Arl5b is a Golgi-localised small G protein involved in the regulation of retrograde transport

EX PE R IM EN TA L C E LL RE S EA RC H 31 8 ( 20 1 2) 4 6 4– 4 7 7

Available online at www.sciencedirect.com

www.elsevier.com/locate/yexcr

Research Article

Arl5b is a Golgi-localised small G protein involved in the regulation of retrograde transport Fiona J. Houghton, Shayne A. Bellingham, Andrew F. Hill, Dorothée Bourges, Desmond K.Y. Ang, Timothy Gemetzis, Isabelle Gasnereau, Paul A. Gleeson⁎ The Department of Biochemistry and Molecular Biology, Bio21 Molecular Science and Biotechnology Institute, The University of Melbourne, Victoria 3010, Australia

A R T I C L E I N F O R M A T I O N

A B S T R A C T

Article Chronology:

Regulation of membrane transport is controlled by small G proteins, which include members of

Received 21 April 2011

the Rab and Arf families. Whereas the role of the classic Arf family members are well

Revised version received

characterized, many of the Arf-like proteins (Arls) remain poorly defined. Here we show that

4 December 2011

Arl5a and Arl5b are localised to the trans-Golgi in mammalian cells, and furthermore have identi-

Accepted 28 December 2011

fied a role for Arl5b in the regulation of retrograde membrane transport from endosomes to the

Available online 5 January 2012

trans-Golgi network (TGN). The constitutively active Arl5b (Q70L)-GFP mutant was localised efficiently to the Golgi in HeLa cells whereas the dominant-negative Arl5b (T30N)-GFP mutant was

Keywords:

dispersed throughout the cytoplasm and resulted in perturbation of the Golgi apparatus. Stable

Arl proteins

HeLa cells expressing GFP-tagged Arl5b (Q70L) showed an increased rate of endosome-to-Golgi

trans-Golgi network

transport of the membrane cargo TGN38 compared with control HeLa cells. Depletion of Arl5b

Membrane transport

by RNAi resulted in an alteration in the intracellular distribution of mannose-6-phosphate recep-

Retrograde transport

tor, and significantly reduced the endosome-to-TGN transport of the membrane cargo TGN38 and

TGN38

of Shiga toxin, but had no affect on the anterograde transport of the cargo E-cadherin. Collectively

Shiga toxin

these results suggest that Arl5b is a TGN-localised small G protein that plays a key role in regulating transport along the endosome-TGN pathway. © 2012 Elsevier Inc. All rights reserved.

Introduction Small GTP-binding proteins (G proteins) and their effectors play key roles in regulating membrane transport to and from the Golgi apparatus [1–4]. The regulation by G proteins is mediated by their cycling between a cytosolic GDP-bound inactive form and a membrane-associated GTP-bound active state. Small G proteins associated with Golgi apparatus include members of the Rab and Sar1/ARF family. For example, more than 15 Rabs have been

localised to the Golgi complex and several have been mapped to specific regions of the Golgi [5] where they regulate tethering and fusion events of membrane transport vesicles. Golgilocalised Arfs, such as Arf1 and Arf3, and their effectors regulate the vesicle budding process by mediating the recruitment of adaptor proteins to the TGN [6]. A sub-family of Arfs, the Arf-like proteins or Arls, have been identified from genomic sequences which are similar in sequence and protein structural features, but which lack the ability to

⁎ Corresponding author. E-mail address: [email protected] (P.A. Gleeson). Abbreviations: TGN, trans-Golgi network; STxB, Shiga toxin B subunit; M6P-R, mannose-6-phosphate receptor; E-cad, E-cadherin; CI-M6P-R, cation-independent mannose-6-phosphate receptor; siRNA, small interfering RNA; GFP, green fluorescent protein; RFP, red fluorescent protein; YFP, yellow fluorescent protein. 0014-4827/$ – see front matter © 2012 Elsevier Inc. All rights reserved. doi:10.1016/j.yexcr.2011.12.023

EX PE R IM E NTA L CE L L RE S E ARC H 31 8 (20 1 2 ) 4 6 4 –4 7 7

activate cholera toxin or phospholipase D (PLD) [7,8]. More than 16 human ARL genes have been identified [2,9] and the Arl proteins so far characterized have a variety of cellular functions and are localised to a number of intracellular compartments. Arl1 is the best-characterized Golgi-associated Arl [10–13] and has been shown to play a role in the maintenance of Golgi structure and in regulation of both anterograde and retrograde transport at the TGN. The effectors of Arl1 include members of the GRIP domain family of golgins, p230/golgin245 and golgin-97 [11,13,14]. Other GRIP domain golgins, namely GCC88 and GCC185, appear to be recruited in an Arl1-independent fashion, indicating that there may be additional members of the Arf/Arl family associated with the TGN [15,16]. Given the importance of small G proteins in regulating the structure and function of the Golgi, it seems likely that there are additional Arl proteins specifically associated with Golgi apparatus. Here we have analysed the location of Arl5a and Arl5b, as phylogenic analysis indicates that Arl5 proteins are closely related to Arl1 [17] and therefore may have similar roles in regulating transport. In addition, preliminary unpublished reports from the Munro lab have indicated that Arl5a and Arl5b may be Golgi-localised [2]. Here we show that Arl5a and Arl5b are located on the trans-Golgi and demonstrate that Arl5b is involved in regulation of endosome-to-Golgi trafficking.

Materials and methods Constructs and antibodies

465

GGGGCTGATCTTCGCCAAACT3′ and 3′KpnI CGGGGTACCCCACCAATCC GGGAGGTCATCCACTCT5′. PCR products were purified with QIAquick PCR purification kit (Qiagen) and sequentially digested using the primer-introduced restriction sites XhoI and KpnI. Digested PCR products were purified and ligated into the XhoI and KpnI sites of the mCherry-N1 vector. Constructs were verified by DNA sequencing (Applied Genetic Diagnostics, Dept Pathology, University of Melbourne, Australia). Sequences were aligned to the NCBI accession numbers with BLAST and Sequencher (NEB).

Mutagenesis Mutagenesis PCR was used to introduce mutations into Arl5a and Arl5b. A megaprimer was generated by PCR, using mCherry-tagged Arl5a or Arl5b as template DNA, with an appropriate forward primer and a reverse primer that introduced the mutation. The megaprimer product was separated by agarose gel electrophoresis and purified using a gel extraction kit (Qiagen, Germany). The megaprimer and an appropriate reverse primer were then used in a second round of PCR with the original template. The PCR products were purified and a 3rd round of PCR carried out to amplify the product. The final PCR product was separated on an agarose gel, purified and ligated into the XhoI and KpnI sites in the mCherry-N1 vector or pEGFP-N3 vector, and the constructs confirmed by DNA sequencing. An Arl5b (Q70L) construct with a silent mutation in siRNA-1 targeting sequence was generated using the primer 5′GAACACATATTACTCAAATACAGAaTTtATCATTCTTGTTGTTGAT3′, where lower case indicates the silent base substitutions.

Cell culture and transfection

pEGFP-N3 was obtained from Clontech (Clontech, CA, USA). mCherry-N1, a gift from Dr Roger Tsien (UCSD, CA, USA) was cloned into pEGFP. Untagged TGN38 was cloned into pIRES (Clontech, CA, USA) [18]. E-cadherin-RFP and E-cadherin-YFP encode the full length human E-cadherin fused in frame at the C-terminus with the red fluorescent protein (RFP) and with the yellow fluorescent protein (YFP), respectively [19]. Rabbit polyclonal antibodies to human GCC88 and GCC185 have been described [20]. Mouse monoclonal antibodies to human golgin-97, GM130 and TGN38 were purchased from BD Biosciences (NSW, Australia). Rabbit polyclonal antibody to GRASP65 and mouse monoclonal (2G11) antibody to cation-independent mannose-6-phosphate receptor were purchased from Abcam (Cambridge, UK). Mouse antibody to GFP was obtained from Roche (Basil, Switzerland). Mouse monoclonal anti α-tubulin was obtained from GE Healthcare (Rydalmere, NSW, Australia). Secondary antibodies for immunofluorescence were goat anti-rabbit IgG Alexa Fluor 568, goat anti-rabbit IgG Alexa Fluor 647, goat anti-mouse IgG Alexa Fluor 488, goat antimouse IgG Alexa Fluor 568, and goat anti-mouse IgG Alexa Fluor 647 were purchased from Molecular Probes (Invitrogen, Carlsbad, CA, USA). Horse-radish peroxidase-conjugated sheep anti-rabbit Ig and anti-mouse Ig were purchased from DAKO Corporation (Glostrup, Denmark).

siRNA sequences which individually target human Arl5b were designed by Sigma Proligo (Lismore, Australia); Arl5b-1 siRNA (5′-GUU CAU CAU UCU UGU UGU U-3′) and Arl5b-2 siRNA (5′-CUC AUG AGG AUU UAC GGA A-3′). An siRNA sequence to target human Arl1 and control siRNA [11] have been previously described. siRNA duplexes were synthesised by Sigma Proligo (Lismore, Australia).

RT-PCR

Quantitative real time RT-PCR (qPCR)

Wild-type ARL5a and ARL5b cDNAs were amplified from HeLa cell RNA using primers designed to target human ARL5a: (ACCESSION # NM_012097) 5′XhoICCGCTCGAGCGGAGAATGGGAATTCTCTTCACTA3′ and 3′KpnICGGGGTACCCCGATCTTAAGTCGTGACATCATCC5′; human ARL5b: (ACCESSION # NM_178815) 5′XhoI CCGCTCGAGCGGACCAT

Total RNA was isolated with the Qiagen RNeasy mini kit (Qiagen, Doncaster, Vic, Australia) from ~ 2 × 105 cells cultured in 6 well plates that were either untreated, or transfected with control siRNA or Arl5b-1/2 siRNA for 72 h. Isolated RNA was analysed for quality and quantity using an Agilent® 2100 bioanalyzer (Agilent

HeLa cells were maintained as semi-confluent monolayers in Dulbecco’s Modified Eagle's media (DMEM) supplemented with 10% (v/v) fetal bovine serum (FBS), 2 mM L-glutamine, 100 units/μl penicillin and 0.1% (w/v) streptomycin (C-DMEM) in a humidified 10% CO2 atmosphere at 37 °C. Transient transfections of fusion protein constructs were performed using FuGENE 6 transfection reagent (Roche, Basel, Switzerland) or FuGENE HD (Promega, USA). Transfected cells were cultured for 24–48 h. Transfections with siRNA were performed using Oligofectamine (Invitrogen, USA) or DharmaFECT1/2 siRNA transfection reagent (Thermo Fisher Scientific, Lafayette, CO, USA), according to manufacturer's instruction, for 72 h prior to analysis.

RNA interference

466

EX PE R IM EN TA L C E LL RE S EA RC H 31 8 ( 20 1 2) 4 6 4– 4 7 7

Technologies) and all samples had a RIN of > 9. Total RNA (1–2 μg) was converted to cDNA using a High-Capacity cDNA Kit (Applied Biosystems). cDNA was used with Taqman Gene Expression Master mix and human specific Taqman Gene Expression Assays (Applied Biosystems) to setup 20 μl singleplex reactions in quadruplicate with the Qiagility Liquid Handling Robot (QIAGEN) for ARL5B (Hs00379311_m1) and ARL5A (Hs00757386_m1), with internal endogenous reference genes for human GAPDH (Hs99999905_m1) and RPLPO (Hs99999902_m1). qPCR reactions were then run on a StepOnePlus qPCR machine (Applied Biosystems) and analysed using the comparative DeltaDelta CT method. Relative quantification of mRNA levels used control siRNA cells as the normaliser and GAPDH and RPLPO as the internal reference genes. Analyses were performed in quadruplicate for each gene. Data is represented as the mean± SEM of three experiments for wild-type HeLa cells. Statistical analysis was performed by either Mann–Whitney U-test or one-way ANOVA, using Prism 4 (GraphPad Software Inc., USA). p < 0.05 was considered statistically significant.

Indirect immunofluorescence Cells on coverslips were fixed in 4% (w/v) paraformaldehyde (PFA) for 15 min, free aldehyde groups quenched in 50 mM

NH4Cl/PBS for 10 min and cells permeabilised with 0.1% Triton X-100 in PBS for 4 min. Monolayers were incubated in 5% (v/v) FBS in PBS for at least 15 min to reduce non-specific staining. Monolayers were incubated with primary antibody, diluted in 5% (v/v) FBS/PBS, for 40 min, washed in PBS, then incubated with secondary conjugated antibodies for 30 min. Nuclei were stained with 4′,6-Diamidino-2-phenylindole dihydrochloride (DAPI) (Sigma-Aldrich) diluted to 1 μg/ml for 5 min, washed with PBS then rinsed briefly in water. For detection of cell surface E-cadherin (E-cad) cells were fixed and stained with anti-E-cad antibodies before permeabilisation. Coverslips were then blotted dry and mounted in mowiol on a microscope slide.

Anterograde transport assay WT HeLa cells grown in 12 well plates were treated with Arl5b siRNA for 48–72 h, transfected with E-cadherin-YFP for 24–36 h, and washed in PBS and trypsinized at 37 °C for 6 min. Single cell suspensions were obtained by pipetting, C-DMEM added, and cells cultured at 37 °C for up to 4 h in the presence and absence of 50 μg/ml cycloheximide. Cells were harvested with 5 mM (w/v) EDTA/PBS at RT for 15 min, washed in C-DMEM and resuspended in FACS buffer (2 mM EDTA/PBS) supplemented with 5% FBS for at

Fig. 1 – Arl5a and Arl5b localise to the Golgi apparatus. HeLa cells were transfected with either mCherry-tagged Arl constructs (A, B) for 48 h. Cells were fixed in 4% PFA. In B the cells were stained for the cis-Golgi marker GM130 (green) and red and green confocal images were collected separately. Higher magnifications are shown of the indicated regions. In A and B nuclei were stained with DAPI. Bars = 10 μm.

EX PE R IM E NTA L CE L L RE S E ARC H 31 8 (20 1 2 ) 4 6 4 –4 7 7

least 15 min. For detection of cell surface E-cadherin (E-cad) cells were then stained with mouse anti-E-cad antibodies diluted in 2% FBS/FACS buffer at 4 °C for 20 min and incubated with anti-mouse Alexa Fluor 647 (Invitrogen) diluted in 2% FBS/FACS buffer for 20 min. Cells were then washed twice in FACS buffer, fixed in 4% w/v PFA at RT for 15 min, and analysed using a BD LSRFortessa flow cytometer as described below.

467

Cy3-conjugated Shiga toxin fragment B (STxB) [21] was incubated with cells on ice for 30 min, cells were washed, and then STxB was internalised continuously at 37 °C for up to 90 min as previously described [18,22]. Internalisation of unconjugated STxB was detected using a mouse monoclonal antibody to STxB (13C4), followed by fluorochrome-conjugated secondary antibodies.

Confocal microscopy and image analysis Internalisation assays For TGN38 trafficking assays, HeLa or HeLaArl5b (Q70L)-GFP cells were siRNA depleted (as described above) for 48 h. Cells were then transfected with pIRES-TGN38 using FuGENE 6 and incubated at 37 °C for a further 24 h. TGN38 trafficking assays were carried out using mouse anti-rat TGN38 as previously described [18]. Cells were PFA-fixed, permeabilised and TGN38 antibody complexes were detected with anti-mouse IgG Alexa Fluor 568. The Golgi marker GRASP65 was used to define the Golgi region and analysed using Meta Morph software (Molecular Devices, Sunnyvale, CA, USA).

All images were acquired using a confocal laser scanning microscope (Leica LCS SP2 confocal imaging system) using a 100×/1.4 NA HCX PL APO CS oil immersion objective. GFP and Alexa Fluor488 were excited with the 488-nm line of an Argon laser, Alexa Fluor568 and mCherry with a 543-nm HeNe laser, Alexa Fluor647 with a 633-nm HeNe laser and DAPI with a 405-nm UV laser. Images were collected with pixel dimensions of 512 × 512. For postacquisition analyses, all images were thresholded equally at the lower limit. For multi-colour labelling, images were collected independently. 3D reconstructions were generated using the process option of the Leica LCS software.

Fig. 2 – Overexpression of Arl5b (T30N) disrupts localisation of resident Golgi proteins. HeLa cells were transfected with GFP-tagged Arl5b (T30N) for 48 h and cells fixed and permeabilised. (A) Cells were stained for GM130 (red), (B) the TGN golgin GCC88 (red) and for GM130 (grey) and (C) and CI-M6P-R (red) and for GRASP65 (grey). Nuclei were stained with DAPI. Confocal images were collected separately. Bars represent 10 μm.

468

EX PE R IM EN TA L C E LL RE S EA RC H 31 8 ( 20 1 2) 4 6 4– 4 7 7

Quantitation of fluorescence intensity was assessed with the LCS Quantify option (Leica Microsystems, North Ryde, NSW, Australia) or Meta Morph (Molecular Devices, Sunnyvale, CA, USA). Images were cropped in Photoshop.

Flow cytometry

washed three times in 0.1% (v/v) Tween20/PBS. Bound antibodies were detected by enhanced chemiluminescence (NEN, Boston, USA). Membranes were stripped with 25 mM glycine–HCl, pH 2, 1% (w/v) SDS in PBS then re-probed with a mouse anti-tubulin antibody. Images were captured and analysed using the Gel Proanalyzer program (Media Cybernetics, Bethesda, MD, USA).

For cell sorting, cells were harvested in 0.05% (w/v) trypsin/ 0.02% (w/v) EDTA/PBS, resuspended in PBS, and GFP-positive cells purified using a BD FACSAria cell sorter. For analyses, cells were harvested in 5 mM (w/v) EDTA/PBS and single cell suspensions analysed using a BD FACSort or BD LSRFortessa. Data was analysed with Cell Quest Pro software (Becton Dickinson, New Jersey, USA).

Brefeldin A treatment

Immunoblotting

Statistical analyses

Transfected HeLa cells were lysed in SDS-loading buffer. Extracts were resolved on SDS-PAGE using 4–12% NuPAGE gels. Proteins were transferred to PVDF membrane, then probed with mouse anti-GFP antibody, diluted in 1% (w/v) BSA/PBS, for 1 h, and washed three times, each 10 min, in 0.1% (v/v) Tween20/PBS. The PVDF membrane was then incubated with horseradish peroxidaseconjugated anti-mouse, diluted in 1% (w/v) BSA/PBS, for 1 h, and

Data obtained from fluorescence intensity of Golgi-localised M6P-R as the mean, +/− standard deviation using a Mann– Whitney U-test, unpaired, two tailed. Data from at least 80 cells were used for quantification. Analysis of the intracellular distribution of antibody–TGN38 complexes was performed by a two-tailed Chi-square Fisher's exact test. Data from a least 100 cells were used in each experiment. Quantitation of the

HeLa Arl5b (Q70L)-GFP cells or wild-type HeLa cells transfected with Arl5b constructs were cultured for 48 h, then treated with BFA at 5 μg/ml (final) at 37 °C for up to 15 min, before cells were fixed in 4% PFA. Cells were stained for endogenous GCC88.

Fig. 3 – trans-Golgi location of Arl5b (Q70L) in stably transfected HeLa cells. A HeLa cell line stably expressing Arl5b (Q70L)-GFP was generated and monolayers fixed in 4% paraformaldehyde. Cells were stained for endogenous golgins using antibodies to GM130, GCC88 and GCC185 (red). Nuclei were stained with DAPI. Confocal images were collected separately. Inset shows higher magnifications of boxed regions. Bar = 10 μm.

EX PE R IM E NTA L CE L L RE S E ARC H 31 8 (20 1 2 ) 4 6 4 –4 7 7

percent of total fluorescence intensity of TGN38 antibody complexes at the Golgi was performed on at least 17 cells per group, and for STxB on at least 13 cells per group, using Prism GraphPad software (San Diego, USA). Data was expressed as

469

the mean ± SEM and analysed using a Mann–Whitney U-test, unpaired, two tailed. For qPCR data was analysed using Mann– Whitney U-test or one-way ANOVA. P < 0.05 was considered as significant.

Fig. 4 – Depletion of Arl5b from HeLa Arl5b (Q70L)-GFP cell line by siRNA. HeLaArl5b (Q70L)-GFP stable cell line was transfected with either control or Arl5b-1 or Arl5b-2 siRNA for 72 h and (A) monolayers fixed and analysed for GFP fluorescence. In (B) siRNA treated cells were lysed in SDS-PAGE reducing buffer and extracts subjected to SDS-PAGE. Proteins were transfer to a PVDF membrane and probed with rabbit anti-GFP antibodies using a chemiluminescence detection system. The membrane was then stripped and re-probed with anti-α-tubulin. C. Flow cytometry analysis of GFP intensity (log scale) of untreated HeLaArl5b (Q70L)-GFP stable cells (purple), Arl5b-1 siRNA treated cells (green) Arl5b-2 treated cells (red) and wild-type HeLa cells (black). D. HeLaArl5b (Q70L)-GFP cells depleted with siRNA for 72 h were stained for trans-Golgi markers (golgins) golgin-97 and GCC185. Nuclei were stained with DAPI. Confocal images were collected separately. Bar = 10 μm.

470

EX PE R IM EN TA L C E LL RE S EA RC H 31 8 ( 20 1 2) 4 6 4– 4 7 7

Results Arl5a and Arl5b localise to the Golgi apparatus Initially we assessed the localisation of a number of members of the Arl family including human Arl5a and Arl5b. There have been preliminary reports that suggested these Arl5 proteins may be Golgi-associated [2]. cDNAs encoding these ARLs were isolated by RT-PCR of HeLa cell RNA and tagged with mCherry at their C-terminus. C-terminal fluorescent tags were used to minimize potential disruption of membrane association of the N-termini of Arl proteins which is predicted to be myristoylated. The location of the mCherry fusion proteins was assessed in HeLa cells transfected with the Arl constructs. Both Arl5a and Arl5b showed a juxtanuclear staining pattern in transfected HeLa cells, indicative of the Golgi apparatus (Fig. 1A). To further define the characteristics of Arl5a and Arl5b, we generated mutants that were predicted to be restricted in the GTP-bound state, namely Arl5a (Q70L) and Arl5b (Q70L). The constitutively active Arl (Q70L) mutants exhibited a Golgi localisation, as defined by co-localisation with the Golgi marker GM130 (Fig. 1B). Moreover the majority of the Arl5a (Q70L)-mCherry and Arl5b (Q70L)-mCherry was Golgi-associated with very little detected in the cytosol (Fig. 1B), indicating that the Golgi recruitment of the Arl (Q70L) mutants was enhanced compared with the wild-type Arl constructs. The behaviour of the Arl (Q70L) mutants indicates that the active forms of Arl5a and Arl5b are recruited to Golgi membranes. In contrast to the Arl5b (Q70L) mutant, the predicted GDPrestricted mutant, Arl5b (T30N)-GFP showed a more diffuse cytosolic fluorescent staining pattern with little evidence of a Golgi or juxtanuclear recruitment (Fig. 2A), indicating that the recruitment of Arl5b (Q70L) to the Golgi is specific. Expression of the Arl5b (T30N)-GFP mutant resulted in a loss in the Golgi localisation of the TGN golgin, GCC88, as well as the dispersal of M6P-R and the Golgi stack resident, GRASP65 (Figs. 2B, C). Flow cytometric analysis showed that the total level of M6P-R was not altered in the Arl5b (T30N)-GFP-positive cells (not shown). On the other hand, expression of Arl5b (T30N) did not alter the staining pattern of the cis-Golgi marker, GM130, (Figs. 2A, B). These findings suggest that the Golgi structure, in particular the trans-Golgi, is perturbed when the putative GDP-bound Arl5b mutant is overexpressed.

Depletion of Arl5b does not disrupt the Golgi apparatus We subsequently focused our studies on the functional properties of Arl5b. Stable HeLa cells expressing GFP-tagged Arl5b (Q70L) were generated and sorted for GFP-positive cells by flow cytometry. A polyclonal cell line was established where >80% cells were GFP-positive (Fig. 3). The transfected cell line showed normal growth characteristics (not shown). The Arl5b (Q70L)-GFP fusion protein was located in the Golgi region and showed partial overlap with the cis-Golgi marker GM130 and extensive overlap with the TGN markers, GCC88 and GCC185 (Fig. 3). The more prominent co-localisation of Arl5b with the TGN markers compared with the cis-Golgi marker suggests that Arl5b is enriched on the transGolgi (Fig. 3 see also Fig. 1). Arl5b (Q70L)-GFP, as well as wt Arl5b-GFP, were found to dissociate from the Golgi after cells

were treated with brefeldin A (not shown), again indicating that Arl5b is a functional small G protein. We then used the Arl5b (Q70L)-GFP stable cell line to silence Arl5b with two independent siRNA targets to the human Arl5b sequence. GFP fluorescence was used to monitor the reduction in expression of the exogenous Arl5b (Q70L) in the stable GFP-positive cells. Analysis of Arl5b siRNA treated cells by fluorescence showed a dramatic reduction in GFP fluorescence with <10% cells showing detectable GFP fluorescence (Fig. 4A). Immunoblotting with antiGFP antibodies confirmed a reduction >90% of the levels of Arl5b (Q70L)-GFP and analysis by FACS showed that the GFP intensity was substantially reduced in Arl5b (Q70L)-GFP stable cells treated with Arl5b siRNA-1 or siRNA-2 (Figs. 4B and C). Depletion of Arl5b had no apparent affect on the distribution of the TGN golgins, golgin-97 and GCC185 (Fig. 4D) or the cis-Golgi marker GM130 (not shown) indicating that loss of Arl5b did not result in a major perturbation in Golgi structure. We next performed qPCR to determine the relative levels of Arl5b mRNA in wt HeLa cells and Arl5b (Q70L)-GFP stable cell line. There was an 8-fold increase in Arl5b mRNA in the Arl5b (Q70L)-

Fig. 5 – Analysis of endogenous Arl5b depletion in HeLa cells. Total RNA was isolated from (A) ~2 × 105 wild-type HeLa or stable HeLaArl5b (Q70L)-GFP cells, or (B) wild-type HeLa cells transfected with control siRNA or Arl5b-1/2 siRNA for 72 h. Total RNA was converted to cDNA to setup singleplex reactions in quadruplicate for ARL5B and ARL5A, with internal endogenous reference genes for human GAPDH and RPLPO. qPCR reactions were then performed and analysed using the comparative DeltaDelta CT method. Relative quantification of mRNA levels used control siRNA cells as the normaliser and GAPDH and RPLPO as the internal reference genes. Analyses were performed in quadruplicate for each gene. Data is represented as the mean ± SEM of three experiments. Statistical analysis was performed by a Mann–Whitney U-test (A) and one-way ANOVA (B), using Prism 4/5 (GraphPad Software Inc., USA). * p < 0.05, *** p < 0.0001.

EX PE R IM E NTA L CE L L RE S E ARC H 31 8 (20 1 2 ) 4 6 4 –4 7 7

GFP stable cell line compared with wt HeLa cells (Fig. 5A). Given that the siRNA targets efficiently silenced Arl5b (Q70L)-GFP expression in the stable cell line, it is also likely that endogenous Arl5b would

471

be silenced to a similar level. To directly assess the efficiency of depletion of endogenous Arl5b by these siRNA we used qPCR to determine the silencing of endogenous Arl5b in parental HeLa cells. The

Fig. 6 – Depletion of Arl5b does not disrupt E-cadherin transport to the cell surface. (A–B). HeLaArl5b (Q70L)-GFP stable cell line was transfected with either control or Arl5b-1 or Arl5b-2 siRNA for 48 h and transfected again with E-cadherin-RFP (E-cad-RFP) for 24 h. Cells were harvested in 5 mM EDTA/PBS and surface E-cadherin stained with mouse anti-E-cadherin followed by Alexa Fluor647 conjugated anti-mouse antibodies. (A) FACS analysis of GFP fluorescence to demonstrate silencing by Arl5b siRNAs. (B) FACS analysis of surface E-cadherin. Shown is the percentage of cells in R1 region, each sample is identified by the colour code. (C–E) Analysis of transport rates of E-cadherin to the plasma membrane in Arl5b depleted cells. In (C) FACS plots show the effective removal of cell surface E-cadherin by trypsin in HeLa cells transfected with E-cadherin-YFP. (D–E) Wild-type HeLa cells were transfected with either control or Arl5b-1 or Arl5b-2 siRNA for 48 h and transfected again with E-cadherin-YFP for 24 h, treated with trypsin and then incubated at 37 °C for the indicated period. Surface E-cadherin was stained as described in A. D shows the percentage of E-cadherin-YFP-positive cells with detectable cell surface E-cadherin and E shows the FACS plots of the samples at the 4 h time point. Note the similar expression levels of cell surface E-cadherin in control and Arl5b-depleted cells.

472

EX PE R IM EN TA L C E LL RE S EA RC H 31 8 ( 20 1 2) 4 6 4– 4 7 7

siRNA-1 and siRNA-2 targets showed 90% and 80%, respectively, reduction of endogenous Arl5b mRNA in wild-type HeLa cells (Fig. 5B). Furthermore, Arl5a mRNA levels were unaffected by the siRNA-1 and siRNA-2 targets (Fig. 5B) demonstrating that the siRNA targets were specific for Arl5b.

Depletion of Arl5b modulates endosome-to-Golgi trafficking To determine if Arl5b played a role in membrane trafficking from the TGN, we initially investigated whether anterograde transport was affected by the absence of Arl5b. HeLa cells were transfected with an E-cadherin construct, however both control and Arl5bdepleted cells showed similar levels of cell surface expression of E-cadherin as determined by FACS (Figs. 6A and B), indicating that Arl5b did not influence anterograde transport of this membrane protein. To directly measure the kinetics of anterograde transport of E-cadherin to the cell surface we treated intact cells with trypsin to remove the pool of E-cadherin at the cell surface and then measured the arrival of E-cadherin at the PM over a 4 h period. Trypsin treatment was effective at removal of the majority (>90%) of cell surface E-cadherin (Fig. 6C). An increase in E-cadherin was detected at the cell surface of trypsin-treated cells by 1 h incubation at 37 °C and by 4 h ~40% of E-cad-YFP-positive cells showed E-cadherin at the cell surface (Fig. 6D). The level of E-cadherin at the PM in either untreated or Alrb5b depleted cells was very similar (Figs. 6D, E). Moreover, as the delivery of E-cadherin to the cell surface was inhibited in the presence of cycloheximide (not shown), these experiments directly show that anterograde transport of E-cadherin is independent of Arl5b. Next we investigated the intracellular distribution of the cation-independent mannose-6-phosphate receptor (CI-M6P-R) in Arl5b-depleted HeLa cells. Endogenous CI-M6P-R was localised predominantly to a perinuclear location in Arl5b (Q70L)-GFP stable cells (Fig. 7A control), consistent with the localisation of this receptor in the TGN [23]. However, in Arl5b-depleted cells, CI-M6P-R was distributed more extensively throughout the cytoplasm in punctate structures as well as in the perinuclear region (Fig. 7A). We quantified the fluorescence intensity of CI-M6P-R found located within the Golgi region using GRASP65 staining to mark the location of the Golgi apparatus. Analysis of the fluorescence intensity revealed that there was 25% reduction of CI-M6P-R in the Golgi region of Arl5bdepleted cells compared with untreated cells (Fig. 7B). Similar results were obtained after silencing endogenous Arl5b in untransfected HeLa cells (Fig. 7C) as CI-M6P-R was distributed more extensively throughout the cytoplasm of Arl5b depleted cells using the two independent Arl5b siRNAs (Fig. 7C). These data indicate that the endosome-to-TGN recycling of endogenous CI-M6P-R may be perturbed in the absence of Arl5b. We next examined whether Arl5b may be required for endosome-to-TGN transport of the membrane cargo, TGN38. As TGN38 recycles from the plasma membrane to the TGN directly via the early endosomes, the trafficking of this cargo can be readily monitored by an internalisation assay using TGN38 transfected HeLa cells [22]. To analyse the retrograde trafficking of TGN38 from the plasma membrane to the Golgi apparatus, anti-TGN38 antibodies were internalised at 37 °C and the localisation of the antibody–TGN38 complexes determined by staining fixed cells with Alexa-conjugated-anti-mouse IgG. As expected, the antibody–TGN38 complexes remained restricted to the cell surface

Fig. 7 – Intracellular distribution of mannose-6-phosphate receptor is perturbed in Arl5b-depleted cells. (A) HeLaArl5b (Q70L)-GFP or (C) parental HeLa cells were transfected with either control siRNA or Arl5b-1 siRNA for 72 h, then fixed and stained with mouse CI-M6P-R antibody, followed by Alexa Fluor 568 conjugated anti-mouse IgG. The Golgi was stained with cis-Golgi marker anti-rabbit GRASP-65 antibody, followed by Alexa Fluor 647-conjugated anti-rabbit IgG. Nuclei were stained with DAPI. Confocal images were collected separately. Bars=10 μm. B. The fluorescence intensity of CI-M6P-R in the Golgi region, as marked by GRASP65 staining, of control or Arl5b depleted HeLaArl5b (Q70L)-GFP cells was analysed using MetaMorph. Statistical analysis was performed using a two-sided Mann–Whitney U-test. Results are means and the error bars represent SEM. * p<0.05.

EX PE R IM E NTA L CE L L RE S E ARC H 31 8 (20 1 2 ) 4 6 4 –4 7 7

at 4 °C (Fig. 8A, 0 min). Analysis of internalised TGN38 after 30 min in wild-type HeLa cells showed predominantly a punctate, endosomal, localisation and by 60 min the majority of internalised TGN38 was detected in the Golgi region (Fig. 8A). TGN38 transport in the HeLa Arl5b (Q70L)-GFP stable cell line was also analysed (Fig. 8B). By 30 min of internalisation TGN38 was found predominantly in the Golgi region of many of the Arl5b-GFP expressing cells. Analysis of >100 cells in three independent experiments showed that 40% of Arl5b (Q70L)-GFP cells had TGN38 complexes at the Golgi after 30 min internalisation, compared with <20% of wild-type HeLa cells. This result indicates that the expression of the elevated levels of GTP-bound form of Arl5b may enhance endosome-to-Golgi transport. The effect of silencing Arl5b on the retrograde transport of TGN38 was then investigated. There was a marked reduction in the endosome-to-Golgi transport of internalised TGN38 in Arl5b (Q70L)-GFP cells treated with Arl5b siRNA compared with control siRNA (Figs. 9A, B). The majority of TGN38 was located in

473

endosomal punctate structures after 60 min internalisation in Arl5b depleted cells with only low levels within the Golgi region (Fig. 9B). In contrast Arl5b (Q70L)-GFP cells treated with a control siRNA showed that TGN38 was transported from the cell surface to the Golgi by 60 min (Fig. 9A). Analysis of >100 cells showed a significant difference in the endosomal/Golgi distribution of TGN38 after 60 min internalisation between control and Arl5b depleted cells; TGN38 was predominantly located in endosomal structures in ~60% of Arl5b depleted cells compared with only 10% of control cells (Fig. 9C). A second independent siRNA target to Arl5b showed very similar results (Fig. 9C). Quantitative analysis was also performed to measure the fluorescence levels of the TGN38–antibody complexes at the Golgi after 60 min internalisation; these analyses showed a 50% decrease in fluorescence intensity of TGN38 complexes at the Golgi in Arl5b-depleted cells compared with control cells (Fig. 9D), confirming the conclusion that there is a dramatic retardation in endosome-to-TGN transport of TGN38 in the absence of Arl5b.

Fig. 8 – Endosome-to-Golgi trafficking of TGN38 is accelerated in cells overexpressing Arl5b. Wild-type HeLa (A) and HeLaArl5b (Q70L)-GFP (B) cells were transfected with TGN38 and 24 h later cells were incubated with anti-TGN38 antibodies for 30 min on ice. Unbound antibodies were removed, and monolayers incubated for either 30 min or 60 min at 37 °C to internalise the antibody–TGN38 complexes. Monolayers were then fixed in 4% PFA, permeabilised and stained with Alexa568-conjugated anti-mouse IgG. Nuclei were stained with DAPI. In B arrows indicate GFP-positive cells that express TGN38, star indicates a GFP-negative cells which expresses TGN38. Bar = 10 μm.

474

EX PE R IM EN TA L C E LL RE S EA RC H 31 8 ( 20 1 2) 4 6 4– 4 7 7

The impact of Arl5b on retrograde transport of Shiga toxin was also investigated in both Arl5b (Q70L)-GFP cells and parental HeLa cells (Figs. 10B, C). Shiga toxin fragment B (STxB) was incubated with HeLa cells on ice for 30 min and surface bound STxB then internalised at 37 °C for 30–90 min. As expected STxB was first detected in the Golgi region in control cells after 30 min at 37 °C and the bulk of internalised STxB was located at the Golgi after 60 min (not shown) and 90 min internalisation (Fig. 10A). In Arl5b (Q70L)-GFP cells depleted of Arl5b the majority of internalised STxB was located in punctate structures after an extended internalisation period of 90 min (Fig. 10C). Similar results were

obtained using the two independent Arl5b siRNA targets (Fig. 10C). Quantitative analysis of STxB fluorescence intensity at the Golgi revealed that there was a significant decrease in Golgilocalised STxB in Arl5b-depleted Arl5b (Q70L)-GFP cells compared with Arl5b (Q70L)-GFP cells treated with control siRNA (Fig. 10E). A similar result was observed in parental HeLa cells (Figs. 10B and D). These results strongly support a role for endogenous Arl5b in efficient endosome-to-TGN transport of Shiga toxin. To further exclude off target effects of the siRNAs we generated a siRNA-1 resistant Arl5b-GFP mutant and expressed this Arl5b mutant in siRNA treated wild-type HeLa cells. Rescued cells were detected by GFP expression. Internalised STxB was efficiently trafficked to the Golgi of Arl5b siRNA-1 treated GFP-positive HeLa cells after an internalisation period of 90 min (Fig. 10F). Shiga toxin was localised to the Golgi in all cells which expressed the Arl5b rescue construct, confirming that the perturbation in retrograde transport was due specifically to the depletion of Arl5b.

Discussion Given the importance of ARF/ARLs in cellular regulation it is relevant to define the roles of the poorly defined members of the ARL sub-family. Here we have analysed the location of Arl5a and Arl5b in HeLa cells, and shown that both Arls are recruited specifically to the Golgi apparatus. In particular, the finding that Arl5b (Q70L)GFP is predominantly Golgi-localised whereas Arl5b (T30N)-GFP is dispersed throughout the cytoplasm is highly suggestive that this ARL gene encodes a functional small G protein. Moreover, the demonstration that Arl5b plays a role in retrograde transport highlights the role of Arl small G proteins in regulation of Golgi

Fig. 9 – Endosomes-to-Golgi trafficking of TGN38 is retarded in cells depleted of Arl5b. HeLaArl5b (Q70L)-GFP cells were transfected with either (A) control siRNA or (B) Arl5b-1 siRNA for 48 h and then transfected with TGN38 for an additional 24 h. Monolayers were then incubated with mouse anti-TGN38 antibodies for 30 min on ice, washed in PBS, and incubated in serum-free media for 60 min at 37 °C. Monolayers were then fixed in 4% PFA, permeabilised and stained with Alexa568-conjugated anti-mouse IgG. The Golgi was stained with the cis-Golgi marker anti-rabbit GRASP-65 antibody, followed by Alexa Fluor 647-conjugated anti-rabbit IgG. Bar = 10 μm (C) Depicts the distribution of internalised TGN38 in HeLa cells treated with control siRNA, Arl5b-1 siRNA and Arl5b-2 siRNA after 60 min internalisation at 37 °C. Black indicates the number of cells where the majority of TGN38 is Golgi-localised and white indicates the number of cells where TGN38 is predominantly endosomal-localised. Statistical analysis was performed on >100 cells using a two-sided Fisher's Exact Test. *** p < 0.0001. (D) Quantitation of antibody-TGN38 levels within the Golgi of siRNA treated cells after 60 min internalisation at 37 °C. The total fluorescence intensity in each transfected cell (>300 pixel area) and the fluorescence in the area outside the Golgi region (masked by GCC185) was determined and the percentage of the fluorescence within the Golgi calculated by subtraction (n > 17 for each sample). Statistical analysis was performed using an unpaired two-sided Mann–Whitney U-test. Error bar represents SEM. * p < 0.05.

EX PE R IM E NTA L CE L L RE S E ARC H 31 8 (20 1 2 ) 4 6 4 –4 7 7

475

membrane traffic. As Arl5b is widely expressed in eukaryotes [7,24] it is likely to have a key role in retrograde transport in many species. Arl5b represents the second ARL family member to function at the trans-Golgi; the well-defined Arl1 plays a key role in the maintenance of Golgi structure and regulation of membrane transport into and from the TGN [12,25]. Confocal microscopy and functional studies indicate that Arl5b is located on the trans-face of the Golgi. Double-labelling with a number of cis and trans-markers indicated that Arl5b-GFP is enriched on the trans-side of the Golgi. However, these microscopic studies do not distinguish whether Arl5b-GFP is restricted to the trans-Golgi or whether it is found across the Golgi stack. Silencing of Arl5b resulted in a perturbation of the TGN-localised M6P-R, also highlighting a functional association of Arl5b with the TGN. Moreover, expression of the predicted GDP-restricted Arl5b construct resulted in perturbation of TGN components. A trans-Golgi location is relevant to the regulation of the export of traffic from the Golgi and also the receipt of traffic from endosomes. The localisation of Arl5b appeared to be dependent on nucleotide state of Arl5b as the predicted GTP-bound form of Arl5b was associated with the Golgi in a non-saturable dependent manner whereas the predicted GDP-restricted form of Arl5b was localised throughout the cytoplasm. The limiting step in Arl5b recruitment to the Golgi, as for other small G proteins, is likely to be GDP-GTP exchange catalysed by guanine exchange factors. Hence the behaviour of the GFP-tagged Arl5b constructs is likely to reflect the endogenous Arl protein. The functional importance of Arl5b was established by the analysis of different cargo molecules. Firstly, the endosome-TGN recycling of M6P-R was perturbed in the absence of endogenous Arl5b. M6P-R cycles between the TGN and the early and late endosomes [23,26] and is likely to use multiple transport pathways. Secondly, the retrograde transport of TGN38 from early endosomes to the TGN is influenced by Arl5b. Enhanced transport rates of TGN38 were observed in cells overexpressing Arl5b-GFP whereas retarded transport of

Fig. 10 – Retrograde transport of Shiga toxin is dependent on Arl5b. (A,B,F) HeLa and (C) HeLa Arl5b (Q70L)-GFP cells were transfected with either control siRNA or Arl5b-1 or Arl5b-2 siRNA, as indicated, for 72 h. Cy3-conjugated STxB was bound to cells on ice for 30 min, washed in cold PBS, and then incubated in serum-free media at 37 °C for 90 min. Cells were fixed and permeabilised and endogenous GCC185 was stained with rabbit anti-GCC185 antibodies followed by Alexa647-conjugated anti-rabbit IgG. Nuclei were stained with DAPI. In (B) Arl5b (Q70L)-GFP was detected by GFP fluorescence. Confocal images were collected separately. (D, E) Quantitation of Shiga toxin levels within the Golgi of siRNA treated (D) HeLa cells and (E) HeLaArl5b (Q70L)-GFP cells. The total fluorescence intensity in each transfected cell (>300 pixel area) and the fluorescence in the area outside the Golgi region (masked by GCC185) was determined and the percentage of the fluorescence within the Golgi calculated by subtraction (n > 12 for each sample). Statistical analysis was performed using an unpaired two-sided Mann–Whitney U-test. Error bar represents SEM. * p < 0.05; *** p < 0.0001. (F) Expression of an siRNA-1 resistant Arl5b-GFP construct in Arl5b-1 siRNA treated HeLa cells. Stars indicate cells expressing the Arl5b-GFP rescue construct. Bars= 10 μm.

476

EX PE R IM EN TA L C E LL RE S EA RC H 31 8 ( 20 1 2) 4 6 4– 4 7 7

TGN38 occurred in Arl5b depleted cells. And thirdly, the retrograde transport of Shiga toxin was impeded in the absence of Arl5b. The altered rates of Shiga toxin transport in both Arl5b-depleted Arl5b (Q70L)-GFP cells and parental HeLa cells argues that silencing of endogenous Arl5b is causing this block in retrograde transport. The block in Shiga transport to the Golgi could be rescued with a siRNA-1-resistant Arl5b mutant, findings which exclude off-targets affects of the Arl5b RNAi. On the basis of these findings we propose that Arl5b is influencing a common requirement of endosome-to-TGN transport pathways used by these different cargoes. One possibility is that Arl5b is important for the recycling of key machinery from the TGN back to the endosomes, such as SNAREs, hence a block in the efficiency of recycling of machinery components could influence multiple retrograde transport pathways. The function of Arl5b clearly differs from Arl1 that is also located on the trans-Golgi. The overexpression or depletion of Arl5b has little effect on the Golgi structure as detected by light microscopy whereas the constitutively active Arl1 mutant caused an expansion of the membranes of the TGN [12]. The finding that the dominantnegative Arl5b perturbs Golgi structure could be explained by effectors of Arl5b that are shared with other small G proteins. Secondly, activated Arl1(Q70L) inhibited traffic along the secretory pathway [12] whereas activated Arl5b showed little inhibition of Golgi to cell surface transport of E-cadherin. Thirdly, the effectors of Arl1 include the GRIP domain TGN golgins, p230 and golgin-97 [11], whereas we found no difference in the localisation of these TGN golgins on Arl5b depletion, indicating that effectors for these two Arls are different. As both Arl5b and Arl1 are important in regulating retrograde transport it is likely that their roles are distinct and it will now be important to identify the effectors for the Arl5b protein. A number of other small G proteins have been shown to be involved in the regulation of endosome-to-TGN retrograde transport pathways, including Rab6 [27], Rab11 [28] and Arl1 [11,28]. The requirement for multiple small G proteins probably reflects their diverse functions in regulating membrane trafficking [29]. Our study focused on Arl5b, however, it is possible that Arl5a also regulates Golgi membrane transport. Although Arl5a and Arl5b are 80% identical there are a number of examples where closely related isoforms of small G proteins have independent functions, such as Rab6A and Rab6B [27] hence it is very plausible that Arl5a and Arl5b also have independent roles. In summary we have demonstrated that Arl5b is Golgi-localised and is a novel regulator of retrograde transport. This study also highlights the need to fully define the set of small G proteins at the TGN for a better understanding of the regulation of the complex anterograde and retrograde transport pathways in this membrane compartment.

Conflict of interest The authors declare no financial or personal conflict of interest.

Acknowledgment This work was supported by funding from the Australian Research Council.

REFERENCES

[1] M.C. Derby, P.A. Gleeson, New insights into membrane trafficking and protein sorting, Int. Rev. Cytol. 261 (2007) 47–116. [2] A.K. Gillingham, S. Munro, The small G proteins of the arf family and their regulators, Annu. Rev. Cell Dev. Biol. 23 (2007) 579–611. [3] S.R. Pfeffer, Unsolved mysteries in membrane traffic, Annu. Rev. Biochem. 76 (2007) 629–645. [4] B. Short, A. Haas, F.A. Barr, Golgins and GTPases, giving identity and structure to the Golgi apparatus, Biochim. Biophys. Acta 1744 (2005) 383–395. [5] B. Goud, P.A. Gleeson, TGN golgins, Rabs and cytoskeleton: regulating the Golgi trafficking highways, Trends Cell Biol. 20 (2010) 329–336. [6] C. D'Souza-Schorey, P. Chavrier, ARF proteins: roles in membrane traffic and beyond, Nat. Rev. Mol. Cell Biol. 7 (2006) 347–358. [7] S. Pasqualato, L. Renault, J. Cherfils, Arf, Arl, Arp and Sar proteins: a family of GTP-binding proteins with a structural device for 'front-back' communication, EMBO Rep. 3 (2002) 1035–1041. [8] J.W. Tamkun, R.A. Kahn, M. Kissinger, B.J. Brizuela, C. Rulka, M.P. Scott, J.A. Kennison, The arflike gene encodes an essential GTP-binding protein in Drosophila, Proc. Natl. Acad. Sci. U. S. A. 88 (1991) 3120–3124. [9] H. van Valkenburgh, J.F. Shern, J.D. Sharer, X. Zhu, R.A. Kahn, ADP-ribosylation factors (ARFs) and ARF-like 1 (ARL1) have both specific and shared effectors: characterizing ARL1-binding proteins, J. Biol. Chem. 276 (2001) 22826–22837. [10] S.L. Lowe, S.H. Wong, W. Hong, The mammalian ARF-like protein 1 (Arl1) is associated with the Golgi complex, J. Cell Sci. 109 (Pt 1) (1996) 209–220. [11] L. Lu, W. Hong, Interaction of Arl1-GTP with GRIP domains recruits autoantigens Golgin-97 and Golgin-245/p230 onto the Golgi, Mol. Biol. Cell 14 (2003) 3767–3781. [12] L. Lu, H. Horstmann, C. Ng, W. Hong, Regulation of Golgi structure and function by ARF-like protein 1 (Arl1), J. Cell Sci. 114 (2001) 4543–4555. [13] B. Panic, O. Perisic, D.B. Veprintsev, R.L. Williams, S. Munro, Structural basis for Arl1-dependent targeting of homodimeric GRIP domains to the Golgi apparatus, Mol. Cell 12 (2003) 863–874. [14] M. Wu, L. Lu, W. Hong, H. Song, Structural basis for recruitment of GRIP domain golgin-245 by small GTPase Arl1, Nat. Struct. Mol. Biol. 11 (2004) 86–94. [15] M.C. Derby, C. van Vliet, D. Brown, M.R. Luke, L. Lu, W. Hong, J.L. Stow, P.A. Gleeson, Mammalian GRIP domain proteins differ in their membrane binding properties and are recruited to distinct domains of the TGN, J. Cell Sci. 117 (2004) 5865–5874. [16] F.J. Houghton, P.L. Chew, S. Lodeho, B. Goud, P.A. Gleeson, The localization of the Golgin GCC185 is independent of Rab6A/A' and Arl1, Cell 138 (2009) 787–794. [17] Y. Li, W.G. Kelly, J.M. Logsdon Jr., A.M. Schurko, B.D. Harfe, K.L. Hill-Harfe, R.A. Kahn, Functional genomic analysis of the ADP-ribosylation factor family of GTPases: phylogeny among diverse eukaryotes and function in C. elegans, FASEB J. 18 (2004) 1834–1850. [18] Z.Z. Lieu, M.C. Derby, R.D. Teasdale, C. Hart, P. Gunn, P.A. Gleeson, The golgin, GCC88, is required for efficient retrograde transport of cargo from the early endosomes to the trans-golgi network, Mol. Biol. Cell 18 (2007) 4979–4991. [19] J.G. Lock, L.A. Hammond, F. Houghton, P.A. Gleeson, J.L. Stow, E-cadherin transport from the trans-Golgi network in tubulovesicular carriers is selectively regulated by golgin-97, Traffic 6 (2005) 1142–1156. [20] M.R. Luke, L. Kjer-Nielsen, D.L. Brown, J.L. Stow, P.A. Gleeson, GRIP domain-mediated targeting of two new coiled-coil proteins, GCC88 and GCC185, to subcompartments of the trans-Golgi network, J. Biol. Chem. 278 (2003) 4216–4226.

EX PE R IM E NTA L CE L L RE S E ARC H 31 8 (20 1 2 ) 4 6 4 –4 7 7

[21] F. Mallard, C. Antony, D. Tenza, J. Salamero, B. Goud, L. Johannes, Direct pathway from early/recycling endosomes to the Golgi apparatus revealed through the study of shiga toxin B-fragment transport, J. Cell Biol. 143 (1998) 973–990. [22] M.C. Derby, Z.Z. Lieu, D. Brown, J.L. Stow, B. Goud, P.A. Gleeson, The trans-golgi network golgin, GCC185, is required for endosome-to-golgi transport and maintenance of golgi structure, Traffic 8 (2007) 758–773. [23] P. Ghosh, N.M. Dahms, S. Kornfeld, Mannose 6-phosphate receptors: new twists in the tale, Nat. Rev. Mol. Cell Biol. 4 (2003) 202–212. [24] M. Breiner, A. Schurmann, W. Becker, H.G. Joost, Cloning of a novel member (ARL5) of the ARF-family of Ras-related GTPases, Biochim. Biophys. Acta 1308 (1996) 1–6. [25] Y.W. Liu, S.W. Lee, F.J. Lee, Arl1p is involved in transport of the GPI-anchored protein Gas1p from the late Golgi to the plasma membrane, J. Cell Sci. 119 (2006) 3845–3855.

477

[26] J.S. Bonifacino, R. Rojas, Retorgrade transport from endosomes to the trans-Golgi network, Nat. Rev. Mol. Cell Biol. 7 (2006) 568–579. [27] E. Del Nery, S. Miserey-Lenkei, T. Falguieres, C. Nizak, L. Johannes, F. Perez, B. Goud, Rab6A and Rab6A′ GTPases play non-overlapping roles in membrane trafficking, Traffic 7 (2006) 394–407. [28] M. Wilcke, L. Johannes, T. Galli, V. Mayau, B. Goud, J. Salamero, Rab11 regulates the compartmentalization of early endosomes required for efficient transport from early endosomes to the trans-golgi network, J. Cell Biol. 151 (2000) 1207–1220. [29] B.L. Grosshans, D. Ortiz, P. Novick, Rabs and their effectors: achieving specificity in membrane traffic, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 11821–11827.