- Email: [email protected]
Shf, a Shb-like Adapter Protein, Is Involved in PDGF-α-Receptor Regulation of Apoptosis
Biochemical and Biophysical Research Communications 278, 537–543 (2000) doi:10.1006/bbrc.2000.3847, available online at http://www.idealibrary.com on
Shf, a Shb-like Adapter Protein, Is Involved in PDGF-␣-Receptor Regulation of Apoptosis Cecilia K. Lindholm,* ,1 J. Daniel Frantz,† ,1 Steven E. Shoelson,† and Michael Welsh* ,2 *Department of Medical Cell Biology, Uppsala University, Box 571, Biomedicum, S-75123 Uppsala, Sweden; and †Research Division, Joslin Diabetes Center, Boston, Massachusetts
Received October 19, 2000
Recent work has implicated the importance of adapter proteins in signal transduction. To identify homologues of the previously identified adapter protein Shb, database searches were performed. A Shblike protein was found which we have named Shf. Shf contains an SH2 domain and four putative tyrosine phosphorylation sites and is mainly expressed in skeletal muscle, brain, liver, prostate, testis, ovary, small intestine, and colon. The SH2 domain of Shf bound to the PDGF-␣-receptor at tyrosine-720, but not to the PDGF--receptor in PAE cells. Pervanadate induced tyrosine phosphorylation of Shf in NIH3T3 fibroblasts overexpressing this protein, whereas PDGF-AA alone had no detectable effect. NIH3T3 cells overexpressing Shf displayed significantly lower rates of apoptosis than control cells in the presence of PDGF-AA. Our findings suggest a role for the novel adapter Shf in PDGF-receptor signaling and regulation of apoptosis. © 2000 Academic Press
Key Words: Shf; Shb; PDGF-receptor; PDGF; apoptosis; cell signaling.
It is commonly the case that growth factor receptors, such as PDGF- and EGF-receptors, undergo dimerization and autophosphorylation upon binding to their ligands. This generates phosphorylated sites on the receptors capable of binding signaling proteins, such as adapters and proteins with intrinsic enzymatic activity. Some of the proteins known to bind the PDGFreceptors include Src, PLC-␥1, Crk, SHP-2, p85 PI3K, Grb2, Shc and Shb (for review see (1)). Signaling downstream of the PDGF-receptor has been shown to induce both apoptotic and antiapoptotic responses, involving several signaling pathways, in1
These authors have contributed equally to the work presented in this article. 2 To whom correspondence should be addressed Fax: 46-18556401. E-mail: [email protected].
cluding the PI3-kinase and Ras pathways (for review see (2)) Adapter proteins are characterized by their ability to mediate protein-protein interactions, thereby linking growth factor receptors with cytosolic proteins containing enzymatic activity or transcriptional-activation domains. These interactions are mediated by specific binding domains, like Src homology 2 (SH2), phosphotyrosine-binding (PTB) and Src homology 3 (SH3) domains (for review see (3)). Many adapter proteins also contain tyrosine phosphorylation sites responsible for binding SH2 and PTB domains. A recently described adapter protein, Shb, has been shown to be involved in tyrosine kinase signaling. Shb is composed of five proline-rich sequences, a PTBdomain (4), potential tyrosine phosphorylation sites and an SH2 domain (5). The SH2 domain has been shown to associate with the PDGF-receptors, the FGFR-1 (6) and the T cell receptor (4). Overexpression of Shb has also been shown to induce apoptosis under low serum conditions (7), an effect that could be counteracted by the addition of PDGF-BB. Two other Shb homologues, Shd and She (8) were recently identified, suggesting the existence of a family of adapter proteins with similar structural features. To identify additional members of this family, we have performed database searches and found a novel Shblike protein that we have named Shf. In this study we present the cloning of the novel adapter Shf and characterize its interaction with the PDGF-receptor. We also describe its role in promoting survival of NIH3T3 fibroblasts in the presence of PDGF-AA. MATERIALS AND METHODS Antibodies and cell lines. Monoclonal anti-phosphotyrosine 4G10 was purchased from Upstate Biotechnology (Lake Placid, NY). Anti-HA mAb was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Porcine aortic endothelial cells (PAE) overexpressing the PDGF-␣-receptor and the PDGF--receptor were a kind gift from Dr.
537
0006-291X/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
Vol. 278, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
C-H. Heldin (Ludvig Institute for Cancer Research, Uppsala, Sweden). PAE cells were maintained in Ham’s F12 medium (Hyclone) complemented with 10% FCS (Hyclone). NIH3T3 cells were kept in Dulbecco’s minimal Eagle medium (Hyclone) complemented with 10% FcII (Hyclone). Cloning of Shf. A human EST (accession R59413) related to the coding region of the Shb SH2 domain was identified in the GenBank dbest database using the TBLASTN search algorithm. The putative Shb homologue was named Shf. The cDNA clone corresponding to the EST sequence was obtained from the IMAGE consortium via the ATCC and the 1.5-kb insert sequenced. A 5⬘ RACE product was amplified by PCR from human skeletal muscle cDNA (MarathonReady cDNA, Clontech) using the supplied anchor primer (AP1) and a Shf specific primer (18 –26: 5⬘GCCAAGGTAGGTCTTTGATGACCTTA3⬘). The 1.0-kb PCR product was subcloned into pT7Blue (pT7Blue TA, Novagen), and sequenced. A cDNA encoding an intact Shf open reading frame was obtained by PCR from human skeletal muscle cDNA (Quick-Clone cDNA, Clontech). The PCR was carried out using the primers RT18-1 (5⬘CCAAAGGATTCCTATGAGGC3⬘) and RT18-2 (5⬘GGCTGGGTACAGGTCTATCA3). The 1.5-kb product was subcloned into pT7Blue and sequenced. DNA constructs and transfections. The Shf SH2 domain was amplified by PCR and subcloned into the bacterial GST fusion vector pGEX4T-1 (Shf-SH2-GST). Full-length Shf was amplified by PCR and subcloned into the retroviral vector pBABE.HA (Shf-BABE). This expression vector directs the synthesis of proteins tagged at their C-termini with HA epitopes. NIH3T3 cells were transfected with Shf-BABE or empty vector using Lipofectamine as recommended by the manufacturer. Cells overexpressing Shf were selected using 4 g/ml puromycin. Several independent clones were established (NIH-Shf and NIH-control). Northern blot analyses. The 1.5-kb Shf coding region was isolated by gel electrophoresis, labeled with [ 32P]dATP by the random hexamer method (PrimeIt II, Stratagene), and hybridized to multiple human tissue mRNA blots (MTN I and II, Clontech), as recommended. The membranes were washed at high stringency and exposed to a storage phosphor screen (Molecular Dynamics). Immunoprecipitations and Western blot. NIH-Shf and NIHcontrol cells were serum starved (0.1% FcII) for 24 h. The cells were then either unstimulated, stimulated with pervanadate only for 20 min at 37°C, or stimulated with both pervanadate (20 min) and PDGF-AA (added after 10 min of pervanadate treatment) at 37°C. The cells were then washed in ice-cold PBS and subsequently lysed in Triton lysis buffer (0.15 M NaCl, 0.05 M Tris pH 7.5, 0.5% Triton X-100, 1 mM NaF, 0.1 mM orthovanadate, 100 units/ml Trasylol, 2 mM PMSF) on ice. Nuclei were pelleted by centrifugation, and cell extracts were incubated on ice with hemagglutinin (␣-HA) antibody. Immune complexes were pelleted with 50 l protein A-sepharose and subsequently washed three times with PBS, 1% Triton. The samples were then resolved by SDS–PAGE and electric transfer onto Immobilon filter (Millipore) in 20% methanol, 190 mM glycine, 23 mM Tris and 0.02% SDS. The blots were blocked in 5% BSA in PBS, 0.5% Tween 20 and incubated with primary antibodies as indicated. Immunoreactivity was detected using horseradish peroxidaseconjugated secondary antibodies and ECL (Amersham-Pharmacia Biotech, Uppsala, Sweden). Binding experiments. PAE (porcine aortic endothelial) cells expressing PDGF-␣-receptor or PDGF--receptor were serum starved (1% FCS in Ham’s) for 24 h. The cells were then either unstimulated or stimulated with PDGF-BB (20 ng/ml) for 10 min at 37°C. The cells were then washed in PBS and subsequently lysed in Triton lysis buffer as described above. Nuclei were pelleted and cell extracts were incubated for 30 min with Shf-SH2-GST fusion protein or GST (control), coupled to glutatione-Sepharose beads (Amersham-Pharmacia
Biotech, Uppsala, Sweden). The beads were then washed and subjected to SDS–PAGE and Western blotting. Peptide inhibition experiments. PDGF-AA and peptides corresponding to tyrosine-phosphorylation sites in the PDGF- ␣-receptor used in this paper were a kind gift from C-H Heldin (Ludvig Institute for Cancer research, Uppsala, Sweden). The PDGF-␣-receptorpeptides used were Y572/74, KKKKKISPDGHEpYIpYVDPMQLPY; Y720, KKKKESTRSpYVILSFENNG; Y768, LYDRPASpYKKKSM; Y988, MRVDSDNApYIGVTYKNE; Y993, AYIGVTpYKNEED; Y1018, LDEQRLSADSGpYIIPLPDID. For peptide inhibition experiments, NIH3T3 cells were serum starved (0.1% FcII) for 24 h. The cells were subsequently stimulated with pervanadate for 10 min at 37°C, washed in PBS and lysed in Triton lysis buffer as described above. Nuclei were pelleted by centrifugation, and cell extracts were incubated with immobilized Shf-SH2-GST fusion protein in the presence of 100 M phosphorylated synthetic peptides, for 30 min. The Sepharose beads were then washed and subjected to SDS–PAGE and Western blotting. Measurement of cell proliferation. 3 ⫻ 10 4 cells from each of 2 separate NIH3T3 clones expressing Shf and 2 control clones expressing empty vector were cultured in DMEM with 0.1% FcII serum. The cells were counted using a Bu¨rker chamber after 24, 48, 72, and 96 h. The same experiment was also performed in the presence of 5 ng/ml PDGF-AA and the cells were counted as above. Determination of apoptosis. Subconfluent cells from two independent NIH-Shf clones and two NIH-control clones, were serum starved (0.1% FcII) for 3 days, with or without PDGF-AA. The cells were then washed in PBS, trypsin treated and then labeled with Annexin V-FITC and propidium iodide according to the instructions included in the kit (Annexin-V-FLUOS Staining Kit from Boehringer Mannheim, Germany). The cells were then sorted on a flow cytometer (Becton Dickinson). Electronic compensation was used to eliminate bleed-through fluorescence. Data analysis was performed with Cell Quest software (Becton-Dickinson). The same procedure was also performed with cells grown in 10% FcII (Shf and control).
RESULTS Identification of the Novel Adapter Shf To identify additional members of the Shb family of adapter proteins we performed similarity searches in GenBank for sequences homologous to the Shb SH2 domain. Two Shb-like proteins called Shd and She had already been identified (8), and our search revealed a third Shb homologue, which we denominate Shf. The original clone contained a 1.5-kb insert encoding a truncated protein, and in order to obtain the full sequence we performed 5⬘RACE using a Shf specific primer. By these means the complete 2420-bp cDNA sequence was obtained; the deduced amino acid sequence is shown in Fig. 1A. The open reading frame contains 480 amino acids and consists of four putative tyrosine phosphorylation sites and an SH2 domain, all of these with high sequence homology to Shb (Fig. 1B). Shf shares 43% sequence identity with Shb and 40% sequence identity with Shd. Tissue Expression of Shf Previous studies showed that Shb is ubiquitously expressed by virtue of its presence in all tissues and cell lines tested (4, 5). We therefore investigated the
538
Vol. 278, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Deduced amino acid sequence of human Shf and Northern blot analysis. (A) Deduced amino acid sequence of human Shf. (B) Comparison of the putative tyrosine phosphorylation sites and the SH2 domains in Shf, Shb, and Shd. (C) Human tissue mRNA blots from heart (h), brain (b), placenta (p), lung (l), liver (li), skeletal muscle (sm), kidney (k), pancreas (pa), spleen (s), thymus (t), prostate (pr), testis (te), ovary (o), small intestine (si), colon (c), and periferal blood lymphocytes (bl) were hybridized with [ 32P]dATP labeled Shf cDNA. Bands of 2.6 and 1.8 kb are indicated in the figure.
tissue distribution of Shf expression. Northern blot analysis revealed expression of Shf in skeletal muscle as a 1.8 kb transcript and in brain, liver, prostate, testis, ovary, small intestine, and colon as a 2.6-kb band (Fig. 1C), suggesting the possibility of alternatively spliced products. Shf Binds to Tyrosine 720 in the PDGF-␣-Receptor via Its SH2 Domain We have previously noted that Shb interacts with the PDGF-receptors via its SH2 domain (5), and we decided to investigate if this was also the case for Shf. PAE cells overexpressing either the PDGF-␣- or -receptors were treated with PDGF-BB or not and lysates were incubated with either immobilized GST, or
the immobilized SH2 domain of Shf fused to GST (ShfSH2-GST). Western blot analysis using a phosphotyrosine antibody revealed a band corresponding to the PDGF-receptor in the PDGF-stimulated PAE cells overexpressing the ␣-receptor (Fig. 2A). PDGF-BB is known to stimulate both the PDGF-␣- and --receptors (9). Our results show an association between the Shf SH2 domain and the PDGF-␣-receptor after its phosphorylation. In order to identify phosphorylation sites in the PDGF-␣-receptor likely to bind the SH2 domain of Shf we used phosphopeptides composed of the sequences corresponding to known tyrosine phosphorylation sites in the PDGF-␣-receptor and tested these for their ability to displace the binding between the PDGF-receptor
539
Vol. 278, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. The SH2 domain of Shf associates with tyrosine 720 in the PDGF-␣-receptor. (A) PDGF-BB stimulated or unstimulated PAE cells expressing either the PDGF-␣-receptor or the PDGF--receptor were lysed and mixed with immobilized Shf-SH2-GST fusion protein. The samples were separated on SDS–PAGE before Western analysis for phosphotyrosine (4G10). The position of the PDGF-␣-receptor is indicated in the figure. (B) Lysates from pervanadate-stimulated cells were incubated together with immobilized Shf-SH2-GST in the absence or presence of peptides corresponding to tyrosine phosphorylation sites in the PDGF-␣-receptor. The peptides are as indicated in the panel to the right. The protein complexes were subjected to Western blotting analysis using phosphotyrosine antibody. The percentage inhibition of PDGF-receptor binding was determined using densitometric scanning. All values were normalized relative the value obtained in the absence of peptide, which was set to 100%. Means ⫾ SEM for three independent experiments are given and * denotes P ⬍ 0.05 when compared to control (100%).
and Shf SH2 domain. Lysates from pervanadate treated NIH3T3 cells (to obtain maximally phosphorylated PDGF-␣-receptor) were incubated together with the peptides and immobilized Shf-SH2-GST fusion protein. The PDGF-receptor was detected using antiphosphotyrosine antibody (4G10). The peptide corresponding to phosphotyrosine 720 decreased PDGFreceptor binding to the Shf SH2 domain by 70% (Fig. 2B). This result is in agreement with the binding site of the Shf related protein Shb, which also was found to associate with Y720 of the PDGF-␣-receptor (10). Of the other peptides that were tested, Y572/74 (the Srcbinding site), Y768, Y988, Y993, and Y1018, only Y768 showed a slight inhibition of the Shf-PDGFR binding (Fig. 2B). We therefore conclude that tyrosine 720 in the PDGF-␣-receptor is a preferred binding site for the Shf SH2 domain.
Shf Is Phosphorylated upon Pervanadate Stimulation in NIH3T3 Cells To further assess a role for Shf in cell signaling, NIH3T3 fibroblasts were transfected with HA-tagged Shf cDNA and stable clones were then selected (Fig. 3A). Two such clones overexpressing Shf (8 and 18) were used to study the phosphorylation of this protein. Shf overexpressing cells and control cells were stimulated with PDGF-AA, the tyrosine phosphatase inhibitor pervanadate and a combination of both and then immunoprecipitated using the HA-antibody. We could not detect any phosphorylation of Shf when cells were stimulated with PDGF-AA alone (results not shown). However, pervanadate stimulation causes strong tyrosine phosphorylation of Shf (Fig. 3B). The combined treatment with pervanadate plus PDGF-AA did not further elevate the phosphorylation of Shf. This indi-
540
Vol. 278, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Tyrosine phosphorylation of Shf in NIH3T3 fibroblasts. (A) Whole cell lysates from one NIH3T3-control clone and two Shf overexpressing NIH3T3 clones (NIH-Shf 8 and 18) were subjected to SDS–PAGE and Western blot analysis using anti-HA antisera. The position of Shf is indicated with an arrow in the figure. (B) NIH3T3 cells (NIH-control) or NIH3T3 cells stably overexpressing HA-tagged Shf (NIH-Shf) were stimulated with pervanadate and PDGF-AA, pervanadate alone or left unstimulated. Cell lysates were subjected to immunoprecipitation using an anti-HA antibody and the complexes were analyzed by Western analysis with phosphotyrosine antibody. The blot was then stripped and reprobed with HA antibody to assess equal loading.
cates that Shf is phosphorylated, but also rapidly dephosphorylated, in NIH3T3 fibroblasts. Involvement of Shf in Proliferation and Apoptosis Since overexpression of the Shf-like protein Shb in NIH3T3 cells has been shown to decrease cell growth in the absence of serum, we performed similar experiments in the Shf overexpressing cells. NIH-Shf and NIH-control cells were cultured in a low serum content (0.1% FcII) with or without the addition of PDGF-AA for four consecutive days. NIH-Shf cells grown in 0.1% serum displayed similar rates of proliferation as the control cells. In the presence of PDGF-AA, however, the NIH-Shf cells increased significantly in number between day 3 and 4, as compared with control cells (Figs. 4A and 4B). This increase in cell growth when Shf is overexpressed indicates that Shf might be involved in the regulation of proliferation. One possible explanation for the increased proliferation of the Shf cells could be decreased rates of apoptosis. Subconfluent NIH-Shf and NIH-control cells were serum-starved for 3 days, in the absence or presence of PDGF-AA before staining with annexin (as an indication of apoptosis) and propidium iodide. Flow cytometry revealed two populations with altered characteristics compared with the main population. The apoptotic population showed strong staining for annexin (FL-1) and slightly elevated levels of propidium iodide staining (FL-3). The second population was strongly positive for propidium iodide with no or little
annexin-positivity, and this consists of necrotic cells. As seen in Fig. 4C the frequency of apoptosis is similar in the Shf expressing cells after serum starvation. Cells grown in 10% serum also show the same result. The largest difference between NIH-Shf and NIHcontrol can be seen in cells grown in 0.1% serum and PDGF-AA, where Shf significantly decreased the rate of apoptosis. This is consistent with our results from the cell counts, where the largest difference in cell growth is seen between day 3 and 4 under the same conditions. Our results indicate that Shf is involved in regulating apoptosis in response to PDGF. DISCUSSION A variety of adapter proteins have been shown to exert different functions in signal transduction, especially in linking receptors with their downstream effector molecules. In this report we describe the cloning of a novel adaptor protein, Shf, with an SH2 domain and four potential tyrosine phosphorylation sites. Shf shares sequence similarities with the adapter proteins Shb and Shd in these regions. Shf, Shb and Shd all have conserved putative tyrosine phosphorylation sites, as can be seen in Fig. 1B, with the consensus sequence Y-X-(D/E/Q/T)-P-(Y/F/W)-(E/D). It has previously been shown that Shd associates with and is tyrosine phosphorylated by the tyrosine kinase c-Abl (8). We believe that the putative tyrosine phosphorylation sites of Shf are of importance for its interactions with other signaling proteins.
541
Vol. 278, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. Involvement of Shf in proliferation and apoptosis. NIH-control (2 clones) and NIH-Shf cells (2 clones) were cultured in parallel in DMEM with 0.1% serum (A) and with the addition of 5 ng/ml of PDGF-AA (B). The cell number was determined every day for four consecutive days. Means ⫾ SEM for each day is shown and represents data from at least 5 independent experiments. * Denotes P ⬍ 0.05 (day 3 vs day 4) and all comparisons were made using a Student’s t test. (C) NIH-control and NIH-Shf cells were either grown in full serum (10% FcII) or serum starved (0.1%) with or without PDGF-AA for 3 days. The rate of apoptotic cells was then determined using a flow cytometer. * Denotes P ⬍ 0.05 (NIH-Shf vs NIH-control) using a Student’s t test.
Our results show that the SH2 domain of Shf interacts with the PDGF-␣-receptor after PDGF stimulation and that this association is mediated by tyrosine 720 in the PDGF-␣-receptor. Shb also interacts with tyrosine 720 in the PDGF-␣-receptor (10) and it is therefore possible that Shf and Shb compete for the same binding site on the PDGF-receptor. Our data show that Shf is strongly phosphorylated in NIH3T3 cells if we inhibit dephosphorylation with pervanadate, but we see no basal phosphorylation and no detectable PDGF-AA induced phosphorylation in these cells. In Shb overexpressing NIH3T3 cells we see phosphorylation of Shb in response to both PDGF-AA and BB stimulation. This together with the fact that we can see an association of Shf to the PDGF-␣-receptor leads us to conclude that Shf may become phosphorylated
upon binding to the PDGF-receptor, either by the receptor kinase itself or by some other kinase associated with the receptor, and is then rapidly dephosphorylated. In comparison with the widely expressed Shb, Shf is most strongly expressed in brain, skeletal muscle, testis, ovary, and small intestine. This suggests a more specialized role for Shf as an adapter protein in these tissues. In this aspect Shf resembles the other Shb homologues Shd and She more, where Shd is expressed only in the brain and She is expressed in heart, brain, lung and skeletal muscle (8). In our work we show that overexpression of Shf increases cell viability and as a consequence of this, cell proliferation in the presence of PDGF-AA. We have speculated above that Shf might compete with the re-
542
Vol. 278, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
lated adapter Shb. It has previously been shown that overexpression of Shb in NIH3T3 cells increases apoptosis and decreases cell proliferation upon serumstarvation (7). It is therefore possible that Shf and Shb can regulate downstream signaling events by competing for the same binding site on the PDGF-␣-receptor. The PTB-domain and proline-rich domain of Shb may interact with downstream targets. Since Shf can not bind these targets, but possibly others via its tyrosine phosphorylation sites, the cellular response will be different upon PDGF-receptor stimulation depending on the relative expression of the two proteins. Besides Shb and Shf, there are other examples of adapter proteins that regulate cell survival under various conditions. A point mutation of serine 36 in p66Shc has been shown to increase resistance to H 2O 2 or UV-induced apoptosis (11). Shc is an adapter protein involved in transmission of mitogenic signals from activated receptors to Ras. It has also been shown that deletions of the Ras homologue RAS1 or mutations in the SIR4 locus in Saccharomyces cerevisiae increased both life span and stress resistance (12, 13). The exact functions of the adapter protein Shf remain to be elucidated, although it appears to be involved in the regulation of survival. It will be necessary to further define the downstream targets of Shf and also if Shf has a specific function in the tissues where it is most abundantly expressed. ACKNOWLEDGMENTS We gratefully acknowledge the skillful technical assistance of IngBritt Hallgren and Ing-Marie Mo¨rsare. The work has been supported by grants from the Juvenile Diabetes Foundation International, Swedish Medical Research Council (31X-10822), the Swedish Diabetes Association, the Novo-Nordisk Foundation and the Family Ernfors Fund.
REFERENCES 1. Heldin, C. H., Ostman, A., and Ronnstrand, L. (1998) Signal transduction via platelet-derived growth factor receptors. Biochim. Biophys. Acta 1378, F79 –F113
2. Downward, J. (1998) Ras signalling and apoptosis. Curr. Opin. Genet. Dev. 8, 49 –54 3. Peterson, E. J., Clements, J. L., Fang, N., and Koretzky, G. A. (1998) Adaptor proteins in lymphocyte antigen-receptor signaling. Curr. Opin. Immunol. 10, 337–344 4. Welsh, M., Songyang, Z., Frantz, J. D., Trub, T., Reedquist, K. A., Karlsson, T., Miyazaki, M., Cantley, L. C., Band, H., and Shoelson, S. E. (1998) Stimulation through the T cell receptor leads to interactions between SHB and several signaling proteins. Oncogene 16, 891–901 5. Welsh, M., Mares, J., Karlsson, T., Lavergne, C., Breant, B., and Claesson-Welsh, L. (1994) Shb is a ubiquitously expressed Src homology 2 protein. Oncogene 9, 19 –27 6. Karlsson, T., Songyang, Z., Landgren, E., Lavergne, C., Di Fiore, P. P., Anafi, M., Pawson, T., Cantley, L. C., Claesson-Welsh, L., and Welsh, M. (1995) Molecular interactions of the Src homology 2 domain protein Shb with phosphotyrosine residues, tyrosine kinase receptors and Src homology 3 domain proteins. Oncogene 10, 1475–1483 7. Karlsson, T., and Welsh, M. (1996) Apoptosis of NIH3T3 cells overexpressing the Src homology 2 domain protein Shb. Oncogene 13, 955–961 8. Oda, T., Kujovich, J., Reis, M., Newman, B., and Druker, B. J. (1997) Identification and characterization of two novel SH2 domain-containing proteins from a yeast two hybrid screen with the ABL tyrosine kinase. Oncogene 15, 1255–1262 9. Kanakaraj, P., Raj, S., Khan, S. A., and Bishayee, S. (1991) Ligand-induced interaction between alpha- and beta-type platelet- derived growth factor (PDGF) receptors: Role of receptor heterodimers in kinase activation. Biochemistry 30, 1761– 1767 10. Hooshmand-Rad, R., Lu, L., Heldin, C. H., Claesson-Welsh, L., and Welsh, M. (2000) Platelet-derived growth factor-mediated signaling through the shb adaptor protein: Effects on cytoskeletal organization. Exp. Cell Res. 257, 245–254 11. Migliaccio, E., Giorgio, M., Mele, S., Pelicci, G., Reboldi, P., Pandolfi, P. P., Lanfrancone, L., and Pelicci, P. G. (1999) The p66shc adaptor protein controls oxidative stress response and life span in mammals [see comments]. Nature 402, 309 – 313 12. Sun, J., Kale, S. P., Childress, A. M., Pinswasdi, C., and Jazwinski, S. M. (1994) Divergent roles of RAS1 and RAS2 in yeast longevity. J. Biol. Chem. 269, 18638 –18645 13. Kennedy, B. K., Austriaco, N. R., Jr., Zhang, J., and Guarente, L. (1995). Mutation in the silencing gene SIR4 can delay aging in S. cerevisiae. Cell 80, 485– 496.
543
Shf, a Shb-like Adapter Protein, Is Involved in PDGF-␣-Receptor Regulation of Apoptosis Cecilia K. Lindholm,* ,1 J. Daniel Frantz,† ,1 Steven E. Shoelson,† and Michael Welsh* ,2 *Department of Medical Cell Biology, Uppsala University, Box 571, Biomedicum, S-75123 Uppsala, Sweden; and †Research Division, Joslin Diabetes Center, Boston, Massachusetts
Received October 19, 2000
Recent work has implicated the importance of adapter proteins in signal transduction. To identify homologues of the previously identified adapter protein Shb, database searches were performed. A Shblike protein was found which we have named Shf. Shf contains an SH2 domain and four putative tyrosine phosphorylation sites and is mainly expressed in skeletal muscle, brain, liver, prostate, testis, ovary, small intestine, and colon. The SH2 domain of Shf bound to the PDGF-␣-receptor at tyrosine-720, but not to the PDGF--receptor in PAE cells. Pervanadate induced tyrosine phosphorylation of Shf in NIH3T3 fibroblasts overexpressing this protein, whereas PDGF-AA alone had no detectable effect. NIH3T3 cells overexpressing Shf displayed significantly lower rates of apoptosis than control cells in the presence of PDGF-AA. Our findings suggest a role for the novel adapter Shf in PDGF-receptor signaling and regulation of apoptosis. © 2000 Academic Press
Key Words: Shf; Shb; PDGF-receptor; PDGF; apoptosis; cell signaling.
It is commonly the case that growth factor receptors, such as PDGF- and EGF-receptors, undergo dimerization and autophosphorylation upon binding to their ligands. This generates phosphorylated sites on the receptors capable of binding signaling proteins, such as adapters and proteins with intrinsic enzymatic activity. Some of the proteins known to bind the PDGFreceptors include Src, PLC-␥1, Crk, SHP-2, p85 PI3K, Grb2, Shc and Shb (for review see (1)). Signaling downstream of the PDGF-receptor has been shown to induce both apoptotic and antiapoptotic responses, involving several signaling pathways, in1
These authors have contributed equally to the work presented in this article. 2 To whom correspondence should be addressed Fax: 46-18556401. E-mail: [email protected].
cluding the PI3-kinase and Ras pathways (for review see (2)) Adapter proteins are characterized by their ability to mediate protein-protein interactions, thereby linking growth factor receptors with cytosolic proteins containing enzymatic activity or transcriptional-activation domains. These interactions are mediated by specific binding domains, like Src homology 2 (SH2), phosphotyrosine-binding (PTB) and Src homology 3 (SH3) domains (for review see (3)). Many adapter proteins also contain tyrosine phosphorylation sites responsible for binding SH2 and PTB domains. A recently described adapter protein, Shb, has been shown to be involved in tyrosine kinase signaling. Shb is composed of five proline-rich sequences, a PTBdomain (4), potential tyrosine phosphorylation sites and an SH2 domain (5). The SH2 domain has been shown to associate with the PDGF-receptors, the FGFR-1 (6) and the T cell receptor (4). Overexpression of Shb has also been shown to induce apoptosis under low serum conditions (7), an effect that could be counteracted by the addition of PDGF-BB. Two other Shb homologues, Shd and She (8) were recently identified, suggesting the existence of a family of adapter proteins with similar structural features. To identify additional members of this family, we have performed database searches and found a novel Shblike protein that we have named Shf. In this study we present the cloning of the novel adapter Shf and characterize its interaction with the PDGF-receptor. We also describe its role in promoting survival of NIH3T3 fibroblasts in the presence of PDGF-AA. MATERIALS AND METHODS Antibodies and cell lines. Monoclonal anti-phosphotyrosine 4G10 was purchased from Upstate Biotechnology (Lake Placid, NY). Anti-HA mAb was obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Porcine aortic endothelial cells (PAE) overexpressing the PDGF-␣-receptor and the PDGF--receptor were a kind gift from Dr.
537
0006-291X/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
Vol. 278, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
C-H. Heldin (Ludvig Institute for Cancer Research, Uppsala, Sweden). PAE cells were maintained in Ham’s F12 medium (Hyclone) complemented with 10% FCS (Hyclone). NIH3T3 cells were kept in Dulbecco’s minimal Eagle medium (Hyclone) complemented with 10% FcII (Hyclone). Cloning of Shf. A human EST (accession R59413) related to the coding region of the Shb SH2 domain was identified in the GenBank dbest database using the TBLASTN search algorithm. The putative Shb homologue was named Shf. The cDNA clone corresponding to the EST sequence was obtained from the IMAGE consortium via the ATCC and the 1.5-kb insert sequenced. A 5⬘ RACE product was amplified by PCR from human skeletal muscle cDNA (MarathonReady cDNA, Clontech) using the supplied anchor primer (AP1) and a Shf specific primer (18 –26: 5⬘GCCAAGGTAGGTCTTTGATGACCTTA3⬘). The 1.0-kb PCR product was subcloned into pT7Blue (pT7Blue TA, Novagen), and sequenced. A cDNA encoding an intact Shf open reading frame was obtained by PCR from human skeletal muscle cDNA (Quick-Clone cDNA, Clontech). The PCR was carried out using the primers RT18-1 (5⬘CCAAAGGATTCCTATGAGGC3⬘) and RT18-2 (5⬘GGCTGGGTACAGGTCTATCA3). The 1.5-kb product was subcloned into pT7Blue and sequenced. DNA constructs and transfections. The Shf SH2 domain was amplified by PCR and subcloned into the bacterial GST fusion vector pGEX4T-1 (Shf-SH2-GST). Full-length Shf was amplified by PCR and subcloned into the retroviral vector pBABE.HA (Shf-BABE). This expression vector directs the synthesis of proteins tagged at their C-termini with HA epitopes. NIH3T3 cells were transfected with Shf-BABE or empty vector using Lipofectamine as recommended by the manufacturer. Cells overexpressing Shf were selected using 4 g/ml puromycin. Several independent clones were established (NIH-Shf and NIH-control). Northern blot analyses. The 1.5-kb Shf coding region was isolated by gel electrophoresis, labeled with [ 32P]dATP by the random hexamer method (PrimeIt II, Stratagene), and hybridized to multiple human tissue mRNA blots (MTN I and II, Clontech), as recommended. The membranes were washed at high stringency and exposed to a storage phosphor screen (Molecular Dynamics). Immunoprecipitations and Western blot. NIH-Shf and NIHcontrol cells were serum starved (0.1% FcII) for 24 h. The cells were then either unstimulated, stimulated with pervanadate only for 20 min at 37°C, or stimulated with both pervanadate (20 min) and PDGF-AA (added after 10 min of pervanadate treatment) at 37°C. The cells were then washed in ice-cold PBS and subsequently lysed in Triton lysis buffer (0.15 M NaCl, 0.05 M Tris pH 7.5, 0.5% Triton X-100, 1 mM NaF, 0.1 mM orthovanadate, 100 units/ml Trasylol, 2 mM PMSF) on ice. Nuclei were pelleted by centrifugation, and cell extracts were incubated on ice with hemagglutinin (␣-HA) antibody. Immune complexes were pelleted with 50 l protein A-sepharose and subsequently washed three times with PBS, 1% Triton. The samples were then resolved by SDS–PAGE and electric transfer onto Immobilon filter (Millipore) in 20% methanol, 190 mM glycine, 23 mM Tris and 0.02% SDS. The blots were blocked in 5% BSA in PBS, 0.5% Tween 20 and incubated with primary antibodies as indicated. Immunoreactivity was detected using horseradish peroxidaseconjugated secondary antibodies and ECL (Amersham-Pharmacia Biotech, Uppsala, Sweden). Binding experiments. PAE (porcine aortic endothelial) cells expressing PDGF-␣-receptor or PDGF--receptor were serum starved (1% FCS in Ham’s) for 24 h. The cells were then either unstimulated or stimulated with PDGF-BB (20 ng/ml) for 10 min at 37°C. The cells were then washed in PBS and subsequently lysed in Triton lysis buffer as described above. Nuclei were pelleted and cell extracts were incubated for 30 min with Shf-SH2-GST fusion protein or GST (control), coupled to glutatione-Sepharose beads (Amersham-Pharmacia
Biotech, Uppsala, Sweden). The beads were then washed and subjected to SDS–PAGE and Western blotting. Peptide inhibition experiments. PDGF-AA and peptides corresponding to tyrosine-phosphorylation sites in the PDGF- ␣-receptor used in this paper were a kind gift from C-H Heldin (Ludvig Institute for Cancer research, Uppsala, Sweden). The PDGF-␣-receptorpeptides used were Y572/74, KKKKKISPDGHEpYIpYVDPMQLPY; Y720, KKKKESTRSpYVILSFENNG; Y768, LYDRPASpYKKKSM; Y988, MRVDSDNApYIGVTYKNE; Y993, AYIGVTpYKNEED; Y1018, LDEQRLSADSGpYIIPLPDID. For peptide inhibition experiments, NIH3T3 cells were serum starved (0.1% FcII) for 24 h. The cells were subsequently stimulated with pervanadate for 10 min at 37°C, washed in PBS and lysed in Triton lysis buffer as described above. Nuclei were pelleted by centrifugation, and cell extracts were incubated with immobilized Shf-SH2-GST fusion protein in the presence of 100 M phosphorylated synthetic peptides, for 30 min. The Sepharose beads were then washed and subjected to SDS–PAGE and Western blotting. Measurement of cell proliferation. 3 ⫻ 10 4 cells from each of 2 separate NIH3T3 clones expressing Shf and 2 control clones expressing empty vector were cultured in DMEM with 0.1% FcII serum. The cells were counted using a Bu¨rker chamber after 24, 48, 72, and 96 h. The same experiment was also performed in the presence of 5 ng/ml PDGF-AA and the cells were counted as above. Determination of apoptosis. Subconfluent cells from two independent NIH-Shf clones and two NIH-control clones, were serum starved (0.1% FcII) for 3 days, with or without PDGF-AA. The cells were then washed in PBS, trypsin treated and then labeled with Annexin V-FITC and propidium iodide according to the instructions included in the kit (Annexin-V-FLUOS Staining Kit from Boehringer Mannheim, Germany). The cells were then sorted on a flow cytometer (Becton Dickinson). Electronic compensation was used to eliminate bleed-through fluorescence. Data analysis was performed with Cell Quest software (Becton-Dickinson). The same procedure was also performed with cells grown in 10% FcII (Shf and control).
RESULTS Identification of the Novel Adapter Shf To identify additional members of the Shb family of adapter proteins we performed similarity searches in GenBank for sequences homologous to the Shb SH2 domain. Two Shb-like proteins called Shd and She had already been identified (8), and our search revealed a third Shb homologue, which we denominate Shf. The original clone contained a 1.5-kb insert encoding a truncated protein, and in order to obtain the full sequence we performed 5⬘RACE using a Shf specific primer. By these means the complete 2420-bp cDNA sequence was obtained; the deduced amino acid sequence is shown in Fig. 1A. The open reading frame contains 480 amino acids and consists of four putative tyrosine phosphorylation sites and an SH2 domain, all of these with high sequence homology to Shb (Fig. 1B). Shf shares 43% sequence identity with Shb and 40% sequence identity with Shd. Tissue Expression of Shf Previous studies showed that Shb is ubiquitously expressed by virtue of its presence in all tissues and cell lines tested (4, 5). We therefore investigated the
538
Vol. 278, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Deduced amino acid sequence of human Shf and Northern blot analysis. (A) Deduced amino acid sequence of human Shf. (B) Comparison of the putative tyrosine phosphorylation sites and the SH2 domains in Shf, Shb, and Shd. (C) Human tissue mRNA blots from heart (h), brain (b), placenta (p), lung (l), liver (li), skeletal muscle (sm), kidney (k), pancreas (pa), spleen (s), thymus (t), prostate (pr), testis (te), ovary (o), small intestine (si), colon (c), and periferal blood lymphocytes (bl) were hybridized with [ 32P]dATP labeled Shf cDNA. Bands of 2.6 and 1.8 kb are indicated in the figure.
tissue distribution of Shf expression. Northern blot analysis revealed expression of Shf in skeletal muscle as a 1.8 kb transcript and in brain, liver, prostate, testis, ovary, small intestine, and colon as a 2.6-kb band (Fig. 1C), suggesting the possibility of alternatively spliced products. Shf Binds to Tyrosine 720 in the PDGF-␣-Receptor via Its SH2 Domain We have previously noted that Shb interacts with the PDGF-receptors via its SH2 domain (5), and we decided to investigate if this was also the case for Shf. PAE cells overexpressing either the PDGF-␣- or -receptors were treated with PDGF-BB or not and lysates were incubated with either immobilized GST, or
the immobilized SH2 domain of Shf fused to GST (ShfSH2-GST). Western blot analysis using a phosphotyrosine antibody revealed a band corresponding to the PDGF-receptor in the PDGF-stimulated PAE cells overexpressing the ␣-receptor (Fig. 2A). PDGF-BB is known to stimulate both the PDGF-␣- and --receptors (9). Our results show an association between the Shf SH2 domain and the PDGF-␣-receptor after its phosphorylation. In order to identify phosphorylation sites in the PDGF-␣-receptor likely to bind the SH2 domain of Shf we used phosphopeptides composed of the sequences corresponding to known tyrosine phosphorylation sites in the PDGF-␣-receptor and tested these for their ability to displace the binding between the PDGF-receptor
539
Vol. 278, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. The SH2 domain of Shf associates with tyrosine 720 in the PDGF-␣-receptor. (A) PDGF-BB stimulated or unstimulated PAE cells expressing either the PDGF-␣-receptor or the PDGF--receptor were lysed and mixed with immobilized Shf-SH2-GST fusion protein. The samples were separated on SDS–PAGE before Western analysis for phosphotyrosine (4G10). The position of the PDGF-␣-receptor is indicated in the figure. (B) Lysates from pervanadate-stimulated cells were incubated together with immobilized Shf-SH2-GST in the absence or presence of peptides corresponding to tyrosine phosphorylation sites in the PDGF-␣-receptor. The peptides are as indicated in the panel to the right. The protein complexes were subjected to Western blotting analysis using phosphotyrosine antibody. The percentage inhibition of PDGF-receptor binding was determined using densitometric scanning. All values were normalized relative the value obtained in the absence of peptide, which was set to 100%. Means ⫾ SEM for three independent experiments are given and * denotes P ⬍ 0.05 when compared to control (100%).
and Shf SH2 domain. Lysates from pervanadate treated NIH3T3 cells (to obtain maximally phosphorylated PDGF-␣-receptor) were incubated together with the peptides and immobilized Shf-SH2-GST fusion protein. The PDGF-receptor was detected using antiphosphotyrosine antibody (4G10). The peptide corresponding to phosphotyrosine 720 decreased PDGFreceptor binding to the Shf SH2 domain by 70% (Fig. 2B). This result is in agreement with the binding site of the Shf related protein Shb, which also was found to associate with Y720 of the PDGF-␣-receptor (10). Of the other peptides that were tested, Y572/74 (the Srcbinding site), Y768, Y988, Y993, and Y1018, only Y768 showed a slight inhibition of the Shf-PDGFR binding (Fig. 2B). We therefore conclude that tyrosine 720 in the PDGF-␣-receptor is a preferred binding site for the Shf SH2 domain.
Shf Is Phosphorylated upon Pervanadate Stimulation in NIH3T3 Cells To further assess a role for Shf in cell signaling, NIH3T3 fibroblasts were transfected with HA-tagged Shf cDNA and stable clones were then selected (Fig. 3A). Two such clones overexpressing Shf (8 and 18) were used to study the phosphorylation of this protein. Shf overexpressing cells and control cells were stimulated with PDGF-AA, the tyrosine phosphatase inhibitor pervanadate and a combination of both and then immunoprecipitated using the HA-antibody. We could not detect any phosphorylation of Shf when cells were stimulated with PDGF-AA alone (results not shown). However, pervanadate stimulation causes strong tyrosine phosphorylation of Shf (Fig. 3B). The combined treatment with pervanadate plus PDGF-AA did not further elevate the phosphorylation of Shf. This indi-
540
Vol. 278, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Tyrosine phosphorylation of Shf in NIH3T3 fibroblasts. (A) Whole cell lysates from one NIH3T3-control clone and two Shf overexpressing NIH3T3 clones (NIH-Shf 8 and 18) were subjected to SDS–PAGE and Western blot analysis using anti-HA antisera. The position of Shf is indicated with an arrow in the figure. (B) NIH3T3 cells (NIH-control) or NIH3T3 cells stably overexpressing HA-tagged Shf (NIH-Shf) were stimulated with pervanadate and PDGF-AA, pervanadate alone or left unstimulated. Cell lysates were subjected to immunoprecipitation using an anti-HA antibody and the complexes were analyzed by Western analysis with phosphotyrosine antibody. The blot was then stripped and reprobed with HA antibody to assess equal loading.
cates that Shf is phosphorylated, but also rapidly dephosphorylated, in NIH3T3 fibroblasts. Involvement of Shf in Proliferation and Apoptosis Since overexpression of the Shf-like protein Shb in NIH3T3 cells has been shown to decrease cell growth in the absence of serum, we performed similar experiments in the Shf overexpressing cells. NIH-Shf and NIH-control cells were cultured in a low serum content (0.1% FcII) with or without the addition of PDGF-AA for four consecutive days. NIH-Shf cells grown in 0.1% serum displayed similar rates of proliferation as the control cells. In the presence of PDGF-AA, however, the NIH-Shf cells increased significantly in number between day 3 and 4, as compared with control cells (Figs. 4A and 4B). This increase in cell growth when Shf is overexpressed indicates that Shf might be involved in the regulation of proliferation. One possible explanation for the increased proliferation of the Shf cells could be decreased rates of apoptosis. Subconfluent NIH-Shf and NIH-control cells were serum-starved for 3 days, in the absence or presence of PDGF-AA before staining with annexin (as an indication of apoptosis) and propidium iodide. Flow cytometry revealed two populations with altered characteristics compared with the main population. The apoptotic population showed strong staining for annexin (FL-1) and slightly elevated levels of propidium iodide staining (FL-3). The second population was strongly positive for propidium iodide with no or little
annexin-positivity, and this consists of necrotic cells. As seen in Fig. 4C the frequency of apoptosis is similar in the Shf expressing cells after serum starvation. Cells grown in 10% serum also show the same result. The largest difference between NIH-Shf and NIHcontrol can be seen in cells grown in 0.1% serum and PDGF-AA, where Shf significantly decreased the rate of apoptosis. This is consistent with our results from the cell counts, where the largest difference in cell growth is seen between day 3 and 4 under the same conditions. Our results indicate that Shf is involved in regulating apoptosis in response to PDGF. DISCUSSION A variety of adapter proteins have been shown to exert different functions in signal transduction, especially in linking receptors with their downstream effector molecules. In this report we describe the cloning of a novel adaptor protein, Shf, with an SH2 domain and four potential tyrosine phosphorylation sites. Shf shares sequence similarities with the adapter proteins Shb and Shd in these regions. Shf, Shb and Shd all have conserved putative tyrosine phosphorylation sites, as can be seen in Fig. 1B, with the consensus sequence Y-X-(D/E/Q/T)-P-(Y/F/W)-(E/D). It has previously been shown that Shd associates with and is tyrosine phosphorylated by the tyrosine kinase c-Abl (8). We believe that the putative tyrosine phosphorylation sites of Shf are of importance for its interactions with other signaling proteins.
541
Vol. 278, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 4. Involvement of Shf in proliferation and apoptosis. NIH-control (2 clones) and NIH-Shf cells (2 clones) were cultured in parallel in DMEM with 0.1% serum (A) and with the addition of 5 ng/ml of PDGF-AA (B). The cell number was determined every day for four consecutive days. Means ⫾ SEM for each day is shown and represents data from at least 5 independent experiments. * Denotes P ⬍ 0.05 (day 3 vs day 4) and all comparisons were made using a Student’s t test. (C) NIH-control and NIH-Shf cells were either grown in full serum (10% FcII) or serum starved (0.1%) with or without PDGF-AA for 3 days. The rate of apoptotic cells was then determined using a flow cytometer. * Denotes P ⬍ 0.05 (NIH-Shf vs NIH-control) using a Student’s t test.
Our results show that the SH2 domain of Shf interacts with the PDGF-␣-receptor after PDGF stimulation and that this association is mediated by tyrosine 720 in the PDGF-␣-receptor. Shb also interacts with tyrosine 720 in the PDGF-␣-receptor (10) and it is therefore possible that Shf and Shb compete for the same binding site on the PDGF-receptor. Our data show that Shf is strongly phosphorylated in NIH3T3 cells if we inhibit dephosphorylation with pervanadate, but we see no basal phosphorylation and no detectable PDGF-AA induced phosphorylation in these cells. In Shb overexpressing NIH3T3 cells we see phosphorylation of Shb in response to both PDGF-AA and BB stimulation. This together with the fact that we can see an association of Shf to the PDGF-␣-receptor leads us to conclude that Shf may become phosphorylated
upon binding to the PDGF-receptor, either by the receptor kinase itself or by some other kinase associated with the receptor, and is then rapidly dephosphorylated. In comparison with the widely expressed Shb, Shf is most strongly expressed in brain, skeletal muscle, testis, ovary, and small intestine. This suggests a more specialized role for Shf as an adapter protein in these tissues. In this aspect Shf resembles the other Shb homologues Shd and She more, where Shd is expressed only in the brain and She is expressed in heart, brain, lung and skeletal muscle (8). In our work we show that overexpression of Shf increases cell viability and as a consequence of this, cell proliferation in the presence of PDGF-AA. We have speculated above that Shf might compete with the re-
542
Vol. 278, No. 3, 2000
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
lated adapter Shb. It has previously been shown that overexpression of Shb in NIH3T3 cells increases apoptosis and decreases cell proliferation upon serumstarvation (7). It is therefore possible that Shf and Shb can regulate downstream signaling events by competing for the same binding site on the PDGF-␣-receptor. The PTB-domain and proline-rich domain of Shb may interact with downstream targets. Since Shf can not bind these targets, but possibly others via its tyrosine phosphorylation sites, the cellular response will be different upon PDGF-receptor stimulation depending on the relative expression of the two proteins. Besides Shb and Shf, there are other examples of adapter proteins that regulate cell survival under various conditions. A point mutation of serine 36 in p66Shc has been shown to increase resistance to H 2O 2 or UV-induced apoptosis (11). Shc is an adapter protein involved in transmission of mitogenic signals from activated receptors to Ras. It has also been shown that deletions of the Ras homologue RAS1 or mutations in the SIR4 locus in Saccharomyces cerevisiae increased both life span and stress resistance (12, 13). The exact functions of the adapter protein Shf remain to be elucidated, although it appears to be involved in the regulation of survival. It will be necessary to further define the downstream targets of Shf and also if Shf has a specific function in the tissues where it is most abundantly expressed. ACKNOWLEDGMENTS We gratefully acknowledge the skillful technical assistance of IngBritt Hallgren and Ing-Marie Mo¨rsare. The work has been supported by grants from the Juvenile Diabetes Foundation International, Swedish Medical Research Council (31X-10822), the Swedish Diabetes Association, the Novo-Nordisk Foundation and the Family Ernfors Fund.
REFERENCES 1. Heldin, C. H., Ostman, A., and Ronnstrand, L. (1998) Signal transduction via platelet-derived growth factor receptors. Biochim. Biophys. Acta 1378, F79 –F113
2. Downward, J. (1998) Ras signalling and apoptosis. Curr. Opin. Genet. Dev. 8, 49 –54 3. Peterson, E. J., Clements, J. L., Fang, N., and Koretzky, G. A. (1998) Adaptor proteins in lymphocyte antigen-receptor signaling. Curr. Opin. Immunol. 10, 337–344 4. Welsh, M., Songyang, Z., Frantz, J. D., Trub, T., Reedquist, K. A., Karlsson, T., Miyazaki, M., Cantley, L. C., Band, H., and Shoelson, S. E. (1998) Stimulation through the T cell receptor leads to interactions between SHB and several signaling proteins. Oncogene 16, 891–901 5. Welsh, M., Mares, J., Karlsson, T., Lavergne, C., Breant, B., and Claesson-Welsh, L. (1994) Shb is a ubiquitously expressed Src homology 2 protein. Oncogene 9, 19 –27 6. Karlsson, T., Songyang, Z., Landgren, E., Lavergne, C., Di Fiore, P. P., Anafi, M., Pawson, T., Cantley, L. C., Claesson-Welsh, L., and Welsh, M. (1995) Molecular interactions of the Src homology 2 domain protein Shb with phosphotyrosine residues, tyrosine kinase receptors and Src homology 3 domain proteins. Oncogene 10, 1475–1483 7. Karlsson, T., and Welsh, M. (1996) Apoptosis of NIH3T3 cells overexpressing the Src homology 2 domain protein Shb. Oncogene 13, 955–961 8. Oda, T., Kujovich, J., Reis, M., Newman, B., and Druker, B. J. (1997) Identification and characterization of two novel SH2 domain-containing proteins from a yeast two hybrid screen with the ABL tyrosine kinase. Oncogene 15, 1255–1262 9. Kanakaraj, P., Raj, S., Khan, S. A., and Bishayee, S. (1991) Ligand-induced interaction between alpha- and beta-type platelet- derived growth factor (PDGF) receptors: Role of receptor heterodimers in kinase activation. Biochemistry 30, 1761– 1767 10. Hooshmand-Rad, R., Lu, L., Heldin, C. H., Claesson-Welsh, L., and Welsh, M. (2000) Platelet-derived growth factor-mediated signaling through the shb adaptor protein: Effects on cytoskeletal organization. Exp. Cell Res. 257, 245–254 11. Migliaccio, E., Giorgio, M., Mele, S., Pelicci, G., Reboldi, P., Pandolfi, P. P., Lanfrancone, L., and Pelicci, P. G. (1999) The p66shc adaptor protein controls oxidative stress response and life span in mammals [see comments]. Nature 402, 309 – 313 12. Sun, J., Kale, S. P., Childress, A. M., Pinswasdi, C., and Jazwinski, S. M. (1994) Divergent roles of RAS1 and RAS2 in yeast longevity. J. Biol. Chem. 269, 18638 –18645 13. Kennedy, B. K., Austriaco, N. R., Jr., Zhang, J., and Guarente, L. (1995). Mutation in the silencing gene SIR4 can delay aging in S. cerevisiae. Cell 80, 485– 496.
543