological nitrogen fixation of Rhizobium, biological control of root pathogens (Champavat, 1990) as well as toleration to environmental salinity in some plant species (Ruiz-Lozano et al., 1996) They can also enhance water use efficiency, quality of the fruit in watermelon plants (Kaya et al., 2003), cytokinins and gibberellins level in other plants (Allen et al., 1980, 1982). However, there are many accounts of null or even negative effects on growth rate (Koide and Dickiel, 2002). In addition, high levels of colonization by AMF did not protect crop roots from damage by root pathogens in wheat (Ryan et al., 2002). Applications of the fungicide as a soil drench can reduce AMF colonization in field plots (O'Connor et al., 2002), although in wild cardoon survived AMF to pesticide employed in commercial nursery can enhance plant productivity (Marin et al., 2002). On the other hand, this mutualistic association can provide mycorrhizal fungi with a relatively constant and direct access to carbohydrates, such as, glucose and sucrose supplied by the colonized plant roots (Broeckling et al., 2008; Czarnes et al., 2000). AMF members of Zygomycota class are not able to grow in the absence of their host plant and this has hampered their mass production and utilization within crop systems (Harrison, 1999). However, it is possible to grow AMF in sterile culture with plant root explants, because AMF are obligatory biotrophs (Harrier, 2001). It is believed that development of AMF symbiosis plays a crucial role in the initial colonization of land by plants and in the evolution of the vascular plants (Brundrett, 2002). Although, arbuscular mycorrhizal fungi (AMF) symbiotic mechanism is the most common underground symbiosis, in which around 80% of terrestrial plant species are able to associate with members of fungal phylum Glomeromycota (Glassop et al., 2005), much less is known about the signaling pathways involved
210
A.A.S. Al-Asbahi / Gene 494 (2012) 209–213
in colonization stimulation. In addition, development of AMF symbiosis in plant is thought to be initiated via reciprocal signal exchange by coordination (Liu et al., 2002). Upon physical attachment between the two partners, a complex sequence of biochemical and cytological events and intracellular modification are associated with penetration and intercellular growth of AM fungi into cortical cells of the root plant forming branched hyphens called arbuscule ((Liu et al., 2002; Quilambo, 2003). However, accurate mechanism and associated signaling pathways are largely unknown. For example, information about interaction mechanisms and mutual signals is rare (Camprubia et al., 1995; McAllister et al., 1994; Tarafdar and Marschner, 1995). Very little is known about how AMF detect the presence of their host plant and how they set up symbiotic relationships with them (Giovannetti et al., 1996). Since, understanding of these effects as part of ecosystem processes is essential for obtaining the maximum benefit for plant growth and health in the context of soil–plant system sustainability, the purpose of the current study was to determine the relationships between some of these soil saprophytic fungi in plant–microbe interaction initiation at the level of gene expression. Because, elicitors involved in initiating of gene expression and cellular signaling are important for understanding of AMF colonization mechanisms which in turn can lead to extension of this association to the other plant species that have not convincingly demonstrated. To achieve this goal, we have used mRNA differential display (DD) approach to detect the genes involved in this mechanism. ‘Avocet S’ wheat variety has been utilized for differential display analysis for detection and identification of the induced genes by Trichoderma harzianum culture filtrate spray. 2. Materials and methods 2.1. Plant materials and growth conditions Bread wheat (Avocet S) seeds obtained from the International Center of Aagricultural Research in Dry Area (ICARDA), Syria were germinated under dark conditions. Seedlings were transferred into a seven liter hydroponic medium containing all necessary macro and micronutrients. The final concentrations were; 2 mM calcium (Ca), 4 mM nitrate (NO3), 1 mM magnesium (Mg), 2 mM potassium (K), 0.2 mM phosphorus (P), 1 μM boron (B), 1 μM manganese (Mn), 0.2 μM copper (Cu), 100 μM iron (Fe), 10 μM ammonium (NH4). Nutrient solutions were aerated and changed every 2 days. Plants were grown in growth chamber at 18 °C, light period for 12 h, and 12 °C at dark period for 12 h. Humidity was kept covalent as 40% during light and dark periods. 2.2. Plant treatments with Trichoderma T. harzianum Raifi strain (KRL-AG2) fungal spores were used to inoculate the surface of 100 ml potato dextrose broth (PDB) which was contained in 500 ml conical flask and were allowed to grow at room temperature with shaking in dark conditions for 10 days. The culture was then filtered through filter paper to separate the mycelia mat
from the culture that was diluted with distilled water (1:1) and was used to spray two week grown wheat plants. Upon treatments, leave tissues of treated and control plants were collected after 4 and 10 days and stored at −80 °C for further studies. 2.3. RNA extraction and first strand cDNA synthesis Total RNA from wheat leaves, about 100 mg, was extracted using TRIzol reagent method according to the manufacturer. Synthesis of the first strand is achieved by using Superscript III reverse transcriptase (Invitrogen) according to the manufacturer's procedure. 2.4. mRNA differential display PCR amplification and autoradiography The mRNA differential display (DD) molecular approach was applied according to Clontech's Delta DD method in which the single strand cDNA (ss-cDNA) is used as template in DD analysis. Ploymerase chain reaction (PCR) cycles were optimized by varying the annealing temperature according to primer pair's combinations of forward (P) and reverse (T) primers listed in (Table 1). PCR was performed in MJ Research PTC 100 type thermal cycler in a 200 μl sterile PCR tube, the following components were mixed; 1 × PCR Buffer (75 mM Tris–HCl with pH 8.8 at 25 °C, 20 mM (NH4)2SO4, 0.01% (v/v) Tween 20), 0.25 mM dNTP mix (DNA Amp), 1.5 mM MgCl2 (DNA Amp), 2 u of Taq DNA polymerase, 15 pmol of each primer pair and sterile distilled water up to 20 μl volume were mixed in a 200 μl PCR tube. PCR cycling conditions were 94 °C for 2 min as initial denaturation, 35 cycles of three steps as denaturation at 94 °C for 1 min, annealing at 42–55 °C for 1 min and extension at 72 °C for 1 min and 1 cycle of 5 min extension at 72 °C. Reactions were terminated by adding 4 μl of stop solution (95% formamide, 20 mM EDTA, 0.25% bromophenol blue and 0.025% xylene cyanol). More than 40 different (P–T) primer combinations were used for DD/RT PCR analysis. However, due to the less homology between P primers with the 5′ region of the mRNA, a few primer pairs resulted in PCR amplification. PCR products labeled with α- 33P dCTP, were separated by electrophoresis on denaturing 6% polyacrylamide sequencing gels and visualized by autoradiography. 2.5. Cloning and sequencing All of the differentially expressed bands that were detected by autoradiographs are precisely cut from denaturing gels and then were eluted for 30 min in 10 μl of H2O followed by boiling for 2 min. This differentially expressed band was re-amplified in a second PCR using the same corresponding P9&T2 primer and following the same protocol. Amplified band was electrophoretically separated on run on 1% agarose gel, and then was cut and cloned in pTZ57RT-Easy vector and transformed to E. coli (Dh5-α cells) for enrichment to be ready for sequencing. Cloned band was manually sequenced by the dideoxy sequencing method using primers annealing to M13 sites of the cloning vector. The obtained sequence data of the differentially expressed band was searched in the Genbank databases of the
Table 1 List of the random primers sequences used in differential display PCR reactions and their corresponding melting temperatures (Tm) measured in degree Celsius (°C). Forward primers (P primers)
Primer sequence
Tm, (°C)
Reverse primer (T primers)
Primer sequence
P1 P2 P3 P4 P5 P6 P7 P8 P9
ATTAACCCTCACTAAATGCTGGGGA ATTAACCCTCACTAAATCGGTCATAG ATTAACCCTCACTAAATGCTGGTGG ATTAACCCTCACTAAATGCTGGTAG ATTAACCCTCACTAAAGATCTGACTG ATTAACCCTCACTAAATGCTGGGTG ATTAACCCTCACTAAATGCTGTATG ATTAACCCTCACTAAATGGAGCTGG ATTAACCCTCACTAAATGTGGCAGG
66.1 63.7 61.3 59.7 60.1 61.3 58.1 61.3 61.3
T1 T2 T3 T4 T5 T6 T7 T8 T9
CAT TAT CAT TAT CAT TAT CAT TAT CAT TAT CAT TAT CAT TAT CAT TAT CAT TAT
GCT GCT GCT GCT GCT GCT GCT GCT GCT
GAG GAG GAG GAG GAG GAG GAG GAG GAG
Tm, (°C) TGA TGA TGA TGA TGA TGA TGA TGA TGA
TAT CT (9) AA CT (9) AC TAT CT (9) AG TAT CT (9) CA TAT CT (9) CC TAT CT (9) CG TAT CT (9) GA TAT CT (9) GC TAT CT (9) GG
65.1 64.9 65.0 67.0 67.8 68.5 67.0 68.6 68.5
A.A.S. Al-Asbahi / Gene 494 (2012) 209–213
National Center for Biotechnology Institute (NCBI), Blastn software, for existence of homologous sequences.
2.6. Real time qRT-PCR analysis The differentially expressed gene band was confirmed by a Stratagene MX3005p qPCR System using the Brilliant SYBR Green qPCR Master mix (Stratagene, Cat no, 600548) based on the available sequence data of the gene that were used to design real time PCR primers through Primer3 software (Rozen and Skaletsky, 2000), which are (5′-CAGGCTGGAGTGC AGAGGTAC-3′ and 5′-ACAGACATGCAC CACCACATC-3′) respectively. The amounts of RNA in each qRT-PCR reaction were normalized using a constitutively expressed wheat actin-1 gene specific primers 5′-AATGGTCAAGGCTGGTTTCGC-3′ and 5′-CTGCG CCTCATCACCAACATA-3′ forward and reverse, respectively. qRT-PCR was performed in triple replicates for each RNA sample per primer pair. At the end of cycling, about 36 cycles, fluorescence intensity values were detected by using REST software (Bustin et al., 2005) that was also used to draw amplification plots showing expression levels of Trichoderma-treated tissues in comparison to control (Fig. 1) which are reflected by change in fluorescence during cycling.
211
3. Results and discussion Comparison of mRNA expression levels in Trichoderma-treated and untreated Avocet S wheat seedlings, the differentially expressed gene fragment shown by differential display (DD) autoradiography in Supplemental Fig. 1 is homologous with Arbuscular mycorrhiza protein according to homology alignment searched result as shown in Supplemental Fig. 2. Real time PCR that verified expression differences observed between treated and untreated plants showed positive effect of T. harzianum in induction of mRNA expression of the arbuscular mycorrhiza protein by 2.5 folds comparing with the untreated control plant tissues as it is illustrated by the amplification plots in (Fig. 1). Previous studies on T. harzianum fungi were mainly concerning in their biological role as; 1) plant biocontrol agent involved in diseases systemic acquired resistance for many plant species (Bais et al., 2005; Camprubia et al., 1995; Deshwal et al., 2003; Dhillion, 1994; Sharma and Dohroo, 1996; Siddiqui and Mahmood, 1996; Yedidia et al., 1999) and 2) plant growth stimulation and yield promotion (Fehlberg et al., 2004; Mohammed et al., 2008). Since, T. harzianum have significant effects on mycorrhizal development and symbiosis of AMF in many investigated vascular plant species, they are now
Fig. 1. Real time PCR profile illustrating the expression level differences of arbuscular mycorrhizal gene homolog reflected by the fluorescence changes versus amplification cycles of Trichoderma harzianum-treated and untreated control Avocet S seedlings in comparison with normalized fluorescence data of the constitutively expressed actin1 gene that have not been changed in both treated and control tissues. A: Expression level differences observed for Triticum aestivum arbuscular mycorrhizal protein mRNA between the treated and untreated samples. B: Normalization of mRNA levels using actin1 gene expression with triplicates for treated and untreated samples. C & D are the real time PCR dissociation phases of A & B respectively. The accumulation of dsDNA can be assessed by the incorporation of SYBR Green I dye into a PCR reaction. SYBR Green experiment has two major phases: Amplification phase corresponds to the PCR portion of the experiment and results in the generation of dsDNA (A &B), and dissociation phase typically displayed in (C &D) amplification plots. Dissociation curves shown here confirm the absence of primer–dimers and sample contamination in the amplification plots shown in C and D, so that, majority of fluorescence detected can be attributed to the labeling of specific PCR products.
212
A.A.S. Al-Asbahi / Gene 494 (2012) 209–213
known as plant growth promoting rhizomicroorganisms (PGPR) (Dubsky et al., 2002). Similarly, many soil bacterial species were also known as PGPR enhancing mycorrhizal colonization of AMF such as, Glomus mosseae in rhizosphere area of plant roots leading to mutual effects with other microbial populations in the rhizosphere region (Vázquez et al., 2000). The effects of these PGPR bacteria such as, Bacillus coagulans on mycorrhization, plant growth, biomass yield, and nutrient uptake by host plant become much higher when combined with PGPR fungi such as Trichoderma viride (Selvaraj et al., 2008). Replicate combinations of (Trichoderma, Bacillus, Azospirillum and Pseudomonas) have also shown better results with respect to mycorrhizal colonization of AMF with host roots (Vázquez et al., 2000). Plant-growth-promoting organisms were previously stated as mycorrhizal helper organisms MHO (Srinath et al., 2003), including mycorrhizal helper bacteria (MHB) and mycorrhizal helper fungi (MHF) (Duponnois and Plenchette, 2003). MHO seems to have synergistic effects on AMF, enhancing their mycorrhization with vascular plant roots. Nonetheless, plant response mechanisms to signals from AMF, MHB and MHF haven't been identified yet and, the reason why some plants do not form mycorrhizas is still fully unknown. However, some recent research studies have reported that, volatile and soluble exudates produced by PGPR fungi such as T. harzianum are strongly related to mycorrhization phenomenon in plant (Camprubia et al., 1995; Chandanie et al., 2009; Martinez et al., 2003). On the other hand, plant secondary metabolites such as phenolic compounds, especially the flavonoids, stimulate spore germination, micelial growth and ramification of several arbuscular mycorrhizal fungi-AMF (Aikawa et al., 2000; Becard et al., 1992; Romero and Siqueira, 1996), as well as the development of root colonization (Vierheilig et al., 1998). In addition, identified root exudates of many plant roots such as, amino acids, organic acids, sugars, vitamins, purines, nucleosides, enzymes, hormones, inorganic ions, and CO2, and terpenoids secondary metabolites (Walker et al., 2003) might serve as early chemical mediators of more specific plant microbe interactions (Dakora and Phillips, 2002), act as chemoattractants (Bais et al., 2004; vanWest et al., 2003), and/or as root signals that specifically induce microbial genes necessary for the establishment of compatible associations with plants (Hirsch et al., 2003). In addition, in 2004 evidence has been provided that fungal signals activate plant gene expression before occurrence of physical contact with AM fungi (Harrison and Baldwin, 2004). The findings of the current study support previous studies that reported the existence of the host plant response reflected by production of one or more of their enzymes, protein and/or extracellular metabolites that can play a key role in AM fungal colonization and compatibility with host plant (Artursson et al., 2006; Garrido and Ocampo, 2002; McAllister et al., 1994). Our study suggests that volatile biomolecules released by T. harzianum Raifi KRL-AG2 indirectly enhance AM fungi association with Avocet S wheat plant roots through over-expression of host plant protein that is homologous to arbuscular mycorrhizal protein which might be involved in AM–plant interaction. The putative protein, will attract attentions of interests for exploitation all of rhizosphere microorganisms in biological interaction advantages that are associated with symbiotic mechanisms to enhance plant accessibility to nutrients and toleration to biotic and abiotic stresses that will emerge the transformation of the world toward the forthcoming organic agriculture era that will stand on safe and cheap organic inputs for cultivation of all the economically known plant species including non-legume and non-AMF symbiotic plant species. 4. Conclusion In conclusion, T. harzianum Raifi (KRL-AG2) can be regarded to be a mycorrhiza helper fungus by increasing the expression of AM protein in the inoculated tissues demonstrated that it might play crucial
role in mycorrhizal establishment. However, interaction between AMF and helper organisms and consequent developmental changes need further investigation. Acknowledgments The author gratefully acknowledge the financial support from the Turkish BAP institution (fund number, BAP-2005-07-02-002) and Middle East Technical University in Ankara, Turkey (METU Research Fund). The author offers great thanks to the Science and Technological Research Council (TÜBİTAK) for the 16 month fellowship award. Appendix A. Supplementary data Supplementary data to this article can be found online at doi:10. 1016/j.gene.2011.12.030. References Aikawa, J., Ishii, T., Kuramoto, M., Kadoya, K., 2000. Growth stimulants for vesicular-AMF in Satsuma mandarin pomace. J. Jpn. Soc. Hortic. Sci. 69, 385–389. Allen, M.F., Moore, T.S., Christensen, M., 1980. Phytohormone changes in Bouteolua gracils infected by vesicular-arbuscular mycorrhizae, II. Altered levels of gibberellin-like substances and abscisic acid in the host plant. Can. J. Bot. 60, 468–471. Allen, M., Moore Jr., T.S., Christensen, M., 1982. Phytohormone changes in Bouteloua gracilis infected by vesicular-arbuscular mycorrhizae: I. Cytokinin increases in the host plant. Can. J. Bot. 58, 371–374. Altomare, C., Norvell, A., Bjorkman, T., Harman, G.E., 1999. Solubilization of phosphates and micronutrients by the plant-growth promoting and biocontrol fungus, Trichoderma harzianum Rifai. Appl. Environ. Microbiol. 65, 2926–2933. Araus, J.L., Slafer, G.A., Royo, C., Serret, M.D., 2008. Breeding for yield potential and stress adaptation in cereals. Crit. Rev. Plant Sci. 27, 377–412. Arpana, J., Bagyaraj, D.J., 2007. Response of kalmegh to an arbuscular mycorrhizae fungus and a growth promoting rhizomicroorganism at two levels of phosphorus fertilizer. Am. Eurasian J. Agric. Environ. Sci. 2, 33–38. Artursson, V., Finlay, R.D., Jansson, J.K., 2006. Minireview: Interactions between arbuscular mycorrhizal fungi and bacteria and their potential for stimulating plant growth. Environ. Microbiol. 8, 1–10. Bais, H.P., Park, S.W., Weir, T.L., Callaway, R.M., Vivanco, J.M., 2004. How plants communicate using the underground information superhighway. Trends Plant Sci. 9, 26–32. Bais, H.P., Prithiviraj, B., Jha, A.K., Ausubel, F.M., Vivanco, J.M., 2005. Mediation of pathogen resistance by exudation of antimicrobials from roots. Nature 434, 217–221. Becard, G., Douds, D.D., Pfeffer, P.E., 1992. Extensive in vitro growth of vesicular-AMF in the presence of CO2 and flavonoides. Appl. Environ. Microbiol. 58, 821–825. Bever, J.D., Schultz, P.A., Pringle, A., Morton, J.B., 2001. Arbuscular mycorrhizal fungi: more diverse than meets the age, and the ecological tale of why. Bioscience 51, 923–931. Broeckling, C.D., Broz, A.K., Bergelson, J., Manter, D.K., Vivanco, J.M., 2008. Root exudates regulate soil fungal community composition and diversity. Appl. Environ. Microbiol. 74, 738–774. Brundrett, M.C., 2002. Coevolution of roots and mycorrhiza of land plants. New Phytol. 154, 275–304. Bustin, A., Benes, V., Nolan, T., Pfaffl, W., 2005. Quantitative real time RT-PCR-perspective. J. Mol. Endocrinol. 34, 597–601. Camprubia, A., Calvet, C., Estaun, V., 1995. Growth enhancement of Citrus reshni after inoculation with Glomus intraradices and Trichoderma auroviride, and associated effects on microbial populations and enzyme activity in potting mixes. Plant Soil 173, 233–238. Caris, C., Hoerdt, W., Hwkins, H.J., Roenheld, V., George, E., 1998. Studies on the iron transport by arbuscular mycorrhizal hyphae from soil to peanut and sorghum plants. Mycorrhiza 8, 35–39. Champavat, R.S., 1990. Response of chickpea (Cicer arietinum) to Rhizobium and vesicular arbuscular mycorrhiza dual inoculation. Acta Microbiol. Polonica 39, 163–169. Chandanie, W.A., Kubota, M., Hyakumachi, M., 2009. Interactions between the arbuscular mycorrhizal fungus Glomus mosseae and plant growth-promoting fungi and their significance for enhancing plant growth and suppressing damping-off of cucumber (Cucumis sativus L.). Appl. Soil Ecol. 41, 336–341. Chen, B.D., Li, X.L., Tao, H.Q., Christie, P., Wong, M.H., 2003. The role of arbuscular mycorrhiza in zinc uptake by red clover growing in calcareous soil spiked with various quantities of zinc. Chemosphere 50, 839–846. Czarnes, S., Hallett, P.D., Bengough, A.G., Young, I.M., 2000. Root-and microbial-derived mucilages affect soil structure and water transport. Eur. J. Soil Sci. 51, 435–443. Dakora, F.D., Phillips, D.A., 2002. Root exudates as mediators of mineral acquisition in low-nutrient environments. Plant Soil 245, 35–47. Davies Jr., F.T., Portugal-Olalde, V., Aguilera-Gomez, L., Alvarado, M.J., Ferrera-Cerrato, R.C., Bouton, T.W., 2002. Alleviation of drought stress of Chile ancho pepper (Capsicum annuum cv San Luis) with arbuscular mycorrhiza indigenous to Mexico. Sci. Hortic. 92, 347–359.
A.A.S. Al-Asbahi / Gene 494 (2012) 209–213 Deshwal, V.K., Dubey, R.C., Maheshwari, D.K., 2003. Isolation of plant growthpromoting strains of this would limit the colonization of Bradyrhizobium (Arachis) sp. with biocontrol potential against Macrophomina phaseolina causing charcoal rot of peanut. Curr. Sci. 84, 443–448. Dhillion, S.S., 1994. Effects of Trichoderma-harzianum, Beijerinckia_mobilis and Aspergilus-niger on Arbuscular mycorrhizal infection and sporulation in maize, wheat, millet sorghum, barley and oats. Z. Pflanzenk. Pflanzen. 101, 272–277. Dubsky, M., Sramek, F., Vosatka, M., 2002. Inoculation of cyclamen (Cyclamen persicum) and poinsettia (Euphorbia pulcherrima) with arbuscular mycorrhizal fungi and Trichoderma harzianum. Rost. Vyroba 48, 63–68. Duponnois, R., Plenchette, C.A., 2003. Mycorrhiza helper bacterium enhances ectomycorrhizal and endomycorrhizal symbiosis of Australian Acacia species. Mycorrhiza 13, 85–91. Elad, Y., Kapat, A., 1999. Role of Trichoderma harzianum protease in the biocontrol of Botrytis cinerea. Eur. J. Plant Pathol. 105, 177–189. Fehlberg, V., et al., 2004. The promoter of lehaemoglobin gene VfLb29. functional analysis and identification of molecules necessary for its activation in the infected cells of root nodules and in the arbuscule-containing cells of mycorrhizal roots. J. Exp. Bot. 56, 799–806. Garrido, J.M., Ocampo, J.A., 2002. Regulation of the plant defence response in arbuscular mycorrhizal symbiosis. J. Exp. Bot. 53, 1377–1386. Giovannetti, M., Sbrana, C., Citernesi, A.S., Avio, L., 1996. Analysis of factors involved in fungal recognition responses to host-derived signals by arbuscular mycorrhizal fungi. New Phytol. 133, 65–71. Glassop, D., Smith, E., Smith, F.W., 2005. Cereal phosphate transporter associated with the mycorrhizal pathway of phosphate uptake into roots. Planta 222, 688–698. Gonzalez-Chavez, C., D'Haen, J., Vangronsveld, J., Dodd, J.C., 2002. Copper soprtion and accumulation by the extraradical mycelium of different Glomus spp (arbuscular mycorrhizal fungi) isolated from the same pollued soil. Plant Soil 240, 287–297. Guo, Y., George, E., Marschner, H., 1996. Contribution of arbuscular mycorrhizal fungus to uptake of Cadmnium and Nickel in bean and maize plants. Plant Soil 184, 195–205. Harrier, L.A., 2001. Arbuscular mycorrhizal symbiosis: a molecular review of fungal dimension. J. Exp. Bot. 52, 469–478. Harrison, M.J., 1999. Molecular and cellular aspects of the arbuscular mycorrhizal symbiosis. Annu. Rev. Plant Physiol. Plant Mol. Biol. 50, 361–389. Harrison, M.J., Baldwin, I., 2004. Biotic interactions: poly and counter-poly in the biotic interactions of plants. Curr. Opin. Plant Biol. 7, 353–355. Hirsch, A.M., Bauer, W.D., Bird, D.M., Cullimore, J., Tyler, B., Yoder, J.I., 2003. Molecular signals and receptors: controlling rhizosphere interactions between plants and other organisms. Ecology 84, 858–868. Howell, C.R., Hanson, L.E., Stiponavic, R.D., Puckhaber, L.S., 2000. Induction of Ferperiod synthesis in cotton roots and control of Rhizoctonia solani by seed treatment with Trichoderma virens. Psychopathology 90, 248–252. Johansen, A., Jakobsen, I., Jessen, E.S., 1993. External hyphae of vesicular-arbuscular mycorrhizal fungi associated with Trifolium subterraneum L. 3. Hyphal transport of 32P and 15N. New Phytol. 124, 61–68. Kaya, C., Higgs, D., Kirnak, H., Tas, I., 2003. Mycorrhizal colonization improves fruit yield and water use efficiency in water melon (Citrullus lanatus Thunb) grown under well-watered and water-stressed conditions. Plant Soil 253, 287–292. Koide, R.T., Dickiel, I.A., 2002. Effects of mycorrhizal fungi on plant populations. Plant Soil 244, 307–317. Liu, A., Hamel, C., Elmi, A., Costa, C., Ma, B., Smith, D.L., 2002. Concentrations of K, Ca and Mg in maize colonised by arbuscular mycorrhizal fungi under field conditions. Can. J. Soil Sci. 82, 271–278. Marin, M., Ybarra, M., Fe, A., Garcia-Ferriz, L., 2002. Effect of arbuscular mycorrhiza fungi and pesticides on Cyanara cardunculatus growth. Agric. Food Sci. Finland 11, 245–251. Martinez, A., Obertello, M., Ocampo, A., Juan, A., Godeas, A., 2003. Interaction between Trichoderma pseudokoningii strains and the arbuscular mycorrhizal Glomus mossea and Gigaspora rosea. Mycorrhiza 14, 79–84.
213
McAllister, C.B., García-Romera, I., Godeas, A., Ocampo, J.A., 1994. Interaction between Trichoderma koningii, Fusarium solani and Glomus mosseae: effect on plant growth, arbuscular mycorrhizas and saprohytic population. Soil Biol. Biochem. 26, 1363–1367. Mohammed, A.S., El Hassan, S.M., Elballa, M.M., Elsheikh, E.A., 2008. The role of Trichoderma, VA mycorrhiza and dry yeast in the control of rhizoctonia disease of potato (Solanum tuberosum L.) U. of K. J. Agric. Sci. 16, 285–301. O'Connor, P.J., Smith, S.E., Smith, E.A., 2002. Arbuscular mycorrhizas influence plant diversity and community structure in semi-arid herbland. New Phytol. 154, 209–218. Pandya, U., Saraf, M., 2009. Application of fungi as a biocontrol agent and their biofertilizer potential in agriculture. J. Adv. Dev. Res. 1, 90–99. Quilambo, O.A., 2003. Review: The vesicular-arbuscular mycorrhizal. Afr. J. Biotechnol. 2, 539–546. Reynolds, M., et al., 2011. Raising yield potential of wheat. I. Overview of a consortium approach and breeding strategies. J. Exp. Bot. 62, 439–452. Romero, A.G.F., Siqueira, J.O., 1996. Activity of flavonoids on spores of the mycorrhizal fungus Gigaspora gigantean in vitro. Pesqui. Agropecu. Bras. 31, 517–522. Rozen, Skaletsky, 2000. Primer 3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. 132, 365–386. Rufyikiri, G., Thiry, Y., Wang, L., Delvaux, B., Declerck, S., 2002. Uranium uptake and translocation by the arbuscular mycorrhizal fungus, Glomus intraradices, under root-organ culture conditions. New Phytol. 156, 275–281. Ruiz-Lozano, J.M., Azcon, R., Gomez, M., 1996. Alleviation of salt stress by arbuscular mycorrhizal Glomus species in Lactuca sativa plants. Plant Physiol. 98, 767–772. Ryan, M.H., Norton, R.M., Kirkegaard, J.A., McCormick, K.M., Knights, S.E., Angus, J.F., 2002. Increasing mycorrhizal colonisation does not improve growth and nutrition of wheat on vertsols in south-eastern Australia. J. Agric. Res. 53, 1173–1181. Selvaraj, T., Rajeshkumar, S., Nisha, M.C., Wondimu, L., Tesso, M., 2008. Effect of Glomus mosseae and plant growth promoting rhizomicroorganisms (PGPR's) on growth, nutrients and content of secondary metabolites in Begonia malabarica Lam. Maejo Int. J. Sci. Technol. 2, 516–525. Sharma, S., Dohroo, N.P., 1996. Vesiculararbuscular mycorrhizae in plant health and disease management. Int. J. Trop. Plant Dis. 14, 147–155. Siddiqui, Z.A., Mahmood, I., 1996. Biological control of Heterodera cajani and Fusarium udum on pigeonpea by Glomus mosseae., Trichoderma harzianum., and Verticillium chlamydosporium. Isr. J. Plant Sci. 44, 49–56. Srinath, J., Bagyaraj, D.J., Satyanarayana, B.N., 2003. Enhanced growth and nutrition of micropropagated Ficus benjamina to Glomus mosseae co inoculated with Trichoderma harzianum and Bacillus coagulans. World J. Microbiol. Biotechnol. 19, 69–72. Subramanian, K.S., Charest, C., 1999. Acquisition of N by external hyphae of an arbuscular mycorrhizal fungus and its impact on physiological responses in maize under drought-stressed and well watered conditions. Mycorrhiza 9, 69–75. Tarafdar, J.C., Marschner, H., 1995. Dual inoculation with Aspergillus fumigatus and Glomus mosseae enhances biomass production and nutrient uptake in wheat (Triticum aestivum L.) supplied with organic phosphorus as Na-phytate. Plant Soil 173, 92–102. vanWest, P., Appiah, A.A., Gow, N.A.R., 2003. Advances in research on oomycete root pathogens physiology. Mol. Plant Pathol. 62, 99–113. Vázquez, M.M., César, S., Azcón, R., Barea, J.M., 2000. Interactions between arbuscular mycorrhizal fungi and other microbial inoculants (Azospirillum, Pseudomonas, Trichoderma) and their effects on microbial population and enzyme activities in the rhizosphere of maize plants. Appl. Soil Ecol. 15, 261–272. Vierheilig, H., Bago, B., Albrecht, C., Poulin, M.J., Piché, Y., 1998. Flavonoids and arbuscular-mycorrhizal fungi. Adv. Exp. Med. Biol. 439, 9–33. Walker, T.S., Bais, H.P., Grotewold, E., Vivanco, J.M., 2003. Root exudation and rhizosphere biology. Plant Physiol. 132, 44–51. Yedidia, I., Benhamou, N., Chet, I., 1999. Induction of defense responses in cucumber plants (Cucumis sativus L.) by the biocontrol agent Trichoderma harzianum. Appl. Environ. Microbiol. 65, 1061–1070.