Associations between common arginine vasopressin 1b receptor and glucocorticoid receptor gene variants and HPA axis responses to psychosocial stress in a child psychiatric population

Psychiatry Research 179 (2010) 64–68

Contents lists available at ScienceDirect

Psychiatry Research j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / p s yc h r e s

Associations between common arginine vasopressin 1b receptor and glucocorticoid receptor gene variants and HPA axis responses to psychosocial stress in a child psychiatric population Dirk van West a,b,c,d,⁎, Jurgen Del-Favero a,b, Dirk Deboutte c,d, Christine Van Broeckhoven b,e, Stephan Claes a,b,f a

Department of Molecular Genetics, Applied Molecular Genomics Group, VIB, Belgium University of Antwerp (UA), Antwerp, Belgium c University Center of Child and Adolescent Psychiatry Antwerp (UKJA), Antwerp, Belgium d Collaborative Antwerp Psychiatric Research Institute (CAPRI), University of Antwerp, Belgium e Department of Molecular Genetics, Neurodegenerative Brain Diseases Group, VIB, Belgium f University Psychiatric Center, Campus Leuven, University of Leuven, Belgium b

a r t i c l e

i n f o

Article history: Received 12 September 2008 Received in revised form 8 March 2009 Accepted 15 April 2009 Keywords: Children Genetic Polymorphism

a b s t r a c t On the one hand, a suitable response to daily stressors is crucial for adequate functioning in any natural environment. On the other hand, depending on the individual's genetic makeup, prolonged stress that is accompanied by an inappropriate level of responsiveness may lead to physiological and psychiatric disorders. Several psychiatric conditions have been linked with stress and alterations in hypothalamic–pituitary–adrenal (HPA) activity. While stress is a general phenomenon, illness is only seen in a proportion of individuals, suggesting that genetic factors may play a role in the ability to cope with stress. In children, relatively little research has been conducted to determine the impact of genetic factors on the variability in HPA axis functioning. In the present exploratory investigation, 106 prepubertal children were studied to estimate the impact of four glucocorticoid receptor gene (NR3C1) polymorphisms (NR3C1-1 [rs10482605], ER22/23EK [rs6190], N363S [rs6195], N766N [rs6196]) and five arginine vasopressin (AVP) receptor 1b gene (AVPR1b) polymorphisms (AVPR1b_s1 [rs28536160], AVPR1b_s2 [rs28373064], AVPR1b_s3 [rs33976516], AVPR1b_s4 [rs33985287], AVPR1b_s5 [rs33933482]) on cortisol responses after a psychosocial stress test (public speaking task). ER22/23EK carriers had significantly lower cortisol responses to psychosocial stress compared with noncarriers. These findings provide evidence for the relevance of the ER22/23EK polymorphism in childhood HPA axis regulation. However, the small number of ER22/23EK subjects does not allow us to draw definitive conclusions about the genotypic effect. © 2009 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Recent studies in clinical and developmental neuroscience show an increased interest in understanding the relevance of the hypothalamic– pituitary–adrenal (HPA) axis in child and adolescent psychiatry. The HPA axis is involved in neuroendocrine and behavioural responses to stress affected by developmental influences (Lupien et al., 2000; Meaney, 2001). Besides the well-documented influences of early developmental processes on these neurobehavioural systems of stress, there is also evidence that childhood is a time of plasticity in HPA axis functioning. Several studies have provided evidence for an association between HPA axis functioning and psychiatric problems (Kirschbaum

⁎ Corresponding author. University Center of Child and Adolescent Psychiatry (UCKJA), ZNA Middelheim, University of Antwerp, Lindendreef 1, B-2020 Antwerp, Belgium. Tel.: +32 3 280 49; fax: +32 3 280 49 14. E-mail address: [email protected] (D. van West). 0165-1781/$ – see front matter © 2009 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.psychres.2009.04.002

and Hellhammer, 1994; Chrousos, 1997; Levine, 2000; Preussner et al., 2003). Research on this topic is based on the role of the HPA axis in stress regulation. In stressful situations, the hypothalamus secretes corticotropin-releasing hormone (CRH), which, in synergy with arginine vasopressin (AVP), stimulates the pituitary gland to secrete adrenocorticotrophic hormone (ACTH). Subsequently, ACTH is released, which causes the adrenal glands to produce cortisol. Changes in cortisol concentrations influence immunity, metabolism, growth, reproduction and other important physiological processes (Chrousos, 1997; Sapolsky et al., 2000; De Kloet, 2003). HPA axis functioning has not only been studied in the context of immediate stress, but also in psychiatric problems that are associated with severe or chronic stress. Abnormal responses to stress have been reported in child and adolescent psychiatry. For example, there is evidence for altered HPA axis functioning in children and adolescents with dysthymia (Gispen-de Wied et al., 1998; Jansen et al., 1999), depression (Casat and Powell, 1988; Dahl et al., 1992; Luby et al.,

D. van West et al. / Psychiatry Research 179 (2010) 64–68 Table 1 Demographic characteristics of patients and healthy controls. ADHD-C (n = 51)

ADHD-I (n = 12)

SP (n = 18)

CONTROL (n = 25)

P

Measure

Mean

S.D.

Mean

S.D.

Mean

S.D.

Mean

S.D.

Age Gender⁎ Tanner BMI SES TIQ VIQ PIQ

8.52 43/8 1.05 16.32 39.52 99.72 100.52 99.12

1.84

8.70 10/2 1.09 16.41 43.66 101.92 102.04 101.99

1.61

9.29 9/9 1.12 16.59 46.09 105.17 104.02 105.38

0.82

8.71 14/11 1.09 16.78 44.61 102.44 103.38 101.73

1.41

0.12 2.00 7.45 8.23 9.79 7.79

0.26 1.89 7.13 10.03 10.02 9.84

0.26 1.13 4.66 7.46 7.33 7.09

0.24 1.62 4.89 9.44 13.12 10.41

0.377 0.007 0.582 0.754 0.052 0.131 0.541 0.066

Mean values and standard deviations. Note: ⁎ Male/female ratio, BMI = Body Mass Index, SES = Socioeconomic status, TIQ = Total Intelligence Quotient, VIQ = Verbal Intelligence Quotient, PIQ= Performance Intelligence Quotient; ADHD-C=Attention deficit hyperactivity disorder, combined subtype; ADHD-I=predominantly inattentive subtype; SP=Social phobia.

2003), posttraumatic stress disorder (PTSD) (Goenjian et al., 1996, 2003; Kaufman et al., 1997a; Duval et al., 2004), attention-deficit/ hyperactivity disorder (ADHD) (King et al., 1998; Hong et al., 2003; Yang et al., 2007; Blomqvist et al., 2007), anxiety disorders (Granger et al., 1994; Martel et al., 1999; Gerra et al., 2000; Coplan et al., 2002; Dorn et al., 2003; Terleph et al., 2006; van West et al., 2008), pervasive developmental disorder, autism and multiple complex developmental disorder (Jansen et al., 1999, 2000, 2003; Corbett et al., 2006; Marinovic-Curin et al., 2008), and oppositional-defiant disorder (ODD) and conduct disorder (CD) (Gispen-de Wied et al., 1998; Van Goozen et al., 1998, 2000; Snoek et al., 2004; Van de Wiel et al., 2004; McBurnett et al., 2005; Popma et al., 2006). The various functions of the HPA axis are largely determined by well-regulated gene expression in tissues at different levels of the axis. The sophisticated use of molecular biology techniques has allowed molecular cloning of a number of genes encoding hormones or secretory proteins. For a number of HPA axis functional candidate genes, our research group developed single-nucleotide polymorphism (SNP) maps and studied them in a haplotype-based association approach in samples of patients with affective disorders. We have studied in detail so far four genes coding for the CRH receptor 2 (CRHR2) (Villafuerte et al., 2002), the CRH binding protein (CRH-BP) (Claes et al., 2003; Van den Eede et al., 2007a,b), the AVP receptor 1B (AVPR1B) (van West et al., 2004) and the glucocorticoid receptor (NR3C1) (van West et al., 2006). An interesting finding was a protective effect of a major haplotype of AVPR1B for major depression in a Belgian and a Swedish sample (van West et al., 2004). Further, we showed that polymorphisms in the 5′ region of NR3C1 – most probably promoter polymorphisms – play a role in the genetic vulnerability for major depression, again in a Belgian and a Swedish sample with recurrent major depression (van West et al., 2006). In the Swedish sample, the rare allele of SNP ER22/ 23EK was overrepresented in patients, a finding that was subsequently confirmed in an independent study in German patients (Van Rossum et al., 2006). In the Belgian sample, the association was mainly driven by SNP NR3C1-1 (rs10482605), a polymorphism with a functional effect on GR gene expression (Wüst, 2007). The 80-kb-large NR3C1 is located on chromosome 5q31–q32. The gene comprises nine exons (Nobukuni et al., 1995). Exon 1 and part of exon 2 contain the 5′UTR, exons 2–9 the coding sequences, and part of exon 9 the 3′untranslated region (UTR) (Nobukuni et al., 1995). Recently, two additional alternative first exons (designated exons 1A and 1B) were identified upstream of exon 1 (now exon 1C) (Breslin et al., 2001). At least three promoters regulate the transcriptional activity of NR3C1 (Breslin et al., 2001). The 12-kb-large gene encoding AVPR1b is located on human chromosome 1q32 and consists of two exons that code a 424-amino acid sequence.

65

If it is true that GR and AVPR1b polymorphisms increase the vulnerability for major depression, it is logical to assume that these SNPs alter the stress response. To test this hypothesis, the present study was conducted to estimate the impact of these four NR3C1 and five AVPR1b polymorphisms on cortisol responses to psychosocial stress in a child psychiatric population. 2. Methods 2.1. Subjects The research sample consisted of 106 prepubertal children (51 children with attention deficit hyperactivity disorder, combined subtype [ADHD-C], 12 children with ADHD, predominantly inattentive subtype [ADHD-I], 18 children with social phobia (SP), and 25 healthy controls) who all underwent a psychosocial stress test (cfr. infra). Demographic variables are shown in Table 1. All patients were recruited from the psychiatric outpatients clinic, at the University Center of Child and Adolescent Psychiatry in Antwerp. Parent ratings of behaviour were ascertained using the Child Behavior Checklist (CBCL) (Achenbach, 1991a). Teacher ratings of behaviour were obtained using the Teacher Report Form (TRF) (Achenbach, 1991b). All patients were diagnosed by a semistructured interview: the Schedule for Affective Disorders and Schizophrenia for School Aged Children Present and Lifetime Version 1.0 with supplement (K-SADS-PL) (Kaufman et al., 1997b) for all ADHD children and the Anxiety Disorders Interview Schedule for DSM-IV: Child and Parent Versions (ADIS-IV-C/P) (Siebelinck and Treffers, 2001; Silverman and Albano, 1996) for children with SP. Diagnoses were made according to the DSM-IV-TR (APA, 2000) by a trained child psychiatrist. All subjects were medication-naïve. Twenty-five control subjects between 6 and 12 years old were recruited from grades 1 to 6 of regular local elementary schools and screened for psychiatric problems, using the CBCL filled out by the parents. None of the children had any symptom cluster score above the 98th percentile. All patients and control individuals had parents of Belgian nationality. All children with a Full Scale IQ, as measured by the Wechsler Intelligence Scale for Children-Revised (WISC-R) (Wechsler, 1974) of less than 85 and children with a history of any neurologic or endocrinologic disorder and steroid medication were excluded from this study. Stage of pubertal development was assessed in the parent interview using schematic drawings of secondary sex characteristics associated with the five standard Tanner stages of pubertal development (score range: 1–5) (Marshall and Tanner, 1969). Subjects with a score higher than 2 were excluded from the study. As a second measure of physical development, the body mass index (BMI) was computed. Socioeconomic status (SES) was measured using the Hollingshead Four-Factor Index of Social Status (Hollingshead, 1975). This measure generates an SES score for each family based upon maternal and paternal education and occupation. The Medical Ethical Committee of the University of Antwerp approved the research project, and parents gave written informed consent after the purpose and course of the study had been explained. 2.2. Experimental procedure and saliva sampling The psychosocial stress test consisted of a public speaking task (PST), which has been proved to be an effective stressor in both children and adults (Dickerson and Kemeny, 2004; Kudielka et al., 2004). The PST was embedded in a 135-min test session, consisting of an initial resting period (60 min), the PST (15 min) and a post-test resting period (60 min) (Table 2). For this population, we used an adapted version of the Trier Social Stress Test (TSTT) (Kirschbaum et al., 1993), primarily by shortening its duration and increasing its relevance to participants. This procedure has been described in detail elsewhere (van West et al., 2008). For each subject, seven saliva samples were collected for measurement of the cortisol concentration. The first saliva sample was taken during the initial resting period, 30 min after the start of the test session (t = − 30). The second sample was taken after 60 min, at the end of the initial rest period just before the public speaking task (T0). Saliva was also collected right after the 10-min preparation period (T10) and after the 5-min talk (T15). During the second 1-h rest period, a further three saliva samples were collected at 20-min intervals (T35, T55, T75) (Table 2). As a specific measure of responsivity to the stressor, the following cortisol variables were computed:

Table 2 Study design. Prestress (60 min)

Stress (15 min)

Time

− 60

−30

0

Task

Q

Q

Cortisol

10

Introduction PST Preparation Cort1 Cort2 Cort3

Poststress (60 min) 15

35

55

75

Judgement

Q

Game

Game

Cort4

Cort5

Cort6

Cort7

Time schedule of the psychosocial stress test. (Q: Questionnaires; Cort: cortisol).

66

D. van West et al. / Psychiatry Research 179 (2010) 64–68

Table 3 Location and nomenclature of 5 SNPs in AVPR1b and 4 SNPs in NR3C1. SNP name

SNP location

rs number

Mutation nomenclature

PCR primers

SNP primers

NR3C1-1

Promotor

rs10482605

g.-3211T N C

CCAACACCCAGGAAAA

ER22/23EK

Exon2

rs6190

c.68G NA

N363S

Exon2

rs6195

c.1088A NG

N766N

Exon9alfa

rs6196

c.2292T N C

AVPR1b_s1

5′UTR

rs28536160

g.-1057A N G

AVPR1b_s2

5′UTR

rs28373064

g.-885T N C

AVPR1b_s3

3′UTR

rs33976516

g.⁎9C N G

AVPR1b_s4

3′UTR

rs33985287

g.⁎115A N G

AVPR1b_s5

3′UTR

rs33933482

g.⁎120G N A

F-GAGCTCCCGAGTGGGTCT R-GAACGATGCAACCTGTTGGT F-CAAGCTGCCTCTTACTAATCG R-CCCAGGTCATTTCCCATCAC F-ACCGGACACTAAACCCAAAA R-TCAGAGTCCCCAGAGAAGTCA F-GGGAATTCCAGTGAGATTGG R-CAACTGCTTCTGTTGCCAAG F-TCAGCCTCAGCCTAACCCTCAGT R-GGCAGAGAACCTCCACTAGTCCTG F-CCAGGACTAGTGGAGGTTCTCTGC R-CTCACACTAGGGGCAGCTGTGAC F-GCTGCCTCATAAGCTCCCAATCT R-TGGACCCCTAGACAGCACCAT F-GCCAGAAGTTAAGATGTCCCTTGG R-CGAGGCATAGGGAAAGGAAGAAAA F-TCAGACGTCACTCCCAGGTGACT R-GGCAGTCACTCCTCCCACCTAC

CCCAGGTCATTTCCCATCAC GATCCTTGGCACCTA AGAAGTTTTTTGATA CATCATCTTTTAGGAAAGA GTTAGAGGAGCCCTGTC CCATGCACACATGGT GTGGGGGTGTATATGG GCGCGGTTGTCGG

basal, deltapeak, AUCtot, AUCnet, post1–4. Basal represents the mean free cortisol concentration over the two time points before the PST. Deltapeak is the maximum free cortisol concentration after the PST corrected for basal. The area under the curve (AUC) was calculated to incorporate the cortisol concentrations at five time points after the initial resting period according to the trapezoid method described by Pruessner et al. (2003). AUCtot is the total area under the curve and represents the total cortisol output. AUCnet is identical to AUCtot, except for the removal of the area between the ground and basal. Post1–4 are cortisol values immediately, 20 min, 40 min and 60 min after the talk.

test) was used to compare values of cortisol variables in subjects with different genotypes. Repeated-measures analysis of covariance (ANCOVA) incorporating diagnosis and gender as covariates with ‘genotype’ as between-subjects factor and ‘cortisol results’ as within-subjects factor were used to assess changes in levels of log (cortisol). A two-tailed significance level of 5% was used for each test. For statistical analysis, we used SPSS for Windows, version 15.0.

2.3. Biochemical analyses

Because the N363S SNP was not polymorphic, we excluded it for further statistical analysis. The distribution of genotypes for all NR3C1 and AVPR1b polymorphisms was in Hardy–Weinberg equilibrium (P N 0.05). There is a significant association between SNP ER22/23EK and Post1 (P = 0.010), Peak (P = 0.029), Deltapeak (P = 0.027) and AUCtot (P = 0.029); a trend toward association was observed between SNP ER22/23EK and Post2 (P = 0.086), Post3 (P = 0.054) and AUCnet (P = 0.078). For the ER22/23EK polymorphism in NR3C1, allelic discrimination analysis identified 99 subjects (93%) homozygous for the G allele, no subjects homozygous for the A allele, and seven (7%) heterozygotes. The resulting allelic frequencies (number of concerned alleles divided by total number of alleles) of 0.97 for the G allele and 0.03 for the A allele correspond with previous reports (Koper et al., 1997; Van Rossum et al., 2002, 2004). There were six male ER22/23EK carriers (four children with ADHD-C, one child with SP, and one healthy control child) and one female healthy control carrier. Salivary cortisol responses to the psychosocial stress test exposure are shown in Fig. 1. Repeated-measures ANCOVA revealed a significant main effect of group (carriers vs. noncarriers) (F = 4.06; df = 1; P = 0.047) but no significant time (F = 1.54; df = 3,73; P = 0.195) or group by

All stress tests were carried out in the afternoon, when HPA activity is low and stable, and therefore more susceptible to stimulation (Kirschbaum and Hellhammer, 1994). Cortisol can be measured from saliva in a reliable and stress-free way (Kirschbaum and Hellhammer,1994), and reflects the biologically active (unbound) fraction of serum cortisol (Aardal and Holm, 1995). After the start of an effective stressor, salivary cortisol increases can be observed 15–20 min later (Kirschbaum and Hellhammer, 1994). Subjects collected saliva by holding a dental roll in the mouth and chewing on it for 30–90 s until they feel that the swab is soaked with saliva. The saturated roll was placed in Salivette (Sarstedt, Nümbrecht, Germany) collection devices and stored at room temperature until completion of the session. Samples were then stored at −20 °C until biochemical analysis. Salivettes were then centrifuged at 3000 rpm for 5 min, which resulted in a clear supernatant of low viscosity. Cortisol analyses were performed in duplicate by direct radio-immunoassay on 100 µl of salivary free cortisol samples in competition, with a HPLC preparation of cortisol3CMO coupled with 2-[125I]odohistamine as tracer, for specific antibodies raised against cortisol-3-CMO-BSA (Sulon et al., 1978). The lower detection limit of the assay was 12 ng dl–1, with a mean intra-assay coefficient of variation of 4.3% (n=10). The coefficients of variation for between-run assays are 12.26% and 9.38% (at concentrations of 34.39±4.22 and 410.59±38.53 ng dl–1, respectively) (n=30). 2.4. SNP analysis by pyrosequencing SNP detection by sequencing was described elsewhere (van West et al., 2004, 2006). Five SNPs within AVPR1b and four SNPs within NR3C1 that were used in two previous studies (van West et al., 2004, 2006) were amplified using polymerase chain reaction (PCR). Biotinylated PCR products were immobilised onto streptavidin-coated paramagnetic beads (Dynal AS, Oslo, Norway). Biotinylated ssDNA was obtained by incubating the immobilised PCR product in 50 µl 0.5 M NaOH for 5 min followed by two sequential washes in 100 µl 10 mM Tris–Acetate pH 7.6. Primer annealing was effectuated by incubation at 80 °C for 2 min and then at room temperature for 5 min. Pyrosequencing was performed on the PSQ96 pyrosequencer (Pyrosequencing AB, Uppsala, Sweden). Table 3 lists the location, scientific nomenclature and primers of five SNPs in NR3C1.

3. Results

2.5. Statistical analysis For analyses of hormonal responses, all data were log transformed to yield unskewed outcome variables. Differences in gender ratio between groups were tested by using chi-square analysis. One-factor analyses of variance (ANOVAs) were used to assess the effect of diagnostic group on age, Tanner stage, BMI, SES and IQ. In both study samples we used the UNPHASED program (http://www.mrc-bsu.cam.ac.uk/personal/ frank/software/unphased/) (Dudbridge, 2003) to perform genetic association analysis. UNPHASED comprises a suite of program for association analysis of multilocus haplotypes from unphased genotype data. The application implements maximumlikelihood inference on haplotype and genotype effects with binary (disease affection status) and quantitative (cortisol values) traits. The Mann–Whitney Rank Sum Test (U-

Fig. 1. Cortisol values in ER22/23EK carriers and ER22/23EK noncarriers.

D. van West et al. / Psychiatry Research 179 (2010) 64–68 Table 4 Median values and ranges of the computed cortisol variables in ER22/23EK carriers and noncarriers. ER22/23EK carriers (n = 7)

ER22/23EK noncarriers (n = 99)

Measure

Median

Range

Median

Range

Basal Post1 Post2 Post3 Post4 Peak Deltapeak AUC_tot AUC_net

0.59 0.60 0.59 0.56 0.39 0.71 0.12 27.60 − 5.90

0.44–0.94 0.46–1.18 0.28–1.20 0.09–1.23 0.17–0.68 0.54–1.49 0.02–0.55 15.03–53.90 − 17.03–6.90

0.75 0.91 0.88 0.77 0.53 1.03 0.33 38.00 5.53

0.46–1.18 0.33–2.26 0.22–2.01 0.12–1.80 0.12–1.23 0.57–2.26 0.04–1.54 15.95–77.23 − 25.93–43.77

U statistic

P-value

229 148 217 201 255 169 175 179 193

0.135 0.011 0.099 0.064 0.244 0.024 0.029 0.033 0.051

time interaction (F = 1.62; df = 3,73; P = 0.174). Table 4 lists the mean values and standard deviations of the computed cortisol variables in ER22/23EK carriers and noncarriers. There was a significant difference between groups for post1 (P = 0.011), peak (P = 0.024), deltapeak (P = 0.029) and AUCtot (P = 0.033); there was a trend toward significance for post3 (P = 0.064) and AUCnet (P = 0.051). All cortisol values were lower in ER22/23EK carriers compared with noncarriers. 4. Discussion This is, to the best of our knowledge, the first report documenting an impact of HPA axis gene polymorphisms on cortisol responses to psychosocial stress in a child psychiatric population. The most striking finding of the present investigation is the significant difference in salivary cortisol responses to psychosocial stress between ER22/23EK carriers and noncarriers. These results suggest that the ER22/23EK allele is related to decreased responses to a psychosocial stress procedure. Previously, the ER22/23EK polymorphism was associated with a decreased response to the administration of 1 mg dexamethasone, suggestive of GR resistance (Koper et al., 1997; Van Rossum et al., 2002). A change in the balance between two previously reported (Yudt and Cidlowski 2001) translational variants of the GR protein (GR-A and GR-B) could explain the molecular mechanism for this reduced glucocorticoid sensitivity. Russcher et al. (2005) found, as a result of the ER22/23EK polymorphism, a reduction in the formation of the shorter, transcriptionally more active GR-B synthesis and an increase of the longer, transcriptionally less active GR-A. Van Rossum et al. (2006) also found that the ER22/23EK carriers showed a significantly faster clinical response to antidepressant therapy as well as a trend toward better cognitive functioning during depression. Using a psychosocial stressor, Wüst et al. (2004) examined the impact of three NR3C1 polymorphisms on cortisol responses to psychosocial stress test; unfortunately, too few subjects with the ER22/23EK genotype were available to test the impact of this polymorphism on HPA axis reactivity. One major limitation of the present study is the risk of a falsepositive finding (type I error) due to multiple comparisons. The levels of significance of the SNP associations would not withstand Bonferroni correction for multiple testing. However, the comparisons were not independent from one another because most of the SNPs are in high linkage disequilibrium. Therefore, the Bonferroni correction is probably too strict. Another major limitation is the risk of a falsenegative result (type II error) due to the small sample size and the accompanying problem of limited statistical power to detect associations. However, the rather original study design may partly compensate for the modest sample size. The most important limitation of the present study is the small sample size and the accompanying problem of limited statistical power to detect associations. The results were not corrected for multiple testing. However, all significant findings emerged with the

67

same polymorphism (ER22/23EK), making a false positive finding unlikely. The HPA axis is of major interest for psychoneuroendocrinological research. Molecular genetic studies linked to the (endo)phenotype ‘HPA axis response to stress’ could be important in clarifying the (neurobiological) relationship between stress, HPA axis and genetic vulnerability. In future studies, this finding needs to be replicated in both large representative populations of “normal subjects” as well as populations of patients with diseases and states that are related to a dysregulated HPA axis. Acknowledgements This work has been supported by the Special Research Fund of the University of Antwerp (UA), the Fund for Scientific Research Flanders (FWO-F), the National Fund for Scientific Research (FNRS) and the Interuniversity Attraction Poles (IUAP) programme P5/19 of the Belgian Science Policy Office. S. Claes is a senior Clinical Researcher of the FWO-F. We acknowledge the contribution of the VIB8 Genetic Service Facility to the genetic analyses. We thank K. Peeters for the technical support. We are grateful to the patients and control individuals for their co-operation and participation in this research study.

References Aardal, E., Holm, A.C., 1995. Cortisol in saliva: reference ranges and relation to cortisol in serum. European Journal of Clinical Chemistry and Clinical Biochemistry 33, 927–932. Achenbach, T.M., 1991a. Manual for the Child Behavior Checklist and 1991 Profile. University of Vermont, Department of Psychiatry, Burlington, VT. Achenbach, T.M., 1991b. Manual for the Teacher's Report Form and 1991 Profile. University of Vermont, Department of Psychiatry, Burlington, VT. American Psychiatric Association (APA), 2000. Diagnostic and Statistical Manual of Mental Disorders, 4th ed., Text Revision. American Psychiatric Press, Washington, DC. Blomqvist, M., Holmberg, K., Lindblad, F., Fernell, E., Ek, U., Dahllöf, G., 2007. Salivary cortisol levels and dental anxiety in children with attention deficit hyperactivity disorder. European Journal of Oral Sciences 115, 1–6. Breslin, M.B., Geng, C.D., Vedeckis, W.V., 2001. Multiple promoters exist in the human GR gene, one of which is activated by glucocorticoids. Molecular Endocrinology 15, 1381–1395. Casat, C.D., Powell, K., 1988. The dexamethasone suppression test in children and adolescents with major depressive disorder: a review. Journal of Clinical Psychiatry 49, 390–393. Chrousos, G.P., 1997. Stressors, stress and neuroendocrine integration of the adaptive response. Annals of the New York Academy of Sciences 851, 331–335. Claes, S., Villafuerte, S., Forsgren, T., Sluijs, S., Del-Favero, J., Adolfsson, R., Van Broeckhoven, C., 2003. The corticotropin-releasing hormone binding protein is associated with major depression in a population from Northern Sweden. Biological Psychiatry 54, 867–872. Coplan, J.D., Moreau, D., Chaput, F., Martinez, J.M., Hoven, C.W., Mandell, D.J., Gorman, J.M., Pine, D.S., 2002. Salivary cortisol concentrations before and after carbon-dioxide inhalations in children. Biological Psychiatry 51, 326–333. Corbett, B.A., Mendoza, S., Abdullah, M., Wegelin, J.A., Levine, S., 2006. Cortisol circadian rhythms and response to stress in children with autism. Psychoneuroendocrinology 31, 59–68. Dahl, R.E., Kaufman, J., Ryan, N.D., Perel, J.M., al-Shabbout, M., Birmaher, B., Nelson, N., Puig-Antich, J., 1992. The dexamethasone suppression test in children and adolescents: a review and controlled study. Biological Psychiatry 32, 109–126. De Kloet, E.R., 2003. Hormones, brain and stress. Endocrine Regulations 37, 51–68. Dickerson, S.S., Kemeny, M.E., 2004. Acute stressors and cortisol responses: a theoretical integration and synthesis of laboratory research. Psychological Bulletin 130, 355–391. Dorn, L.D., Campo, J.C., Thato, S., Dahl, R.E., Lewin, D., Chandra, R., Di Lorenzo, C., 2003. Psychological comorbidity and stress reactivity in children and adolescents with recurrent abdominal pain and anxiety disorders. Journal of the American Academy of Child and Adolescent Psychiatry 42, 66–75. Dudbridge, F., 2003. Pedigree disequilibrium tests for multilocus haplotypes. Genetic Epidemiology 25, 115–121. Duval, F., Crocq, M.A., Guillon, M.S., Mokrani, M.C., Monreal, C., Bailey, P., Macher, J.P., 2004. Increased adrenocorticotropin suppression after dexamethasone administration in sexually abused adolescents with posttraumatic stress disorder. Annals of the New York Academy of Sciences 1032, 273–275. Gerra, G., Zaimovic, A., Zambelli, U., Timpano, M., Reali, N., Bernasconi, S., Brambilla, F., 2000. Neuroendocrine responses to psychological stress in adolescents with anxiety disorder. Neuropsychobiology 42, 82–92. Gispen-de Wied, C.C., Jansen, L.M.C., Wynne, H.J., Matthys, W., van der Gaag, R.J., Thijssen, J.H.H., van Engeland, H., 1998. Differential effects of hydrocortisone and dexamethasone on cortisol suppression in a child psychiatric population. Psychoneuroendocrinology 23, 295–305.

68

D. van West et al. / Psychiatry Research 179 (2010) 64–68

Goenjian, A.K., Yehuda, R., Pynoos, R.S., Steinberg, A.M., Tashjian, M., Yang, R.K., Najarian, N.L., Fairbanks, L.A., 1996. Basal cortisol and dexamethasone suppression of cortisol and MHPG among adolescents after the 1988 earthquake in Armenia. American Journal of Psychiatry 153, 929–934. Goenjian, A.K., Pynoos, R.S., Steinberg, A.M., Endres, D., Abraham, K., Geffner, M.E., Fairbanks, L.A., 2003. Hypothalamic-pituitary-adrenal activity among Armenian adolescents with PTSD symptoms. Journal of Traumatic Stress 16, 319–323. Granger, D.A., Weisz, J.R., Kauneckis, D., 1994. Neuroendocrine reactivity, internalizing behavior problems, and control-repeated cognitions in clinic-referred children and adolescents. Journal of Abnormal Psychology 103, 267–276. Hollingshead, A.B., 1975. Four Factor Index of Social Status. Department of Sociology, Yale University, New Haven, CT. Hong, H.J., Shin, W.S., Lee, E.H., Oh, Y.H., Noh, K.S., 2003. Hypothalamic-pituitaryadrenal reactivity in boys with attention deficit hyperactivity disorder. Yonsei Medical Journal 4, 608–614. Jansen, L.M.C., Gispen-de Wied, C.C., Jansen, M.A., van der Gaag, R.J., Matthys, W., van Engeland, H., 1999. Pituitary-adrenal reactivity in a child psychiatric population: salivary cortisol response to stressors. European Neuropsychopharmacology 9, 67–75. Jansen, L.M.C., Gispen-de Wied, C.C., van der Gaag, R.J., ten Hove, F., WillemsenSwinkels, S.W.M., Harteveld, E., van Engeland, H., 2000. Unresponsiveness to psychosocial stress in a subgroup of autistic-like children, Multiple Complex Developmental Disorder. Psychoneuroendocrinology 25, 753–764. Jansen, L.M.C., Gispen-de Wied, C.C., van der Gaag, R.J., van Engeland, H., 2003. Differentiation between autism and multiple complex developmental disorder in response to psychosocial stress. Neuropsychopharmacology 28, 582–590. Kaufman, J., Birmaher, B., Perel, J., Dahl, R.E., Moreci, P., Nelson, B., Wells, W., Ryan, N.D., 1997a. The corticotropin-releasing hormone challenge in depressed abused, depressed nonabused, and normal control children. Biological Psychiatry 42, 669–679. Kaufman, J., Birmaher, B., Brent, D., Rao, U., Flynn, C., Moreci, P., Williamson, D., Ryan, N., 1997b. Schedule for affective disorders and schizophrenia for school-aged children present and lifetime version (K-SADS-PL): initial reliability and validity data. Journal of the American Academy of Child and Adolescent Psychiatry 35, 980–988. King, J.A., Barkley, R.A., Barrett, S., 1998. Attention-deficit hyperactivity disorder and the stress response. Biological Psychiatry 44, 72–74. Kirschbaum, C., Hellhammer, D.H., 1994. Salivary cortisol in psychoneuroendocrine research: recent developments and applications. Psychoneuroendocrinology 19, 313–333. Kirschbaum, C., Pirke, K.M., Hellhammer, D.H., 1993. The Trier Social Stress Test: a tool for investigating psychobiological stress responses in a laboratory setting. Neuropsychobiology 28, 76–81. Koper, J.W., Stolk, R.P., de Lange, P., Huizenga, N.A., Molijn, G.J., Pols, H.A., Grobbe, D.E., Karl, M., de Jong, F.H., Brinkmann, A.O., Lamberts, S.W., 1997. Lack of association between five polymorphisms in the human glucocorticoid receptor gene and glucocorticoid resistance. Human Genetics 99, 663–668. Kudielka, B.M., Buske-Kirschbaum, A., Hellhammer, D.H., Kirschbaum, C., 2004. HPA axis responses to laboratory stress in healthy elderly adults, younger adults, and children: impact of age and gender. Psychoneuroendocrinology 29, 83–98. Levine, S., 2000. Influence of psychological variables on the activity of the hypothalamic-pituitary-adrenal axis. European Journal of Pharmacology 405, 149–160. Luby, J.L., Heffelfinger, A., Mrakotsky, C., Brown, K., Hessler, M., Spitznagel, E., 2003. Alterations in stress cortisol reactivity in depressed preschoolers relative to psychiatric and no-disorder comparison groups. Archives of General Psychiatry 60, 1248–1255. Lupien, S.J., King, S., Meany, M.J., McEwen, B.S., 2000. Child's stress hormone levels correlate with mother's socioeconomic status and depressive state. Biological Psychiatry 48, 976–980. Marinovic-Curin, J., Marinovic-Terzic, I., Bujas-Petkovic, Z., Zekan, L., Skrabic, V., Dogas, Z., Terzic, J., 2008. Slower cortisol response during ACTH stimulation test in autistic children. European Child and Adolescent Psychiatry 17, 39–43. Marshall, W.A., Tanner, J.M., 1969. Variations in the pattern of pubertal changes in girls. Archives of Disease in Childhood 44, 291. Martel, F.L., Hayward, C., Lyons, D.M., Sanborn, K., Varady, S., Schatzberg, A.F., 1999. Salivary cortisol levels in socially phobic adolescent girls. Depression and Anxiety 10, 25–27. McBurnett, K., Raine, A., Stouthamer-Loeber, M., Loeber, R., Kumar, A.M., Kumar, M., Lahey, B.B., 2005. Mood and hormone responses to psychological challenge in adolescent males with conduct problems. Biological Psychiatry 57, 1109–1116. Meaney, M.J., 2001. The development of individual differences in behavioral and endocrine responses to stress. Annual Review of Neuroscience 24, 1161–1192. Nobukuni, Y., Smith, C.L., Hager, G.L., Detera Wadleigh, S.D., 1995. Characterization of the human glucocorticoid receptor promoter. Biochemistry 34, 8207–8214. Popma, A., Jansen, L.M.C., Vermeiren, R., Steiner, H., Raine, A., Van Goozen, S.H.M., van Engeland, H., Doreleijers, T.A.H., 2006. Hypothalamus pituitary adrenal axis and autonomic activity during stress in delinquent male adolescents and controls. Psychoneuroendocrinology 31, 948–957. Preussner, M., Hellhammer, D.H., Preussner, J.C., Lupien, S.J., 2003. Self-reported depressive symptoms and stress levels in healthy young men: associations with cortisol response to awakening. Psychosomatic Medicine 65, 92–99. Pruessner, J.C., Kirschbaum, C., Meinlschmid, G., Hellhammer, D.H., 2003. Two formulas for computation of the area under the curve represent measures of total hormone concentration versus time-dependent change. Psychoneuroendocrinology 28, 916–931.

Russcher, H., van Rossum, E.F.C., de Jong, F.H., Brinkmann, A.O., Lambrechts, S.W.J., Koper, J.W., 2005. Increased expression of the Glucocorticoid receptor—a translational isoform as a result of the ER22/23EK polymorphism. Molecular Endocrinology 19, 1687–1696. Sapolsky, R.M., Romero, L.M., Muck, A.U., 2000. How do glucocorticoids influence stress responses ? Integrating permissive, suppressive, stimulatory, and preparative actions. Endocrine Reviews 21, 55–89. Siebelinck, B.M., Treffers, P.D., 2001. Dutch Version of the Anxiety Interview Schedule for children for DSM-IV, Child and Parent Versions by W.K. Silverman & A.M. Albano. Swets & Zeitlinger, Lisse. Silverman, W.K., Albano, A.M.,1996. The Anxiety Disorders Interview Schedule for Children for DSM-IV: (Child and Parent Versions). Psychological Corporation, San Antonio, TX. Snoek, H., Van Goozen, S.H.M., Matthys, W., Buitelaar, J.K., van Engeland, H., 2004. Stress responsivity in children with externalizing behavior disorders. Development and Psychopathology 16, 389–406. Sulon, J., Demey-Ponsart, L., Beauduin, P., Sodoyez, J.C., 1978. Radioimmunoassay of corticosterone, cortisol and cortisone: their application to human cord and maternal plasma. The Journal of Steroid Biochemistry and Molecular Biology 9, 671–676. Terleph, T.A., Klein, R.G., Roberson-Nay, R., Mannuzza, S., Moulton, J.L., Woldehawariat, G., Guardino, M., Pine, D.S., 2006. Stress responsivity and HPA axis activity in juveniles: results from a home-based CO2 inhalation study. American Journal of Psychiatry 163, 738–740. Van den Eede, F., Venken, T., Del-Favero, J., Norrback, K.F., Souery, D., Nilsson, L.G., Van den Bossche, B., Hulstijn, W., Sabbe, B.G., Cosyns, P., Mendlewicz, J., Adolfsson, R., Van Broeckhoven, C.V., Claes, S.J., 2007a. Single nucleotide polymorphism analysis of corticotropin-releasing factor-binding protein gene in recurrent major depressive disorder. Psychiatry Research 153, 17–25. Van den Eede, F., Venken, T., Van Den Bogaert, A., Del-Favero, J., Norrback, K.F., Nilsson, L.G., Adolfsson, R., Van Broeckhoven, C., Claes, S.J., 2007b. Single nucleotide polymorphism analysis of corticotropin-releasing factor-binding protein gene in bipolar disorder. Psychiatric Genetics 17, 304–307. Van de Wiel, N.M.H., Van Goozen, S.H.M., Matthys, W., Snoek, H., van Engeland, H., 2004. Cortisol and treatment effect in children with disruptive behavior disorders: a preliminary study. Journal of the American Academy of Child and Adolescent Psychiatry 43, 1011–1018. Van Goozen, S., Matthys, W., Cohen-Kettenis, P.T., Gispen-de Wied, C., Wiegant, V.M., van Engeland, H., 1998. Salivary cortisol and cardiovascular activity during stress in oppositional-defiant disorder boys and normal controls. Biological Psychiatry 43, 531–539. Van Goozen, S., Matthys, W., Cohen-Kettenis, P.T., Buitelaar, J.K., van Engeland, H., 2000. Hypothalamic-pituitary-adrenal axis and autonomic nervous system activity in disruptive children and matched controls. Journal of the American Academy of Child and Adolescent Psychiatry 39, 1438–1445. Van Rossum, E.F., Koper, J.W., Huizenga, N.A., Uitterlinden, A.G., Janssen, J.A., Brinkman, A.O., Grobbe, D.E., de Jong, F.H., van Duyn, C.M., Pols, H.A., Lamberts, S.W., 2002. A polymorphism in the Glucocorticoid receptor gene, which decreases sensitivity to glucocorticoids in vivo, is associated with low insulin and cholesterol levels. Diabetes 51, 3128–3134. Van Rossum, E.F., Voorhoeve, P.G., te Velde, S.J., Koper, J.W., Delemarre-van de Waal, H.A., Kemper, H.C., Lamberts, S.W., 2004. The ER22/23EK polymorphism in the Glucocorticoid receptor gene is associated with a beneficial body composition and muscle strength in young adults. Journal of Clinical Endocrinology and Metabolism 89, 4004–4009. Van Rossum, E.F.C., Binder, E.B., Majer, M., Koper, J.W., Ising, M., Modell, S., Salyakina, D., Lamberts, S.W.J., Holsboer, F., 2006. Polymorphisms of the glucocorticoid receptor gene and major depression. Biological Psychiatry 59, 681–688. van West, D., Del-Favero, J., Aulchenko, Y., Oswald, P., Souery, D., Forsgren, T., Sluijs, S., Bel-Kacem, S., Adolfsson, R., Mendlewicz, J., Van Duijn, C., Deboutte, D., Van Broeckhoven, C., Claes, S., 2004. A major SNP haplotype of the arginine vasopressin 1B receptor protects against recurrent major depression. Molecular Psychiatry 9, 287–292. van West, D., Van Den Eede, F., Del-Favero, J., Souery, D., Norrback, K.F., Van Duijn, C., Sluijs, S., Adolfsson, R., Mendlewicz, J., Deboutte, D., Van Broeckhoven, C., Claes, S., 2006. Glucocorticoid receptor gene-based SNP analysis in patients with recurrent major depression. Neuropsychopharmacology 31, 620–627. van West, D., Claes, S., Sulon, J., Deboutte, D., 2008. Hypothalamic-pituitary-adrenal reactivity in prepubertal children with social phobia. Journal of Affective Disorders 111, 281–290. Villafuerte, S.M., Del-Favero, J., Adolfsson, R., Souery, D., Massat, I., Mendlewicz, J., Van Broeckhoven, C., Claes, S., 2002. Gene-based SNP genetic association study of the corticotropin-releasing hormone receptor-2 (CRHR2) in major depression. American Journal of Medical Genetics 114, 222–226. Wechsler, D., 1974. Wechsler Intelligence Scale for Children – Revised. Psychological Corporation, New York. Wüst, S., 2007. Presentation at the Second Meeting of West European Societies of Biological Psychiatry, 13–15 December 2007, Strasbourg, France. Wüst, S., Van Rossum, E.F., Frederenko, I.S., Koper, J.W., Kumsta, R., Hellhammer, D.W., 2004. Common polymorphisms in the glucocorticoid receptor gene are associated with adrenocortical responses to psychosocial stress. Journal of Clinical Endocrinology and Metabolism 89, 565–573. Yang, S.J., Shin, D.W., Noh, K.S., Stein, M.A., 2007. Cortisol is inversely correlated with aggression for those boys with attention deficit hyperactivity disorder who retain their activity to stress. Psychiatry Research 153, 55–60. Yudt, M.R., Cidlowski, J.A., 2001. Molecular identification and characterization of a and b forms of the Glucocorticoid receptor. Molecular Endocrinology 15, 1093–1103.