interleukin 17 receptor gene polymorphisms and papillary thyroid cancer in Korean population

Cytokine 71 (2015) 283–288

Contents lists available at ScienceDirect

Cytokine journal homepage: www.journals.elsevier.com/cytokine

Association between interleukin 17/interleukin 17 receptor gene polymorphisms and papillary thyroid cancer in Korean population Young Chan Lee a, Joo-Ho Chung b, Su Kang Kim b, Sang Youl Rhee c, Suk Chon c, Seung Joon Oh c, Il Ki Hong d, Young Gyu Eun a,⇑ a

Department of Otolaryngology—Head and Neck Surgery, School of Medicine, Kyung Hee University, Seoul, Republic of Korea Kohwang Medical Research Institute, Kyung Hee University, School of Medicine, Seoul, Republic of Korea Department of Endocrinology and Metabolism, Kyung Hee University School of Medicine, Seoul, Republic of Korea d Department of Nuclear Medicine, Kyung Hee University School of Medicine, Seoul, Republic of Korea b c

a r t i c l e

i n f o

Article history: Received 4 August 2014 Received in revised form 6 November 2014 Accepted 10 November 2014

Keywords: Thyroid neoplasm Interleukin-17 Receptors Polymorphism Single nucleotide

a b s t r a c t Background: Although numerous recent studies have implicated a role for interleukin 17(IL17) in tumor development, the mechanisms of IL17 involvement are still uncharacterized. The aims of this study were to determine whether single nucleotide polymorphisms (SNPs) in IL17 and IL17R contribute to the development of papillary thyroid cancer (PTC) and to assess the relationship between IL17 and IL17R SNPs and the clinicopathologic characteristics of PTC. Materials and methods: Eight SNPs located within the IL17A, IL17RA, and IL17RB genes were genotyped using direct sequencing in 94 patients with PTC and 260 patients without PTC (controls). Genetic data were analyzed using commercially available software. Statistical analyses were then performed to examine the relationships between these SNPs and the clinicopathologic characteristics of PTC. Results: Genotyping analysis demonstrated that the IL17RA SNP rs4819554 (codominant model 1, odds ratio (OR) = 0.39, P = 0.001) and the IL17RB SNP rs1025689 (dominant model, OR = 0.59, P = 0.043) were significantly associated with lack of PTC. Interestingly, the IL17A SNP rs2275913 (codominant model 2, OR = 0.19, P = 0.034) was significantly associated with lack of multifocality. Furthermore, the IL17RA SNP rs4819554 (dominant model, OR = 0.25, P = 0.010) was significantly associated with lack of cancer bilaterality. Conclusion: In this study of SNPs in the IL17 and IL17R genes in patients with PTC, we demonstrated that IL17RA polymorphisms can influence both the development and the bilaterality of PTC. Ó 2014 Elsevier Ltd. All rights reserved.

1. Introduction Although papillary thyroid cancer (PTC) is the one of the most common malignancies and its incidence is rapidly increasing, the etiology of this disease remains largely unknown [1–3]. Numerous pedigree and genomic association studies have indicated that genetic susceptibilities can contribute to PTC [4–6]. Apart from

Abbreviations: IL17, interleukin-17; SNPs, single nucleotide polymorphisms; IL17R, interleukin-17 receptor; PTC, papillary thyroid carcinoma; MMPs, metalloproteinases; Th17, T helper 17; TNF, tumor necrosis factor; PCR, polymerase chain reaction; PBMCs, peripheral blood mononuclear cells; HWE, Hardy–Weinberg equilibrium; OR, odds ratio; CI, confidence interval; FOXP3, forkhead box P3. ⇑ Corresponding author at: Department of Otolaryngology—Head and Neck Surgery, Kyung Hee University School of Medicine, #1 Hoegi-dong, Dongdaemungu, Seoul 130-702, Republic of Korea. Tel.: +82 2 958 8471; fax: +82 2 958 8470. E-mail address: [email protected] (Y.G. Eun). http://dx.doi.org/10.1016/j.cyto.2014.11.011 1043-4666/Ó 2014 Elsevier Ltd. All rights reserved.

genetic and environmental factors, such as iodine intake or radiation exposure, several reports have also indicated that chronic inflammation due to alterations in immune function might be associated with a higher risk of developing PTC [7,8]. The concept that inflammation is capable of causing cancer is derived from the observation that polymorphisms in genes encoding proinflammatory mediators are often associated with human carcinogenesis [9]. Furthermore, three of the oncogenes activated in thyroid cancer, RET/PTC, RAS and BRAF, can induce a cell-autonomous proinflammatory transcriptional program in thyroid cell; this transcriptional program mainly modulates the expression of cytokines, chemokines and their receptors [10]. Recently, Th 17 cells were identified as a new subset of T helper cells. Th 17 cells and their cytokine IL17, particularly IL17A and IL17F, are known to be important mediators of inflammation, autoimmune disease, and cancer [11–13]. The IL17 proinflammatory cytokine family consists of

284

Y.C. Lee et al. / Cytokine 71 (2015) 283–288

six members (IL17A–F); these cytokines can induce the release of other cytokines (such as IL-6, CXCL1, CXCL8, and CCL2), chemokines, and metalloproteinases (MMPs) via their five receptors (IL17RA-RD and SEF) [14,15]. In addition to the proinflammatory actions of IL17, increasing evidence has indicated that IL17 plays an important role in various solid tumors, including ovarian cancer, gastric cancer and breast cancer [16–18]. Moreover, IL17 has also been established as the most important proangiogenic mediator for promoting angiogenesis, which is required to sustain tumor growth [19]. Furthermore, recent studies identified a link between IL17A polymorphisms and susceptibility to cancers, including breast and cervical cancer [20,21]. However, the roles of IL17 polymorphisms in the development of PTC are unknown. The purposes of this study were: (1) to determine whether single nucleotide polymorphisms (SNPs) in IL17 and IL17R contribute to the development of PTC, and (2) to assess the relationships between IL17 and IL17R SNPs and the clinicopathologic characteristics of PTC.

(Fig. 1). These included two promoter SNPs (rs3819024, rs2275913) in IL17A, four exon 13 SNPs (rs879575, rs879577, rs2229151, rs4819554) in IL17RA, and two SNPs (rs2232350, rs1025689) in IL17RB. Genomic DNA was extracted from blood samples, which had been collected in EDTA using a Roche DNA Extraction Kit (Roche, Indianapolis, IN, USA). For the genotyping of each SNP, firstly, the polymerase chain reaction (PCR) was performed using specific primers (Table 2). The condition of PCR was denaturation 94 °C for 30 s, annealing 58 °C for 30 s, and extension 72 °C for 1 min. At the end, PCR was conducted at 72 °C for 7 min to terminate the PCR reaction. Each PCR product was identified with 1.8% agarose gel electrophoresis. The identified PCR products were sequenced using an ABI PRISM 3730XL analyzer (PE Applied Biosystems, Foster City, CA, USA). Sequencing data were analyzed with SeqManII software (DNASTAR Inc., Madison, WI, USA). 2.4. Statistical analysis

2. Material and methods 2.1. Study design Ninety-four consecutively diagnosed patients with PTC and 260 control subjects were enrolled at Kyung Hee University Medical Center for this study over the years of January 2008 to December 2008. Diagnosis of PTC and the possible presence of cervical regional lymph node metastasis were confirmed by pathological examination. The PTC group included 27 males and 67 females; the mean age was 53.2 ± 12.0 years. We recruited healthy controls from regular health examination at the same hospital. The controls denied having had cancer or thyroid disease at enrollment. The control group contained 260 healthy adults (mean age ± SD, 51.8 ± 8.6 years), including 125 males and 135 females. Among the PTC patients requested for participation, all patients agreed to participate. Thus the participation rate for the PTC cases was 100%. The proportion of the controls that were approached agreed to participate was 92.8% (260/280). This study was approved by the Institutional Review Board of the Medical Research Institute at Kyung Hee University Medical Center. Written informed consent was obtained from all subjects. 2.2. Patient subgroups To assess whether IL17 and IL17RA SNPs were associated with any characteristics of PTC, patients were divided into subgroups according to their cancer size (<1 cm or P1 cm), number of tumors (unifocality or multifocality), and cancer location (one lobe or both lobes) after surgery. In addition, patients with PTC were also subgrouped into extrathyroidal invasion (+) and (–) groups, based on their pathological findings. Finally, patients with PTC were further subgrouped into lymph node metastasis (+) and (–) groups to evaluate the contributions of IL17 and IL17RA SNPs to cancer metastasis. The demographic characteristics of the patients with PTC are summarized in Table 1; small differences in subgroup numbers reflect the loss of some clinical data. 2.3. SNP selection and genotyping We searched the dbSNP database (version 141; http:// www.ncbi.nlm.nih.gov/SNP) to select SNPs. We focused SNPs of the exon region and promoter region in genes. We excluded SNPs with unknown heterozygosity (heterozygosity <0.1), with minor allele frequencies (MAF <0.1), unknown genotype frequencies in Asian populations. Finally, eight SNPs located in three interleukin genes (IL17A, IL17RA and IL17RB) in the IL17 family were selected

Compliance with Hardy–Weinberg equilibrium (HWE) was assessed for all SNPs using SNPstats (http://bioinfo.iconcologia.net/index.php?module=Snpstats) in patients and controls, and was adjusted for age and sex. Comparisons between PTC subgroups were also adjusted for age and sex. SNPstats, HapAnalyzer version 1.0 and SNPAnalyzer Pro (ISTECH Inc., Goyang, Republic of Korea) were used to calculate odds ratios (ORs), 95% confidence intervals (CIs), and P values. 3. Results 3.1. Allele frequencies and genetic polymorphism of IL17 and IL17R The allele frequencies and genetic polymorphisms in the IL17 and IL17R genes in the 94 patients with PTC and the 260 control patients are shown in Tables 3 and 4. The genotypic distributions of the SNPs examined in this study were in Hardy–Weinberg equilibrium (P > 0.05; data not shown). Allele frequency analysis of IL17 and IL17R revealed that the G allele of rs4819554 was less frequent in patients with PTC than in control patients (38.0% vs. 47.0%, respectively). However, this trend was not statistically significant (P = 0.050). Logistic regression analysis showed that the IL17RA SNP rs4819554 was significantly

Table 1 Demographic characteristics of the study participants. Variable

PTC (n = 94)

Control (n = 260)

Sex (males: females) Average age (mean ± SD, years old)

27:67 53.2 ± 12.0

125:135 51.8 ± 8.6

Cancer size P1 cm <1 cm

48 (52.2%) 44 (47.8%)

Number of cancers Unifocality Multifocality

61 (67.0%) 30 (33.0%)

Location of cancers One lobe Both lobe

65 (71.4%) 26 (28.6%)

Extrathyroidal invasion Absent Present

44 (48.4%) 47 (51.6%)

Cervical lymph node metastasis Absent Present

66 (72.5%) 25 (27.5%)

PTC, papillary thyroid cancer.

285

Y.C. Lee et al. / Cytokine 71 (2015) 283–288

Fig. 1. Gene map and single nucleotide polymorphisms (SNPs) in the IL17A, IL17RA, and IL17RB. The coding regions are black boxes and untranslation regions are white boxes. Table 2 Primer sequence for PCR. Gene symbol

SNP

Primer sequence

IL17A 399

rs3819024 promoter

Forward Reverse

GGGTTGGAACATGCCTTTAACA AGCTGCTATGCTATGGGTCAAT

IL17A 152

rs2275913 promoter

Forward Reverse

TCAAGGTACATGACACCAGAAG GATGAGTTTGTGCCTGCTATGA

IL17RA

rs879575 Ile486Ile

Forward Reverse

CTCTAAGATCATCGTCCTGTG GCTCATGGACAGGTTCGAGGA

IL17RA

rs879577 Ala367Val

Forward Reverse

CCTCAGTTGGGTTTCTCAGC AGATCATCGTCCTGTGCTCC

IL17RA

rs2229151 Leu396Leu

Forward Reverse

GGTCAGCATGTGTGGTCTTGT AGTCATGACCTGGGTGGGCCG

IL17RA

rs4819554 809

Forward Reverse

CACGCGTGCTAAGAAGGAG CGGGCCATATCCCATTTTAT

IL17RB

rs2232350 Ile451Thr

Forward Reverse

GTCGTCTTCCTTCTTTCCAATG GATCTTTTTCCTGCTGACACCT

IL17RB

rs1025689 Pro42Pro

Forward Reverse

TTTGGTGTGAGTCACTGAGAGG GGTGCGTGTATGCATGTATTTC

SNP, single nucleotide polymorphism.

associated with lack of PTC (codominant model 1 [A/A vs. A/G], OR = 0.39, 95% CI, 0.20–0.74, P = 0.001; dominant model [A/A vs. AG+G/G], OR = 0.45, 95% CI, 0.27–0.75, P = 0.002). In addition, the IL17RB SNP rs1025689 was also significantly associated with lack of PTC (dominant model [C/C vs. C/G+G/G], OR = 0.59, 95% CI, 0.35–0.98, P = 0.043). However, the SNP present in IL17A did not show a significant association with PTC. 3.2. Clinicopathologic features We analyzed the genetic relationships between the IL17 and IL17R SNPs and the subgroups of the PTC patients according to their clinicopathologic features. The IL17A SNP rs2275913 (codominant model 2 [G/G vs. A/A], OR = 0.19, 95% CI, 0.04–0.90, P = 0.034; dominant model [G/G vs. A/G+A/A], OR = 0.34, 95% CI, 0.12–0.91, P = 0.033; log-additive model, OR = 0.49, 95% CI, 0.26–0.92, P = 0.021) was significantly associated with lack of multifocality (Table 5). Moreover, the A allele was significantly less frequent in patients with a multifocal tumor (P = 0.011). Furthermore, the IL17RA SNP rs4819554 (dominant model [A/A vs. A/G+G/G],

Table 3 Allele frequencies of the IL17 and IL17R polymorphisms in patients with PTC and controls. Gene

SNP

Allele

PTC (n, (%))

Control (n, (%))

OR (95% CI)

P-value

IL17A

rs3819024

A G

98 (52.0) 90 (48.0)

285 (55.0) 233 (45.0)

1.11 (0.79–1.55)

0.52

rs2275913

G A

98 (52.0) 90 (48.0)

289 (56.0) 231 (45.0)

1.14 (0.81–1.59)

0.43

rs879575

G A

185 (98.0) 3 (2.0)

510 (98.0) 10 (2.0)

0.82 (0.22–3.02)

0.77

rs879577

G A

180 (96.0) 8 (4.0)

486 (94.0) 30 (6.0)

0.71 (0.32–1.59)

0.41

rs2229151

G A

111 (59.0) 77 (41.0)

325 (63.0) 193 (37.0)

1.18 (0.83–1.66)

0.34

rs4819554

A G

116 (62.0) 72 (38.0)

278 (53.0) 242 (47.0)

0.71 (0.50–1.00)

0.05

rs2232350

T C

161 (86.0) 27 (14.0)

414 (80.0) 106 (20.0)

0.65 (0.41–1.03)

0.06

rs1025689

C G

110 (59.0) 78 (41.0)

269 (52.0) 251 (48.0)

0.76 (0.54–1.06)

0.11

IL17RA

IL17RB

PTC, papillary thyroid cancer; OR, Odds ratio; CI, Confidence interval.

286

Y.C. Lee et al. / Cytokine 71 (2015) 283–288

Table 4 Logistic regression model of IL17 and IL17R polymorphisms in patients with PTC and controls. Gene IL17A

IL17RA

SNP

PTC (n, (%))

Control (n, (%))

Model

OR (95% CI)

P-value

a

rs3819024

A/A A/G G/G

29 (30.9) 40 (42.5) 25 (26.6)

77 (29.7) 131 (50.6) 51 (19.7)

Codominant 1 Codominant 2b Dominant Recessive Log-additive

0.78 1.26 0.91 1.46 1.11

(0.40–1.49) (0.59–2.66) (0.54–1.54) (0.83–2.56) (0.79–1.55)

0.791 0.968 0.748 0.181 0.540

rs2275913

G/G A/G A/A

28 (29.8) 42 (22.7) 24 (25.5)

76 (29.2) 137 (52.7) 47 (18.1)

Codominant 1c Codominant 2d Dominant Recessive Log-additive

0.83 1.32 0.96 1.48 1.14

(0.43–1.59) (0.61–2.84) (0.57–1.63) (0.83–2.62) (0.81–1.60)

1.000 0.813 0.901 0.177

rs879575

G/G A/G

91 (96.8) 3 (3.2)

250 (96.8) 10 (3.8)

Codominant 1 Codominant 2 Dominant Recessive Log-additive

NA NA 0.73 (0.19–2.77) NA NA

0.647

Codominant 1 Codominant 2 Dominant Recessive Log-additive

NA NA 0.63 (0.27–1.45) NA NA

0.280

rs879577

IL17RB

Genotype

G/G A/G

86 (91.5) 8 (8.5)

228 (88.4) 30 (11.6)

rs2229151

G/G A/G A/A

35 (37.2) 41 (43.6) 18 (19.1)

104 (40.1) 117 (45.2) 38 (14.7)

Codominant 1c Codominant 2d Dominant Recessive Log-additive

0.98 1.37 1.07 1.38 1.13

(0.53–1.81) (0.62–3.04) (0.65–1.77) (0.73–2.61) (0.80–1.59)

1.000 0.733 0.763 0.309 0.490

rs4819554

A/A A/G G/G

41 (43.6) 34 (36.2) 19 (20.2)

71 (27.3) 136 (52.3) 53 (20.4)

Codominant 1a Codominant 2b Dominant Recessive Log-additive

0.39 0.62 0.45 1.04 0.71

(0.20–0.74) (0.29–1.32) (0.27–0.75) (0.57–1.89) (0.50–1.00)

0.001 0.321 0.002 0.887 0.050

rs2232350

T/T T/C C/C

68 (72.3) 25 (26.6) 1 (1.1)

164 (63.1) 86 (33.1) 10 (3.8)

Codominant 1e Codominant 2f Dominant Recessive Log-additive

0.67 0.27 0.63 0.30 0.64

(0.36–1.25) (0.02–2.99) (0.37–1.08) (0.03–2.47) (0.40–1.04)

0.309 0.448 0.096 0.267 0.064

rs1025689

C/C C/G G/G

35 (37.2) 40 (42.5) 19 (20.2)

67 (25.8) 135 (51.9) 58 (22.3)

Codominant 1g Codominant 2h Dominant Recessive Log-additive

0.56 0.65 0.59 0.92 0.77

(0.30–1.05) (0.30–1.40) (0.35–0.98) (0.50–1.66) (0.55–1.09)

0.083 0.427 0.043 0.783 0.140

The P values are calculated from logistic regression analyses after adjusting for sex and age. PTC, papillary thyroid cancer; OR, Odds ratio; CI, Confidence interval; NA, Not available. Missing genotype data was excluded in analysis. Bold values indicate P < 0.05. a Codominant1, A/A vs. A/G. b Codominant 2, A/A vs. GG. c Codominant1, G/G vs. A/G. d Codominant 2, G/G vs. A/A. e Codominant1, T/T vs. T/C. f Codominant 2, T/T vs. C/C. g Codominant1, C/C vs. C/G. h Codominant 2, C/C vs. GG.

OR = 0.25, 95% CI, 0.08–0.73, P = 0.010; log-additive model, OR = 0.37, 95% CI, 0.18–0.78, P = 0.004) was significantly associated with lack of cancer bilaterality; furthermore, the G allele of this SNP was less frequent in patients with bilateral PTC (P = 0.032) (Table 6). No significant associations were observed between the IL17 and IL17R SNPs and the cancer size, number of cancer tumors, presence of extrathyroidal invasion, or presence of cervical lymph node metastasis. 4. Discussion In the present study, we investigated the associations between polymorphisms in the IL17 and IL17R genes and PTC in a Korean population. We found that the IL17RA SNP rs4819554 and the IL17RB SNP rs1025689 were significantly associated with lack of

PTC. In addition, the IL17A SNP rs2275913 was significantly associated with lack of multifocality, and the IL17RA SNP rs4819554 was significantly associated with lack of cancer bilaterality. IL17 is a glycoprotein of 155 amino acids and is also an inflammatory cytokine secreted by CD4 Th17 and CD8 Tc 17 cells [14,15]. The role of IL17 in inflammatory and autoimmune disease has been studied extensively [22,23]. The receptor for IL17 (IL-17R) is ubiquitously expressed by all immune cells; importantly, stimulation of IL17 can induce the expression of other cytokines such as IL1, IL6, IL8, tumor necrosis factor (TNF), and macrophage inflammatory protein 1 [24]. Numerous studies have shown that IL17 is found in various tumors including cervical, ovarian gastric, breast and other malignancies [16–18,21]. In addition, other studies have revealed that IL17 and IL17-producing cells can exert potent protumor

287

Y.C. Lee et al. / Cytokine 71 (2015) 283–288 Table 5 Genotype and allele frequencies of the IL17A SNP rs2275913 in patients with PTC according to the number of cancers. Multifocality n = 30

Unifocality n = 61

Model

OR (95% CI)

P-value

Genotype, n (%) G/G A/G A/A

13 (43.3) 13 (43.3) 4 (13.3)

15 (24.6) 27 (44.3) 19 (31.1)

Codominant 1a Codominant 2b Dominant Recessive Log-additive

0.45 0.19 0.34 0.30 0.49

(0.13–1.51) (0.04–0.90) (0.12–0.91) (0.09–1.02) (0.26–0.92)

0.285 0.034 0.033 0.054 0.021

Allele, n (%) G A

39 (65.0) 21 (35.0)

57 (47.0) 65 (53.0)

1 0.43 (0.22–0.82)

0.011

The P values are calculated from logistic regression analyses after adjusting for sex and age. PTC, papillary thyroid cancer; OR, Odds ratio; CI, Confidence interval. Missing genotype data was excluded in analysis. Bold values indicate P < 0.05. a Codominant1, G/G vs. A/G. b Codominant 2, G/G vs. A/A.

Table 6 Genotype and allele frequencies in the IL17RA SNP rs4819554 in patients with PTC according to the location of their cancer. Both lobe n = 26

One lobe n = 65

Model

OR (95% CI)

P-value

Genotype, n (%) A/A A/G G/G

16 (61.5) 7 (26.9) 3 (11.5)

22 (33.9) 27 (41.5) 16 (24.6)

Codominant 1a Codominant 2b Dominant Recessive Log-additive

0.26 0.23 0.25 0.42 0.37

(0.07–1.00) (0.04–1.29) (0.08–0.73) (0.10–1.73) (0.18–0.78)

0.051 0.114 0.010 0.234 0.004

Allele, n (%) A G

39 (75.0) 13 (25.0)

71 (55.0) 59 (45.0)

1 0.45 (0.21–0.93)

0.032

The P values are calculated from logistic regression analyses after adjusting for sex and age. PTC, papillary thyroid cancer; OR, Odds ratio; CI, Confidence interval. Missing genotype data was excluded in analysis. Bold values indicate P < 0.05. a Codominant1, A/A vs. A/G. b Codominant 2, A/A vs. GG.

actions by promoting angiogenesis [25,26]. A study by Numasaki et al. demonstrated that IL17 can promote angiogenesis and tumor growth by promoting the expression of chemotactic factors such as CXCL, stimulating endothelial cell migration, and positively regulating the formation of new blood vessels in non-small lung cancer [27,28]. Interestingly, Wang et al. found that IL6 production, which is induced by IL17, promotes tumor growth via a STAT3-dependent pathway [29]. Recently, Lee et al. reported that the prevalence of IL17-producing forkhead box P3(FOXP3)+ CD4+ tumor-infiltrating lymphocytes is increased in oral squamous cell carcinoma [30]. This study suggested that Th17 and tumor-infiltrating lymphocytes present in the oral squamous cell carcinoma microenvironment may be involved in the modulation of antitumor immunity or of tumor-promoting inflammation. Some studies have identified links between genetic variations in IL17 and the pathogenesis of human cancer. Shibata et al. found that rs2275913 in IL17A was significantly associated with the development of stomach cancer [31]. Another study found that rs2275913 in IL17A was associated with the development of breast cancer in Chinese women [20]. This study also demonstrated significant associations between IL17 SNPs and tumor protein 53 (p53), progesterone receptor (PR), and human epidermal growth factor receptor 2 (Her-2). In a study of the relationships between IL17 polymorphisms and cervical cancer, rs2275913 was shown to be associated with cancer susceptibility, as well as with the presence of positive peritumor intravascular cancer emboli and a high clinical stage of cervical cancer [21]. However, no study had

investigated whether polymorphisms in IL17 and IL17R influence the risk of PTC development. To the best of our knowledge, this is the first study to demonstrate that polymorphisms in IL17R are associated with susceptibility to PTC. We found that two polymorphisms (rs4819554 and rs1025689) in the IL17R genes were associated with lack of PTC. However, no studies had examined whether IL17R genetic variants could influence IL17R production by PBMCs. Thus, we evaluated whether promoter SNPs affected transcription factors. At the rs4819554 site in the IL17RA gene, the G-containing sequence revealed an SP1 transcription factor consensus sequence; however, this consensus sequence was absent in the A-containing sequence. To further evaluate our results, the biological effects of these SNPs on IL17R production need to be examined. Of the total of 94 patients with PTC in our study, 44 patients (47.8%) presented with papillary thyroid microcarcinoma (PTMC) which defined as tumor measuring 61 cm. This relatively high proportion of PTMC in our study population could affect the results. However, when we assessed the genetic relationship between SNPs and subgroups according to tumor size, we could not any significant difference. Interestingly, we found that the IL17A SNP rs2275913 was significantly associated with lack of multifocality, and that the IL17RA SNP rs4819554 was significantly associated with lack of PTC bilaterality. Both multifocality and bilaterality are clinically important in the context of PTC. Despite a good prognosis, several reports showed PTC with these characteristics may be associated with aggressive courses [32,33]. Hence, considering the possibility of

288

Y.C. Lee et al. / Cytokine 71 (2015) 283–288

multifocality or bilaterality is critical for deciding the extent of surgery for PTC and for predicting patient prognosis. Further studies are needed to provide valuable information for detecting occult PTC by using these SNPs. 5. Conclusion This case-control study of IL17 and IL17R SNPs in patients with PTC found that the IL17 gene polymorphisms rs4819554 and rs1025689 were associated with lack of PTC. In addition, the IL17A SNP rs2275913 was significantly associated with lack of multifocality, and the IL17RA SNP rs4819554 was significantly associated with lack of PTC bilaterality. Author contribution Young Chan Lee: drafting of the manuscript, analysis and interpretation of data. Young Gyu Eun: study design, acquisition, analysis and interpretation of data, critical revision of the manuscript. Ju-Ho Chung: study design, acquisition, analysis and interpretation of data. Su Kang Kim: study design, acquisition, analysis and interpretation of data, revision of the manuscript. Sang Youl Rhee: study design, analysis and interpretation of data. Il Ki Hong: study design, analysis and interpretation of data. Suk Chon: study design, analysis and interpretation of data. Seung Joon Oh: study design, analysis and interpretation of data. Acknowledgement This work was supported by a grant from the Kyung Hee University in 2012. (KHU-20120472). References [1] Hundahl SA, Fleming ID, Fremgen AM, Menck HR. A national cancer data base report on 53,856 cases of thyroid carcinoma treated in the U.S., 1985–1995. Cancer 1998;83:2638–48 [see comments]. [2] Leenhardt L, Grosclaude P, Cherie-Challine L. Increased incidence of thyroid carcinoma in France: a true epidemic or thyroid nodule management effects? Report from the French Thyroid Cancer Committee. Thyroid 2004;14:1056–60. [3] Sprague BL, Warren Andersen S, Trentham-Dietz A. Thyroid cancer incidence and socioeconomic indicators of health care access. Cancer Causes Control 2008;19:585–93. [4] Vlajinac HD, Adanja BJ, Zivaljevic VR, Jankovic RR, Dzodic RR, Jovanovic DD. Malignant tumors in families of thyroid cancer patients. Acta Oncol 1997;36:477–81. [5] Pal T, Vogl FD, Chappuis PO, Tsang R, Brierley J, Renard H, et al. Increased risk for nonmedullary thyroid cancer in the first degree relatives of prevalent cases of nonmedullary thyroid cancer: a hospital-based study. J Clin Endocrinol Metab 2001;86:5307–12. [6] Frich L, Glattre E, Akslen LA. Familial occurrence of nonmedullary thyroid cancer: a population-based study of 5673 first-degree relatives of thyroid cancer patients from Norway. Cancer Epidemiol Biomarkers Prev 2001;10:113–7. [7] Guarino V, Castellone MD, Avilla E, Melillo RM. Thyroid cancer and inflammation. Mol Cell Endocrinol 2010;321:94–102. [8] Bozec A, Lassalle S, Hofman V, Ilie M, Santini J, Hofman P. The thyroid gland: a crossroad in inflammation-induced carcinoma? An ongoing debate with new therapeutic potential. Curr Med Chem 2010;17:3449–61.

[9] Plantinga TS, Costantini I, Heinhuis B, Huijbers A, Semango G, Kusters B, et al. A promoter polymorphism in human interleukin-32 modulates its expression and influences the risk and the outcome of epithelial cell-derived thyroid carcinoma. Carcinogenesis 2013;34:1529–35. [10] Liotti F, Visciano C, Melillo RM. Inflammation in thyroid oncogenesis. Am J Cancer Res 2012;2:286–97. [11] Castellanos-Rubio A, Santin I, Irastorza I, Castano L, Carlos Vitoria J, Ramon Bilbao J. TH17 (and TH1) signatures of intestinal biopsies of CD patients in response to gliadin. Autoimmunity 2009;42:69–73. [12] Miyahara Y, Odunsi K, Chen W, Peng G, Matsuzaki J, Wang RF. Generation and regulation of human CD4+ IL-17-producing T cells in ovarian cancer. Proc Natl Acad Sci USA 2008;105:15505–10. [13] Su X, Ye J, Hsueh EC, Zhang Y, Hoft DF, Peng G. Tumor microenvironments direct the recruitment and expansion of human Th17 cells. J Immunol 2010;184:1630–41. [14] Kolls JK, Linden A. Interleukin-17 family members and inflammation. Immunity 2004;21:467–76. [15] Kawaguchi M, Adachi M, Oda N, Kokubu F, Huang SK. IL-17 cytokine family. J Allergy Clin Immunol 2004;114:1265–73. quiz 74. [16] Kato T, Furumoto H, Ogura T, Onishi Y, Irahara M, Yamano S, et al. Expression of IL-17 mRNA in ovarian cancer. Biochem Biophys Res Commun 2001;282:735–8. [17] Zhu X, Mulcahy LA, Mohammed RA, Lee AH, Franks HA, Kilpatrick L, et al. IL-17 expression by breast-cancer-associated macrophages: IL-17 promotes invasiveness of breast cancer cell lines. Breast Cancer Res 2008;10:R95. [18] Zhang Y, Ma D, Tian Y, Wang X, Qiao Y, Cui B. The imbalance of Th17/Treg in patients with uterine cervical cancer. Clin Chim Acta 2011;412:894–900. [19] Numasaki M, Lotze MT, Sasaki H. Interleukin-17 augments tumor necrosis factor-alpha-induced elaboration of proangiogenic factors from fibroblasts. Immunol Lett 2004;93:39–43. [20] Wang L, Jiang Y, Zhang Y, Wang Y, Huang S, Wang Z, et al. Association analysis of IL-17A and IL-17F polymorphisms in Chinese Han women with breast cancer. PLoS ONE 2012;7:e34400. [21] Quan Y, Zhou B, Wang Y, Duan R, Wang K, Gao Q, et al. Association between IL17 polymorphisms and risk of cervical cancer in Chinese women. Clin Dev Immunol 2012;2012:258293. [22] Weaver CT, Hatton RD, Mangan PR, Harrington LE. IL-17 family cytokines and the expanding diversity of effector T cell lineages. Annu Rev Immunol 2007;25:821–52. [23] McGeachy MJ, Cua DJ. Th17 cell differentiation: the long and winding road. Immunity 2008;28:445–53. [24] Yao Z, Fanslow WC, Seldin MF, Rousseau AM, Painter SL, Comeau MR, et al. Herpesvirus saimiri encodes a new cytokine, IL-17, which binds to a novel cytokine receptor. J Immunol 2011;187:4392–402. [25] Silva-Santos B. Promoting angiogenesis within the tumor microenvironment: the secret life of murine lymphoid IL-17-producing gammadelta T cells. Eur J Immunol 2010;40:1873–6. [26] Wakita D, Sumida K, Iwakura Y, Nishikawa H, Ohkuri T, Chamoto K, et al. Tumor-infiltrating IL-17-producing gammadelta T cells support the progression of tumor by promoting angiogenesis. Eur J Immunol 2010;40:1927–37. [27] Takahashi H, Numasaki M, Lotze MT, Sasaki H. Interleukin-17 enhances bFGF-, HGF- and VEGF-induced growth of vascular endothelial cells. Immunol Lett 2005;98:189–93. [28] Numasaki M, Watanabe M, Suzuki T, Takahashi H, Nakamura A, McAllister F, et al. IL-17 enhances the net angiogenic activity and in vivo growth of human non-small cell lung cancer in SCID mice through promoting CXCR-2dependent angiogenesis. J Immunol 2005;175:6177–89. [29] Wang L, Yi T, Kortylewski M, Pardoll DM, Zeng D, Yu H. IL-17 can promote tumor growth through an IL-6-Stat3 signaling pathway. J Exp Med 2009;206:1457–64. [30] Lee JJ, Chang YL, Lai WL, Ko JY, Kuo MY, Chiang CP, et al. Increased prevalence of interleukin-17-producing CD4(+) tumor infiltrating lymphocytes in human oral squamous cell carcinoma. Head Neck 2011;33:1301–8. [31] Shibata T, Tahara T, Hirata I, Arisawa T. Genetic polymorphism of interleukin17A and -17F genes in gastric carcinogenesis. Hum Immunol 2009;70:547–51. [32] Pacini F, Elisei R, Capezzone M, Miccoli P, Molinaro E, Basolo F, et al. Contralateral papillary thyroid cancer is frequent at completion thyroidectomy with no difference in low- and high-risk patients. Thyroid 2001;11:877–81. [33] Miccoli P, Minuto MN, Ugolini C, Panicucci E, Berti P, Massi M, et al. Intrathyroidal differentiated thyroid carcinoma: tumor size-based surgical concepts. World J Surg 2007;31:888–94.