Associations of adiponectin and fertility estimates in Holstein bulls

Theriogenology 79 (2013) 766–777

Contents lists available at SciVerse ScienceDirect

Theriogenology journal homepage: www.theriojournal.com

Associations of adiponectin and fertility estimates in Holstein bulls Vanmathy R. Kasimanickam a, Ramanathan K. Kasimanickam a, *, John P. Kastelic b, Jeffrey S. Stevenson c a

Department of Veterinary Clinical Sciences, College of Veterinary Medicine, Washington State University, Pullman, Washington, USA Faculty of Veterinary Medicine, University of Calgary, Calgary, Alberta, Canada c Department of Animal Sciences and Industry, College of Agriculture, Kansas State University, Manhattan, Kansas, USA b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 22 May 2012 Received in revised form 25 November 2012 Accepted 2 December 2012

Adiponectin is a pleiotropic regulator of numerous biological functions, including gonadal steroidogenesis and might play a role in sperm structures and functions. The objectives were to: (1) determine associations among serum concentrations of adiponectin, testosterone, and prolactin, and the sperm DNA fragmentation index; (2) associate sperm adiponectin mRNA abundance with estimates of fertility (sire conception rate); and (3) determine sperm protein expression of adiponectin and its receptor in pre- and postcapacitated sperm from Holstein bulls. In experiment 1, biweekly serum concentrations of adiponectin, prolactin, and testosterone were greater (P < 0.05) for high fertility bulls compared with average and low fertility bulls. Furthermore, sperm DNA fragmentation index was greater (P < 0.05) for low fertility compared with both average and high fertility bulls. In experiment 2, samples of sperm from a single collection from commercial Holstein bulls (N ¼ 34) were used to evaluate relative sperm mRNA expression of adiponectin and its receptors, AdipoR1 and AdipoR2, and protein levels of adiponectin and its receptors, AdipoR1 and AdipoR2, in pre- and postcapacitation sperm. The mRNA abundance of adiponectin and its receptors, AdipoR1 and AdipoR2, were greater for high fertility bulls (>2 to 4 sire conception rate) compared with average (2 to 2) and low (>2 to 4) fertility bulls. Based on the sperm capacitation assay, average fertility bulls had a greater percentage of acrosome-reacted sperm at 5 hours than high and low fertility bulls, whereas high fertility bulls had a greater percentage of acrosome-reacted sperm than low fertility bulls. After capacitation, levels of adiponectin protein were lower in average fertility bulls, AdipoR1 was lower in all fertility groups, and AdipoR2 was lower in average and high fertility bulls. In conclusion, adiponectin and its receptors had vital roles in sperm structural and functional traits and consequently they were associated with fertility. In addition to its role in steroidogenesis and sperm capacitation, adiponectin might be involved in sperm-egg fusion and fertilization. Published by Elsevier Inc.

Keywords: Dairy bull Sperm capacitation Adiponectin Sire conception rate

1. Introduction Fertility in male mammals is regulated by two adenohypophyseal gonadotropic hormones, LH and FSH, which modulate testosterone synthesis in Leydig cells and its aromatization to estradiol in Sertoli cells, respectively. The * Corresponding author. Tel.: þ1 509 335 6060; fax: þ1 509 335 0880. E-mail address: [email protected] (R.K. Kasimanickam). 0093-691X/$ – see front matter Published by Elsevier Inc. http://dx.doi.org/10.1016/j.theriogenology.2012.12.001

hypothalamo-hypophyseal-gonadal axis regulates release of hypothalamic GnRH, which alters secretion of gonadotropins and testosterone that are essential for spermatogenesis, sperm maturation, and reproductive behavior [1–3]. Prolactin, a 23 KDa hormone, is synthesized in the adenohypophyseal lactotrophs. Although no clear function was initially ascribed to prolactin in male mammals, including humans [4,5], it is now apparent that prolactin enhances several aspects of testicular function [4,5]. Thus,

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777

prolactin has been implicated in maintenance of spermatogenic cell morphology [6], upregulation of LH receptor number in Leydig cells [7,8], and stimulation of steroidogenesis including androgen production [8–10]. In contrast, prolactin might also inhibit aromatase activity [11]. Prolactin increased FSH receptor number in Sertoli cells in vitro [12] and is involved in morphogenesis of spermatocytes to spermatids [13]. Moreover, several in vitro effects of prolactin in sperm have been reported, including increased calcium binding and/or transport of ejaculated and epididymal sperm [13], increased energy metabolism [14], maintenance of mobility and attachment to the oocyte [15], and reduced capacitation time [15]. It is noteworthy that acute hyperprolactinemia suppressed testosterone synthesis and male fertility by inducing hypersecretion of adrenal corticoids or by inhibiting secretion of GnRH through prolactin receptors on hypothalamic dopaminergic neurons [16,17]. Emergence of the metabolic hormone, adiponectin, as a key endocrine signal, has been a major development, not only in energy balance, but more generally in areas including reproduction, inflammation, and immunology [18–20]. Adiponectin is a pleiotropic regulator of numerous biological functions, including gonadal steroidogenesis. Adiponectin secretion was suppressed by prolactin and growth hormone [21]. A significant, positive relationship between plasma adiponectin and high-density lipoprotein cholesterol previously reported in men [22]. This might contribute to increased testosterone production. In contrast, incubation of Leydig cells with recombinant adiponectin decreased testosterone production [23]. It is plausible that this recombinant adiponectin would have been ineffective or contended with the native adiponectin. We hypothesize that increased sperm adiponectin mRNA abundance might improve male fertility by improving sperm structure and function. The objectives were to: (1) determine associations among serum concentrations of adiponectin, testosterone, and prolactin, and the sperm DNA fragmentation index (% DFI; sperm chromatin structure assay); (2) associate sperm adiponectin mRNA abundance with estimates of fertility (sire conception rate; SCR); and (3) determine sperm protein expression of adiponectin in pre- and postcapacitated sperm obtained from Holstein bulls. 2. Materials and methods 2.1. Experiment 1: associations of adiponectin, prolactin, testosterone, and DNA fragmentation index 2.1.1. Bulls and sample collections Holstein bulls (N ¼ 10; age, 16.9  0.42 [14–18] months old) housed in a commercial bull stud center were selected for use in this study. There were four, four, and two bulls in the low, average, and high fertility sire groups, respectively, representing SCRs scores of 4 to <2, 2 to 2, and >2 to 4, respectively. Blood samples were collected (nine times, 2 weeks apart) by jugular venipuncture using serum separator Vacutainer tubes (Becton Dickinson and Co., Franklin Lakes, NJ, USA) between 8:00 AM and 10:00 AM. Samples were allowed to clot, centrifuged (800 g for 15 minutes), and then frozen pending subsequent analysis of

767

serum concentrations of testosterone, prolactin, and adiponectin. On each blood collection day, for each sire, two ejaculates were collected via artificial vagina, pooled, extended, loaded in 0.5 mL French straws, cryopreserved, and stored in liquid nitrogen. For each sire, 10 straws of frozen semen were subsequently randomly selected, thawed, and evaluated. 2.1.2. Determination of serum testosterone and prolactin concentrations Serum testosterone concentrations were determined by RIA (Coat-A-Count; Diagnostic Products Corporation, Los Angeles, CA, USA) according to the manufacturer’s instructions. The manufacturer reports a sensitivity of 4 ng/dL with a interassay CV of 4% to 18% and intra-assay CV of 6% to 11%. Prolactin was determined using a previously validated RIA [24] with a primary antibody (bPRL; A.F. Parlow) diluted to 1:200,000. Sensitivity averaged 0.3 ng/mL, and intra- and interassay CVs (six assays) averaged 6.8% and 6.3%, respectively. 2.1.3. Determination of adiponectin in serum samples Serum adiponectin concentrations were estimated by direct ELISA, as described [25]. Briefly, 100 mL of goatAcrp30- antibody (Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) were added to 96-well plates that were precoated with standards and samples, and kept at 4  C for at least 24 hours. After washing with buffer, 100 mL of secondary antibody, donkey anti-goat IgG-HRP (Santa Cruz Biotechnology Inc.) were added to each well. After washing with buffer, 200 mL of reagent containing the substrate (acetyl cholinesterase; Thermo Scientific Inc., Waltham, MA, USA) were added, followed by 50 mL of stop solution (Thermo Scientific Inc.) in 5 to 10 minutes, depending on color development. Plates were read at 450 nm using a Glomax-Multi Detection System (Promega Corporation, Madison, WI, USA) and serum adiponectin concentrations were calculated from the standard curve. Intra- and interassay CVs were 6.2% and 10.4%, respectively. 2.1.4. Determination of sperm DNA fragmentation index The sperm chromatin structure assay was performed as described [26]. It is based on the metachromatic properties of acridine orange to distinguish denatured from intact native DNA in sperm. The semen sample was thawed and diluted (2  106 sperm/mL) using TNE buffer (0.01 mol/L TRIS-HCl, 0.15 mol/L NaCl, and 1 mmol/L EDTA, pH 7.4). Acidinduced denaturation of DNA in situ was attained by adding 400 mL of an acid-detergent solution (0.1% [wt/vol] Triton X-100, 0.15 mol/L NaCl, and 0.08 N HCl; pH 1.2) to 200 mL of semen. After 30 seconds, sperm were stained by adding 1.2 mL of a solution containing 6 mg purified acridine orange (Polysciences, Warrington, PA, USA) per mL of buffer (0.1 mol/L citric acid, 0.2 mol/L Na2HPO4, 1 mmol/L EDTA, 0.15 mol/L NaCl; pH 6.0). All steps were performed at room temperature. At 3 minutes after acid-induced denaturation, samples were analyzed using a Coulter EPICS XL-MCL (Beckman Coulter, Fullerton, CA, USA) flow cytometer with 480 nm argon laser and 15 mW. Data corresponding to the red (>630 nm as detected by the FL2 detector) and green (530 nm as detected by the FL1 detector) fluorescence of

768

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777

acquired particles were recorded [27]. The flow cytometer was capable of distinguishing 1024 channels, fluorescence intensities, of both red and green fluorescence on each cell. The flow cytometer was operated a flow rate of 200 events per second, with a maximum of 10,000 sperm events accumulated for each sample. Sperm chromatin damage was quantified by the metachromatic shift from green (native, double-stranded DNA) to red (denatured, single-stranded DNA) fluorescence and displayed as red versus green. Results were stored as list mode files and further analysis of parameters was done with FCS Express software (Version 3.0; DeNovo Software, Thornhill, Ontario, Canada). The software calculated the %DFI [27]. The extent of DNA denaturation in terms of %DFI was calculated based on the ratio of red to total (red plus green) fluorescence for each sperm analyzed. 2.2. Experiment 2 2.2.1. Bulls and sample collection Holstein sires (N ¼ 34; age 2.2  0.06 years old) were used, based on their SCR estimates (August 2010), with approximately three sires selected within each full point SCR score from 4 to 4. To be eligible for consideration, SCR estimates were restricted to sires with 500 services or more (725  13.2 services per sire). There were three, three, four, five, five, three, three, and four bulls with SCR scores of 4, 3, 2, 1, 0, 1, 2, 3, and 4, respectively. Therefore, there were six, 20, and eight bulls in the low, average, and high fertility groups, respectively. Two ejaculates were collected via artificial vagina from each sire on each collection day, combined for processing in a single batch, loaded in 0.5 mL French straws, cryopreserved, and stored in liquid nitrogen. Ten straws per sire were selected randomly and shipped to the laboratory for evaluation. 2.2.2. Association of sperm adiponectin and its receptor mRNA expression and SCR 2.2.2.1. Determination of sperm mRNA expressions of adiponectin and its receptor 1 and 2 by real time polymerase chain reaction. 2.2.2.1.1. Total RNA extraction from sperm. Semen samples (100  106 sperm) were thawed at 36  C for 40 seconds in a water bath, diluted in PBS (pH ¼ 7.4) at room temperature, and centrifuged at 1000 g for approximately 10 minutes (low brake speed and room temperature). Sperm pellets were resuspended in PBS and centrifuged again using the same conditions (three washing steps). Total RNA extraction from sperm was carried out by TRIzol method, as described [28]. Briefly, each sperm pellet was ground in 1 mL TRIzol reagent using a disposable plastic homogenizer in a microcentrifuge tube. The lysate was passed subsequently through a 26-ga needle to ensure homogenization. Samples were incubated for 5 minutes to allow dissociation of nucleoprotein complexes. Phase separation was carried out using chloroform and RNA from the aqueous phase was precipitated in isopropyl alcohol and washed with 75% ethanol. Precipitates were air-dried and dissolved in nuclease-free water at 60  C. Concentration of RNA was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific Inc., West Palm

Beach, FL, USA) and sample absorbance ratio for 260:280 wavelengths were determined to ensure RNA purity (target of close to 2.0). The RNA samples were stored at 20  C pending preparation of complementary DNA (cDNA). 2.2.2.1.2. Polymerase chain reaction of selected genes of interest. The mRNA was reverse-transcribed to cDNA. The cDNA samples were prepared using the iScript cDNA Synthesis kit (Bio-Rad, Hercules, CA, USA). Then, 500 ng of RNA was reverse transcribed in a 20 mL reaction at 25  C for 5 minutes, 42  C for 30 minutes, and 85  C for 5 minutes (25 ng/mL RNA equivalent cDNA was obtained). Samples of total RNA were treated with Dexyribonuclease I, amplification grade (Invitrogen by Life Technologies, Grand Island, NY, USA) before reverse transcription to eliminate DNA contamination. Qiagen Tag polymerase chain reaction (PCR) master mix (Qiagen, Valencia, CA, USA) was used to amplify the fragment of the genes of interest. The final concentration of primers was 0.3 mmol/L. Initial denaturation was set at 94  C for 3 minutes, followed by 30 cycles of denaturation at 94  C for 1 minute, annealing at 55  C for 1 minute, and extension at 72  C. A final extension step (72  C for 10 minutes) was included. Primers (adiponectin, forward: GGTGAGACAGGAGATGTTGGAAT; reverse: CACACTGAACGC TGAGCGATA; AdipoR1, forward: GATCGGCCTGCTGATCATG; reverse: GACGCAGACGATGGAGAGGTA; AdipoR2, forward: GTGATCCCTCACGACGTGCTA; reverse: TCTTAAAACAGGCC CGGAAA) were designed either using the NCBI website or Primer Express version 3.0 (Applied Biosystems Inc., Carlsbad, CA, USA). Consideration was given to the set of primers (forward and reverse primers) to ensure separation of at least one intron, and melting temperatures and guaninecytosine content were optimized. Amplicon was run on a 2% agarose gel and stained with ethidium bromide to ensure a single amplicon for a set of primers (Supplementary Fig. 1). 2.2.2.1.3. Determination of mRNA expression using realtime PCR. Relative mRNA expression was characterized with SYBR green chemistry. Fast SYBR green master mix (2X, Applied Biosystems Inc.) was used to prepare the reaction mix. The final concentration of each primer was 0.3 umol/L, with 20 mL of three technical replicates used for each sample; 1.6 mL of 25 ng/mL RNA equivalent cDNA was present in the total volume of the three triplicates. A StepOne Plus thermocycler (Applied Biosystems Inc.) was used for real time PCR. The precycling stage was maintained at 95  C for 20 seconds. Forty-cycle amplification was done (95  C for 3 seconds and 60  C for 30 seconds; fast ramp speed conditions for the fast mixture). A continuous dissociation step was added to detect additional amplification products. Carboxy X rhodamine dye was used as the passive internal reference. The baseline was adjusted automatically to obtain threshold cycles of each sample. Threshold cycles were normalized to an endogenous control, bovine ribosomal protein. A standard curve was obtained using 1 in 5 dilutions for each set of primers (to verify amplification efficiency). The correlation coefficient for the dilution curve was 0.99. 2.2.3. Immunolocalization of adiponectin and its receptors 1 and 2 Frozen-thawed sperm were washed three times with PBS (pH 7.4; Life Technologies) using centrifugation steps

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777

at 800 g for 15 minutes at room temperature. Approximately 40 mL of sperm sample (10  106/mL) was smeared onto a polylysine-coated microscopic slide, air dried, fixed in methanol for 5 minutes, and then placed in acetone for 30 seconds at room temperature. Slides were washed (three times) in PBS. A circular area of sperm was marked with a wax pen and blocked in PBS with 10% goat serum for AdipoR2 screening and in PBS with 10% rabbit serum for screening AdipoQ secretory protein and AdipoR1 localization. Sperm were incubated in blocking buffer for at least 1 hour in a humid container. After washing in PBS, sperm were incubated overnight with primary antibodies (SC-26496, SC-46748, and SC-99184; Santa Cruz Biotechnology Inc.) at room temperature. Primary antibodies were diluted 1:50 in PBS. An affinitypurified goat polyclonal antibody raised against a peptide mapping near the N-terminus (SC-26496; Santa Cruz Biotechnology Inc.) of AdipoQ was used to tag the presence of the secretory protein AdipoQ. An affinity-purified goat polyclonal antibody raised against a peptide mapping near the C-terminus of AdipoR1 of human origin (SC-46748; Santa Cruz Biotechnology Inc.) was used to localize AdipoR1 in bovine sperm, whereas a rabbit polyclonal antibody developed against amino acids 287– 330 mapping near the C-terminus of AdipoR2 of human origin was used to localize AdipoR2. Epitopes used to raise antibodies had substantial similarities with bovine tissues; therefore, primary antibodies were recommended for use in cattle. After overnight incubation with primary antibodies, slides were washed in PBS three times, each for 5 minutes. Bovine sperm were then incubated with secondary antibodies labeled with fluorescein isothiocyanate (FITC). Secondary antibodies were diluted 1:100 in PBS with 10% rabbit serum for AdipoQ and AdipoR1 screening, and in PBS with 10% goat serum for AdipoR2 targeting. Affinity-purified rabbit anti-goat IgG specific antibody conjugated with FITC (61-1611; Invitrogen) was used to target bound primary antibodies of AdipoQ and AdipoR1 and affinity-purified goat ant-rabbit IgG (HþL) specific antibody conjugated with FITC (65-6111, Invitrogen) was used to tag the primary antibody of AdipoR2 bound to the receptor in bovine sperm. Secondary antibodies were incubated for 45 minutes and then the slides were washed three times in PBS. Thereafter, slides were air-dried for 2 to 3 minutes (over-drying was avoided). Immunostained slides were then mounted with Vectashield mounting medium containing propidium iodide (H-1300; Vector Laboratories, Burlingame, CA, USA) as a counterstain. The four corners of the coverslip were sealed with clear nail polish to avoid sliding of the coverslip over the immunostained sperm. Fluorescent-labeled immunostained bovine sperm were viewed using a confocal microscope (Zeiss LSM 510 META, Carl Zeiss Microscopy LLC, Thornwood, NY, USA). The objective plus water lens was used and the objective magnification was 63. All possible negative controls were included in the immunostaining procedure. All settings including excitation wave length, pinhole, detector gain, amplifier offset, and amplifier gain were similar for positive slides and negative controls of a single target protein.

769

2.2.4. Protein levels of adiponectin and its receptors 1 and 2 in pre- and postcapacitated sperm 2.2.4.1. Sperm capacitation. Frozen thawed bull semen from each sire was washed through a 45% Percoll layer made in sp-TALP medium [29]. Sperm were cleared from the extender by centrifugation (750 g, 15 minutes) at room temperature and washed again in sp-TALP by centrifugation (500 g, 5 minutes) to remove the Percoll. Using this procedure, no sperm selection occurred because all cells (normal, abnormal, motile, or nonmotile) went through the layer. In vitro capacitation of bull sperm was accomplished as described [29]. Briefly, sperm pellets were suspended in glucose-free TALP medium containing 100 mmol/L NaCl, 3.1 mmol/L KCl, 1.5 mmol/L MgCl2, 25 mmol/L NaHCO3, 0.29 mmol/L KH2PO4, 21.6 mmol/L sodium lactate, 0.1 mmol/L sodium pyruvate, 2 mmol/L CaCl2, 20 mmol/L HEPES (pH 7.4), 50 mg/mL BSA, 10 U/mL penicillin, and 20 mg/mL heparin. Sperm samples were incubated at 38.5  C under an atmosphere of 5% CO2, 95% air, and 100% humidity at a concentration of 20  106 sperm/mL. Samples from each sire were evaluated for protein expression at the beginning (0 hours), and at 5 hours after incubation for sperm. 2.2.4.2. Monitoring of dynamics of membrane intact and acrosome-reacted sperm. For membrane integrity, 5 mL of 20 mmol/L SYBR 14 in DMSO and 3 mL of 2.4 mmol/L propidium iodide (PI; Molecular Probes Inc., Eugene, OR, USA) were added to 500 mL of the sample (concentration, 2  106 sperm/mL) and incubated at 37  C for 30 minutes after gentle mixing of the sample. Propidium iodide binds to DNA and can be used for determining cell membrane integrity in bull sperm, because only membrane-defective cells are stained [30]. A minimum of 400 sperm was analyzed for each sample at magnification 400 using fluorescence microscopy (Leitz, Laborlux S, Wetzlar, Germany) fitted with a blue filter set at 450 to 490 nm excitation wavelength. Sperm that were PI-negative were considered to have a fully functional membrane and to be alive. The calcium ionophore A23187 (Molecular Probes) was added and incubated under 5% CO2, 95% air, and 100% humidity for 6 minutes with the sperm samples. After incubation, samples were gently mixed and 30 mL of each sample were used to make smears for FITC-conjugated peanut agglutinin (Sigma-Aldrich, St. Louis, MO, USA) staining to detect the percentage of acrosome intact and reacted sperm [31]. A sperm smear was made on microscopic slide, air dried, placed in 100% ethanol at 20  C for 20 seconds, air dried, and 60 mL of a 20 mg/mL FITCconjugated peanut agglutinin in PBS was placed on the smears and covered with transparency film. After 30 minutes incubation at room temperature, slides were kept in distilled water for 10 minutes, air-dried, and a drop of an antifade solution was placed on the smear and covered with a cover slip. Slides were stored at 20  C and subsequently, 400 cells were observed at magnification 400 under fluorescence microscopy (Leitz, Laborlux S) fitted with blue filter illumination at an excitation wave length of 450 to 490 nm and the percentage of acrosome-intact and reacted sperm were determined for each sample. Sperm without green fluorescence staining of the outer acrosomal

770

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777

membrane with a green fluorescence band at the equatorial segment and with a disrupted, patchy distribution of fluorescence were considered reacted, and those with complete bright fluorescence were considered intact. 2.2.4.3. Protein dot-blot analysis. Proteins from pre- and postcapacitated bull sperm were extracted for determination of protein expression by the dot plot method [32–34]; http://www.westernblotting.org/dot blot protocol.html. A total of 100  106 sperm was homogenized using a handheld tissue homogenizer in 1 mL of ice cold RIPA buffer (Product no: R0278, Sigma-Aldrich Inc.). Protease and phosphatase inhibitor cocktails were added to the RIPA buffer at 10 mL each to 1 mL of RIPA buffer before homogenization. Homogenized lysate was incubated at 4  C for 45 minutes. After incubation, samples were centrifuged at 14,000 g for 30 minutes and the supernatants were separated and stored at 20  C for downstream protein analysis. Protein absorbance was measured at 280 nm using a Nanodrop 1000 spectrophotometer (Thermo Scientific Inc.) and the protein concentrations of the samples were determined. An aliquot (2 mL) of the sample was used and analyses were repeated three to five times to ensure reproducibility. Protein concentration ranged from 40 to 50 mg/mL. Supported nitrocellulose membrane (Bio-Rad) with 0.45 mm pore size was used to spot protein samples and a one in 10 dilution of protein samples was selected to spot. A grid was drawn and 10 mL of the sample was dropped at the center of 2 cm2. The membrane was air dried for 15 to 20 minutes. It was blocked with either 10% rabbit serum and 0.05% Tween 20 in PBS, or 10% goat serum and 0.05% Tween 20 in PBS for approximately 1 hour at room temperature on a rotating platform. The blots were incubated with primary antibodies for adiponectin, AdipoR1 and AdipoR2 (SC-26496, SC-46748, and SC-99184, Santa Cruz Biotechnology Inc.) for 60 minutes. Antibodies were diluted in PBS at 1 in 500 dilutions. They were washed three times with wash buffer (1% rabbit or goat serum, 0.05% Tween 20 in PBS) at 5 minutes wash each time. The blots were incubated in secondary antibodies labeled with FITC (Adiponectin and AdipoR1: 61-1611; AdipoR2: 656111, Invitrogen) for 30 minutes at room temperature in the dark. Secondary antibodies were diluted to 1 in 250. They were washed three times and the last wash was in PBS. Blots were scanned using Molecular Imager Pharose FX Plus System (Bio-Rad) equipped with Quantity One 1-D acquisition and analysis software. Scanning was done at 488 nm excitation laser wave length and 530 nm band pass, with 100 mm resolution. Images were obtained using the manufacturer’s software. All possible negative controls were included with the samples. Quantitative analysis (Supplementary Fig. 2) was performed for four separately repeated experiments using ImageJ software (National Institutes of Health, Bethesda, MD, USA) as described [35,36]. Relative protein levels were expressed as arbitrary units. 2.3. Statistical analyses 2.3.1. Experiment 1 Data were analyzed with a statistical software program (SAS Version 9.1 for Windows, SAS Institute, Cary, NC, USA).

Repeated measures of ANOVA (PROC MIXED procedure of SAS) were used to determine differences in %DFI and hormone concentrations. Differences in %DFI and hormone concentrations were compared within and across bulls and weeks of collection by creating contrast statements. Age of bulls was offered in the model. The difference in median serum hormone concentrations and %DFI among sire fertility groups were determined by the Kruskal–Wallis method. Pearson correlation was estimated to determine correlations among %DFI, prolactin, adiponectin, and testosterone. Multivariate regression analysis was estimated to determine the influence of testosterone, prolactin and adiponectin on sperm %DFI. For all statistical analyses, P < 0.05 was considered significant. 2.3.2. Experiment 2 The coefficient of determination was estimated to determine the association of differences in mRNA abundance for adiponectin, AdipoR1, and AdipoR2 with individual bull SCR scores. The real-time PCR data were analyzed by ANOVA using 2DDCt values [37] to ascertain the statistical significance of any differences in mRNA expressions of adiponectin, AdipoR1, and AdipoR2. Partial least square coefficients were plotted to test model adequacy. To determine differences in sperm membrane parameters and protein concentrations among fertility groups, mean values were analyzed by General Linear Model and pair-wise comparisons were done with a Tukey’s honest significant difference test. For all statistical analyses, P < 0.05 was considered significant. 3. Results 3.1. Experiment 1. Serum adiponectin, prolactin, and testosterone concentrations, and DNA fragmentation index in bull fertility groups Ranges during different semen collection period were: adiponectin, 178 to 654 ng/mL; %DFI, 1.03 to 4.12; serum testosterone, 0.5 to 11.5 ng/mL; and prolactin, 2.17 to 113.7 ng/mL. Results of repeated measures of ANOVA for the effects of bulls and days on the dependent variables %DFI, and testosterone, prolactin, and adiponectin concentrations is shown in Table 1. No differences in %DFI were detected among sampling days (P > 0.10), but there were differences (P < 0.05) among bulls within sampling days. Hence, the %DFI between sampling days were averaged for analysis. Serum concentrations of adiponectin, prolactin, and testosterone varied among sampling days (P < 0.05) and among bulls (P < 0.05). Bull by day interactions were significant (P < 0.05) for adiponectin, testosterone, and Table 1 ‘P’ values from repeated measures of ANOVA for the effects of bulls and days on the dependent variables sperm DNA fragmentation index (%DFI), and testosterone, prolactin, and adiponectin concentrations. Effect

Adiponectin

Testosterone

Prolactin

%DFI

Bulls Day Bulls by day

<0.05 <0.05 <0.05

<0.05 <0.05 <0.05

<0.05 <0.05 <0.05

<0.05 >0.05 >0.05

Accounting for age (P < 0.05).

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777

A

700

c

Adiponectin (ng/mL)

600 500

b 400 300

a 200 Low

B

Average Sire fertility group

120

High

c

Prolactin (ng/mL)

100 80 60 40 b 20

a

0 Low

C

Average Sire fertility group

High

c

12

Testosterone (ng/mL)

10

b

8 6

a

4 2 0 Low

D

Average Sire fertility group

High

a 7 6

DFI (%)

5

771

prolactin but not for %DFI. No bull fertility groups by day interaction was observed (P > 0.1). Median (25th, 75th percentile) adiponectin serum concentrations differed (P < 0.05) among fertility groups, 203.00 (187.8, 217.3), 287.0 (241.5, 350.5), and 564.0 (482.0, 623.0) in low, average, and high fertility bulls, respectively (Fig. 1A). Adiponectin was greater (P < 0.05) in high fertility compared with average and low fertility bulls. Furthermore, average fertility bulls had greater (P < 0.05) serum adiponectin concentrations than low fertility bulls. Median (25th, 75th percentile) serum prolactin concentrations differed (P < 0.05) among fertility groups, 5.28 (4.16, 6.35), 11.60 (10.05, 15.07), and 32.8 (23.3, 63.3) in low, average, and high fertility bulls, respectively (Fig. 1B). Prolactin concentrations were greater (P < 0.05) in high fertility bulls than in average and low fertility bulls, whereas average fertility bulls had greater (P < 0.05) concentrations of prolactin than low fertility bulls. Median (25th, 75th percentile) serum testosterone concentrations differed (P < 0.05) among fertility groups, 4.08 (3.65, 4.27), 5.79 (5.00, 6.69), and 10.64 (9.08, 11.21) in low, average, and high fertility bulls, respectively (Fig. 1C). Serum testosterone concentrations were greater (P < 0.05) in high fertility bulls than in average and low fertility bulls. Average fertility bulls had greater (P < 0.05) concentrations of prolactin than low fertility bulls. Median (25th, 75th percentile) %DFI differed (P < 0.05) among fertility groups, 4.12 (3.98, 4.49), 1.71 (1.59, 1.80), and 1.21 (1.34, 1.42) in low, average, and high fertility bulls, respectively (Fig. 1D). The %DFI was less (P < 0.05) in high fertility bulls than in average and low fertility bulls, and average fertility bulls had lower (P < 0.05) %DFI than low fertility bulls. Correlation coefficients among sperm DNA fragmentation index, prolactin, adiponectin, and testosterone are given in Supplementary Table 1. Negative correlations (P < 0.05) were observed between %DFI and testosterone (r ¼ 0.75), %DFI and adiponectin (r ¼ 0.75), and %DFI and prolactin (r ¼ 0.57). Testosterone (r ¼ 0.88) and adiponectin (r ¼ 0.87) were positively correlated with prolactin (P < 0.01). Adiponectin and adiponectin were positively (r ¼ 0.97) correlated (P < 0.001). Multivariate regression analysis revealed testosterone (P ¼ 0.05) and prolactin (P < 0.05) but not adiponectin influenced %DFI (Supplementary Table 2).

4

3.2. Experiment 2 3

b c

2 1 Low

Average Sire fertility group

High

Fig. 1. (A) Median blood serum adiponectin concentrations and sire conception rate (SCR) in Holstein bulls. There were four, four, and two bulls in the low, average, and high fertility sire groups, respectively, representing SCRs scores of 4 to <2, 2 to 2, and >2 to 4, respectively. a–c Each sire fertility group differed (P < 0.01) from the other two. (B) Median blood serum prolactin concentrations and SCR in Holstein bulls. There were four, four, and two bulls in the low, average, and high fertility sire groups, respectively, representing SCRs scores of 4 to <2, 2 to 2, and >2 to 4, respectively. a–c Each sire fertility group differed (P < 0.01) from the other two. (C) Median blood serum

3.2.1. Association of sperm adiponectin and its receptors mRNA expressions and SCR The fitted plot line and multiple correlation coefficients for mRNA abundance for the target genes evaluated and testosterone concentrations and SCR in Holstein bulls. There were four, four, and two bulls in the low, average, and high fertility sire groups, respectively, representing SCRs scores of 4 to <2, 2 to 2, and >2 to 4, respectively. a–c Each sire fertility group differed (P < 0.01) from the other two. (D) Median percentage sperm DNA fragmentation index and SCR in Holstein bulls. There were four, four, and two bulls in the low, average, and high fertility sire groups, respectively, representing SCRs scores of 4 to <2, 2 to 2, and >2 to 4, respectively. a–c Each sire fertility group differed (P < 0.01) from the other two.

772

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777

SCR scores of the Holstein bulls are shown (Fig. 2). Correlation coefficients for mRNA abundance and SCR were positive (P < 0.01) for adiponectin, AdipoR1, and AdipoR2 (R2 ¼ 0.80, 0.90, and 0.65, respectively; Fig. 2A–C). Mean adiponectin (0.02- to 3.97-fold), AdipoR1 (0.06- to 2.68fold), and AdipoR2 (0.02- to 2.32-fold) mRNA abundance were greater (P < 0.05) for positive SCR score bulls than for bulls with negative SCR scores (Supplementary Fig. 3). The

A

Adiponectin 8

y = -0.8216x + 0.2379 R² = 0.80

mRNA expressions of adiponectin, AdipoR1, and AdipoR2 differed (P < 0.05) among low, average, and high fertility groups (Fig. 3). 3.2.2. Localization of adiponectin and its receptors 1 and 2 Adiponectin protein was abundant in the tail region of sperm, but scarce in the cytoplasm (Fig. 4A). Based on AdipoR1 immunolocalization by fluorescent staining, the receptor was localized mainly at the sperm membrane of the equatorial region and acrosomal region (Fig. 4B). Furthermore, AdipoR2 was localized primarily on the sperm head region, with a bright band on the equatorial line (Fig. 4C).

6

3.2.3. Monitoring of dynamics of membrane-intact and acrosome-reacted sperm The sperm capacitation assay revealed average fertility bulls had a greater percentage of plasma membrane disintegrated and acrosome-reacted sperm at 5 hours than high and low fertility bulls after capacitation (Fig. 5; P < 0.05). Furthermore, high fertility bulls had greater percentage of plasma membrane disintegrated and acrosome-reacted sperm than low fertility bulls after capacitation (Fig. 5; P < 0.05).

Mean CT value

4 2 0 -2 -4 -6

-4

B

-2

0 Sire conception rate

2

4

Adiponectin receptor 1 (AdipoR1) 10

3.2.4. Expression of adiponectin and its receptor proteins The presence of immunodetectable AdipoQ, AdipoR1, and AdipoR2 proteins were observed in the dot blot using the same antibodies as used for immunofluorescent assay (Supplementary Fig. 2). For each antigen, a single dot was observed in the lysate of bull sperm samples pre- and postcapacitation. Immunoblots were also probed for b-actin for normalization of samples. Quantitative analyses of relative protein expressions (arbitrary units) for AdipoQ, AdipoR1, and AdipoR2 are shown (Fig. 6). Capacitation reduced AdipoQ protein expression in average fertility bull groups. Capacitation reduced AdipoR1 protein expression in all fertility groups. The AdipoR1 protein concentration after capacitation was greatly reduced in average fertility

y = -0.6723x + 5.6642 R² = 0.90

Mean CT value

8 6 4 2

0 -4

C

-2

0 Sire conception rate

2

4

Adiponectin receptor 2 (AdipoR2) y = -0.6572x + 2.8326 R² = 0.65

Mean CT value

8

6 4 2 0

-4

-2

0 Sire conception rate

2

4

Fig. 2. Multiple correlation coefficient (R2) of mean CT* values (from sperm cDNA polymerase chain reaction [PCR]) and sire conception rate. (A) Adiponectin (R2 ¼ 0.80; P < 0.0001); (B) AdipoR1 (R2 ¼ 0.90; P < 0.0001); and (C) AdipoR2 (R2 ¼ 0.65; P < 0.0001). Each closed circle represented at least one bull. The smaller the CT value is, the greater the quantity of target cDNA in a given PCR. In an ideal PCR, the number of target molecules doubles in each PCR cycle. Therefore, a difference in the CT value of 1 corresponds to a concentration difference of 2. *CT, cycle threshold.

4 Relative mRNA expression (Normalized to endogenous control)

10

c 3

c

c 2 b 1

b

b a

a

0 ADIPOQ Low

AR1 Bull fertility groups Average

AR2

High

Fig. 3. Mean  SD mRNA expressions of adiponectin (ADIPOQ), adiponectin receptor 1 (AR1), and adiponectin receptor 2 (AR2) among bull fertility groups. There were six, 20, and eight bulls in the low, average, and high fertility sire groups, respectively, representing sire conception rates scores of 4 to <2, 2 to 2, and >2 to 4, respectively. a–c Each sire fertility group differed (P < 0.05) from the other two.

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777

773

Fig. 4. (A) Adiponectin (AdipoQ) immunolocalization in frozen-thawed bull sperm by fluorescent staining. (a) Green fluorescence through a single FITC channel; (b) red fluorescence via PI or red channel; (c) merged for FITC and PI fluorescence; and (d) merged fluorescence in the primary antibody negative control sperm. Note the absence of FITC staining. The AdipoQ protein was abundant in the tail region (open triangle), but scarce in the cytoplasm (white arrow). (B) Adiponectin receptor 1 (AdipoR1) immunolocalization in frozen-thawed bull sperm by fluorescent staining. (a) Green fluorescence through FITC single channel; (b) PI counter staining via red fluorescence single channel; (c) merged for green and red fluorescence; and (d) merged for primary antibody negative control. Note the absence of FITC staining. The AdipoR1 localization was mainly present at the sperm membrane of equatorial region and acrosomal region of bull sperm (white arrow). The receptor also was localized in the sperm tail (open arrow). (C) Adiponectin receptor 2 (AdipoR2) immunolocalization in frozen-thawed bull sperm by fluorescent staining. (a) Green fluorescence through FITC single channel; (b) red fluorescence via red or PI single channel; (c) merged for FITC and counter staining PI; and (d) merged fluorescence for primary antibody negative control. Note the absence of green staining. The AdipoR2 localization was present primarily on the sperm head, manifested as the bright band on the equatorial line (white arrow) and in the tail (open triangle). FITC, fluorescein isothiocyanate; PI, propidium iodide.

bulls compared with low and high fertility bulls (Fig. 5B). Protein concentrations for AdipoR2 were reduced after capacitation in average and high fertility bulls. The

reduction in AdipoR2 protein concentration after capacitation was greater in average fertility bulls compared with high fertility bulls.

774

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777

Spermatozoa (%)

60 b

b

45

c

c

a

30

a

15 0 AR Low

PI Average

High

Fig. 5. Mean  SD differences in percentage sperm (compared with precapacitation sperm parameters) monitored for membrane dynamics after responsiveness to capacitating conditions. a,b Sperm traits differed (P < 0.05); between bull fertility groups. Low indicates low fertility sire groups; average, average fertility sire groups; and high indicates high fertility sire groups. There were six, 20, and eight bulls in the low, average, and high fertility sire groups, respectively, representing sire conception rates scores of  4 to < 2,  2 to  2, and > 2 to  4, respectively. AR, sperm (%) undergoing acrosome reaction; PI, proportion of the membranedefective sperm.

4. Discussion In the present study, associations between serum concentrations of adiponectin, testosterone, and prolactin with sperm DNA fragmentation were determined for three sire fertility groups. In addition, associations of serum concentrations and sperm mRNA abundance of adiponectin and fertility in Holstein bulls were evaluated. Furthermore, immunocytochemistry was used to localize adiponectin and its receptors, AdipoR1, and AdipoR2, in sperm, to further elucidate their roles in sperm function. In the present study, serum adiponectin concentrations were greater in high and average fertility bulls than in low

2.00 1.50

b1

b1

b1

b1

a1

a2 a1

a1 a1

PostCap

Precap

b1 b1

b2 a2 a2

a1

PostCap

Precap

a1a2

b2

1.00 0.50 0.00 Precap

AdipoQ

AdipoR1 Low

Average

PostCap

AdipoR2 High

Fig. 6. Quantitative analyses of adiponectin (AdipoQ) and its receptors 1 (AdipoR1) and 2 (AdipoR2) protein concentrations (arbitrary unit) in pre(Precap) and postcapacitated (PostCap) sperm. The relative concentration of each protein were normalized against corresponding endogenous control and expressed as relative optical density. Data were obtained from three separate analyses and expressed as mean  SD. a,b Protein expression differed (P < 0.05) between bull fertility groups within capacitation status. 1,2 Protein expression differed (P < 0.05) between capacitation status within bull fertility groups. Low indicates low fertility sire groups; average, average fertility sire groups; and high, high fertility sire groups. There were six, 20, and eight bulls in the low, average, and high fertility sire groups, respectively, representing sire conception rates scores of 4 to <2, 2 to 2, and >2 to 4, respectively.

fertility bulls. It was previously reported that AdipoR1 was localized to the seminiferous epithelium, and AdipoR2 was expressed in interstitial Leydig cells and might serve to link metabolic homeostasis and testis function [34,38]. It was recently reported, however, that increased adiponectin concentrations suppressed testosterone production by Leydig cells in a dose-dependent manner in rats [23]. In that regard, adiponectin inhibited basal and human chorionic gonadotropin-stimulated testosterone secretion in the testis of adult rats [36], possibly by suppression of a steroidogenic acute regulatory protein. In contrast, in the present study, adiponectin and testosterone concentrations were greater in high fertility bulls [22]. The significant, positive relationship between plasma adiponectin and high-density lipoprotein cholesterol previously reported in men [22] might have contributed to the greater testosterone concentrations in bulls. Furthermore, reductions in peripheral testosterone concentrations are related to reductions in sperm concentration and motility [39]. Serum prolactin concentrations were greatest in high fertility bulls in the present study. There are indications that prolactin might have a regulatory role in spermatogenesis. For example, more morphologically normal sperm were detected in hyperprolactinemic patients [40], although an increased incidence of high prolactin concentrations were reported in oligozoospermic and azoospermic men [40]. Hyperprolactinemia, however, neither impaired spermatogenesis in the testis nor sperm maturation in the epididymis [41]. In addition, incubating fresh epididymal sperm for 90 minutes in culture media containing various prolactin concentrations did not reduce their motility, although the fertilization rate was significantly decreased when prolactin concentrations reached 100 ng/mL. Perhaps prolactin exerted its effects on male germ cells in the cauda epididymis and subsequently during capacitation, fertilization, or both. Serum prolactin concentrations were significantly reduced in bulls grazing endophyte infected tall fescue pastures compared with those grazing noninfected pastures [42]. In bulls with reduced prolactin concentrations, during a 3-hour stress test, postthaw sperm motility was significantly decreased, in addition to altered computer assisted sperm analysis parameters. Furthermore, sperm penetration was reduced in oocytes fertilized with sperm from bulls grazing endophyte-infected compared with noninfected tall fescue pastures (64.5  3.3% vs. 87.4  1.6%), coupled with hastened meiotic completion and reduced intracellular calcium characteristics. Therefore, several key elements, including age of bulls as noted in this study, might be involved in modulating the effects of serum prolactin on steroidogenesis and on sperm structural and functional traits. Serum prolactin concentrations should be maintained within a normal range, because concentrations greater or less than the normal range affected sperm function and fertility. Furthermore, because daily serum prolactin concentrations are affected by photoperiod [43] and ambient temperatures [44], these conditions might have contributed to variations reported in previous studies and should be considered. It was noteworthy that blood and semen collection were consistently done at the same time of day in the present study.

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777

775

Fig. 7. Schematic diagram regarding possibilities and limitations of using sperm responsiveness to evaluate sperm fertility competence.

It should be noted that the testosterone and adiponectin were positively correlated with prolactin. Adiponectin and testosterone were positively (r ¼ 0.97) correlated (P < 0.001). However, multivariate regression analysis revealed testosterone (P ¼ 0.05) and prolactin (P < 0.05) but not adiponectin influenced %DFI. This indicates that adiponectin role in sperm structural and functional parameters is not via sperm DNA condensation and possibly via sperm capacitation. Alternatively adiponectin might plausibly be involved in sperm DNA condensation indirectly via boosting testosterone and prolactin concentrations. Adiponectin, AdipoR1, and AdipoR2 were immunolocalized in the acrosomal, postacrosomal, equatorial, and tail regions of bull sperm in the present study. Adiponectin is an adipocyte marker that might have a role in cholesterol efflux, and thereby, in capacitation. It should be noted that a sperm-specific ATP-binding cassette (ABC) transporter regulates intracellular lipid metabolism in rodents [45]. A recent study concluded that adiponectin and its receptors (AdipoR1 and AdipoR2) increased cholesterol efflux and also enhanced reconstituted high density lipoproteininduced efflux, at least partially through an ABCA1 pathway [46]. In that study, AdipoR1 and AdipoR2 cDNA were transfected into cells and then labeled with [3H] cholesterol after cholesterol loading, with or without adiponectin for 24 hours, and cholesterol efflux was measured using a liquid scintillation counter. In that study, treatment with adiponectin was associated with greater efflux in AdipoR1- and AdipoR2-transfected cells. In contrast, downregulation of adiponectin receptors using shorthairpin RNA decreased reconstituted high density lipoprotein-induced cholesterol efflux. It is plausible the adiponectin and its receptors might participate in cholesterol efflux via a sperm-specific ABC transporter and thereby affect capacitation. Sperm populations that illustrate only a slow increase in intracellular calcium ion content are not able to respond sufficiently to capacitating conditions and might be unable to undergo capacitation and fertilize the oocyte. Low

fertility bulls did not have high responsiveness and did not fulfill the necessary requirement for good fertilizing competence. Sperm populations with a high level of responsiveness fulfill the necessary requirement for fertilizing competency (high fertility bulls). Positive responsiveness to capacitating conditions, however, is not a sufficient condition for determining fertilizing competency. An excessive acrosome reaction in response to incubation under capacitating conditions and addition of calcium ionophore could lead to too rapid destabilization (average fertility bulls) and cell death. Therefore, sperm responsiveness should be judged not only by the absolute magnitude of the particular sperm traits, but also as a specific sequence of events. In this context, initial responsiveness levels of average fertility bulls were similar to those of high fertility bulls, but the following changes progressed too rapidly, so that final responsiveness levels were considerably elevated (Fig. 7). Therefore, greater levels of acrosome reaction (and/or membrane-defective sperm) might be an indication of lower fertility, so that the upper limit of responsiveness must be taken into consideration for assessment of fertility. Protein concentrations of AdipoQ, AdipoR1, and AdipoR2 differed after capacitation. This partly explains the participation of these proteins in capacitation. In addition, expression of protein after capacitation indicates its potential involvement in sperm–egg interactions and fertilization. In the present study, the mRNA abundance of adiponectin and its receptors (AdipoR1 and AdipoR2) were greater for bulls with larger SCR than for bulls with negative SCR. In addition, serum adiponectin concentrations were positively correlated with SCR. Expression of AdipoR1 and AdipoR2 were reported in ovulated oocytes, after fertilization and in peri-implantation embryos [47]. Furthermore, expression was greater at the morula and blastocyst stages. Treatment with adiponectin increased the proportion of mouse embryos with large numbers of cells and mutated trimeric adiponectin decreased the proportion of embryos with large numbers of cells. In

776

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777

addition, serum and follicular adiponectin concentrations have been proposed as markers for intracytoplasmic sperm injection success [48], and the presence of adiponectin, AdipoR1, and AdipoR2 mRNA in mouse decidual cells at implantation sites has been demonstrated [49]. Therefore, we inferred that adiponectin and its receptors have important roles in embryo development and implantation. 4.1. Conclusions Serum concentrations of adiponectin, testosterone, and prolactin were greatest in high fertility bulls. Furthermore, immunolocalization demonstrated the presence of adiponectin and its receptors, AdipoR1 and AdipoR2, in sperm. Serum adiponectin concentrations and sperm adiponectin and its receptors mRNA abundances were correlated with the SCR. In the present study, increased adiponectin and prolactin were associated with a lower %DFI, perhaps by increased gonadal steroidogenesis (boosting blood testosterone concentrations). Adiponectin and its receptors’ expression were present pre- and postcapacitation, indicating their role in capacitation and possibly involvement in other functions. Therefore, adiponectin and its receptors also have vital roles in the organization of sperm structural and functional traits and consequently might affect fertility. It is possible that in addition to its role in steroidogenesis and capacitation, adiponectin might be involved in sperm– egg fusion and fertilization. Acknowledgments

[6]

[7]

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18] [19]

This research was supported by financial assistance from the College of Veterinary Medicine, Washington State University; Grant Account: 2530-9814. The authors thank Select Sires Inc. for providing semen samples and appreciate their participation in this study. The authors also thank Dr. Geoffrey Dahl, University of Florida, for assistance with the prolactin assay.

[20]

[21]

[22]

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/ j.theriogenology.2012.12.001.

[23]

[24]

References [25] [1] Singh J, O’Neill C, Handelsman DJ. Induction of spermatogenesis by androgens in gonadotropin-deficient (hpg) mice. Endocrinology 1995;136:5311–21. [2] Bhasin S, Fielder T, Peacock N, Sod-Mariah UA, Swerdloff RS. Dissociating antifertility effects of GnRH-antagonist from its adverse effects on mating behavior in male rats. Am J Physiol 1988;254:E84– 91. [3] Brito LF, Barth AD, Rawlings NC, Wilde RE, Crews Jr DH, Mir PS, et al. Effect of improved nutrition during calfhood on serum metabolic hormones, gonadotropins, and testosterone concentrations, and on testicular development in bulls. Domest Anim Endocrinol 2007;33: 460–9. [4] Nicoll CS. Physiological actions of prolactin. In: Knobil E, Sawyer W, editors. Handbook of physiology: endocrinology IV. Baltimore: Williams and Wilkins; 1974. p. 253–92. [5] Bole-Feysot C, Goffin V, Edery M, Binart N, Kelly PA. Prolactin and its receptor: actions, signal transduction pathways and phenotypes

[26] [27]

[28]

[29] [30]

observed in prolactin receptor knockout mice. Endocrine Rev 1998; 19:225–68. Nag S, Sanyal S, Ghosh KK, Biswas NM. Prolactin suppression and spermatogenic developments in maturing rats. A quantitative study. Horm Res 1981;15:72–7. Dombrowicz D, Sente B, Closset J, Hennen G. Dose-dependent effects of human prolactin on the immature hypophysectomized rat testis. Endocrinology 1992;130:695–700. Purvis K, Clausen OP, Olsen A, Haug E, Hansson V. Prolactin and Leydig cell responsiveness to LH/hCG in the rat. Arch Androl 1979;3: 219–30. Rubin RT, Poland RE, Tower BB. Prolactin-related testosterone secretion in normal adult men. J Clin Endocrinol Metab 1976;42: 112–6. Gunasekar PG, Kumaran B, Govindarajulu P. Prolactin and Leydig cell steroidogenic enzymes in the bonnet monkey (Macaca radiata). Int J Androl 1998;11:53–9. Papadopoulos V, Drosdowsky MA, Carreau S. In vitro effects of prolactin and dexamethasone on rat Leydig cell aromatase activity. Andrologia 1986;18:79–83. Guillaumot P, Tabone E, Benahmed M. Sertoli cells as potential targets of prolactin action in the testis. Mol Cell Endocrinol 1996; 122:199–206. Reyes A, Parra A, Chavarria ME, Goicoechea B, Rosado A. Effect of prolactin on the calcium binding and/or transport of ejaculated and epididymal human spermatozoa. Fertil Steril 1979;31:669–72. Rui H, Lebrun JJ, Kirken RA, Kelly PA, Farrar WL. Jak2 activation and cell proliferation induced by antibody-mediated prolactin receptor dimerization. Endocrinology 1994;135:1299–306. Fukuda A, Mori C, Hashimoto H, Noda Y, Mori T, Hoshino K. Effects of prolactin during preincubation of mouse spermatozoa on fertilizing capacity in vitro. J In Vitro Fert Embryo Transfer 1989;6:92–7. Albertson BD, Sienkiewicz ML, Kimball D, Munabi AK, Cassorla F, Loriaux DL. New evidence for a direct effect of prolactin on rat adrenal steroidogenesis. Endocrine Res 1987;13:317–33. Bartke A. Hyperprolactinemia and male reproduction. In: Paulsen JD, Negro-Vilar A, Lucina E, Martini L, editors. Andrology, male fertility and sterility. New York: Academic Press; 1986. p. 101–23. Tsao TS, Lodish HF, Fruebis J. ACRP30, a new hormone controlling fat and glucose metabolism. Eur J Pharmacol 2002;440:213–21. Matsuzawa Y, Funahashi T, Kihara S, Shimomura I. Adiponectin and metabolic syndrome. Arterioscler Thromb Vasc Biol 2004;24: 29–33. Rajala MW, Scherer PE. The adipocyte: at the crossroads of energy homeostasis, inflammation, and atherosclerosis. Endocrinology 2003;144:3765–73. Nilsson L, Binart N, Bohlooly YM, Bramnert M, Egecioglu E, Kindblom J, et al. Prolactin and growth hormone regulate adiponectin secretion and receptor expression in adipose tissue. Biochem Biophys Res Commun 2005;331:1120–6. Pfaehler A, Nanjappa MK, Coleman ES, Mansour M, Wanders D, Plaisance EP, et al. Regulation of adiponectin secretion by soy isoflavones has implication for endocrine function of the testis. Toxicol Lett 2012;209:78–85. van Hoek M, van Tol A, van Vark-Van der Zee LC, Jansen H, Kastelein JJP, Sijbrands EJ, et al. Role of plasma adiponectin on the HDL-cholesterol raising effect of atorvastatin in patients with type 2 diabetes. Curr Med Res Opinion 2009;25:93–101. Miller AR, Stanisiewski EP, Erdman RA, Douglass LW, Dahl GE. Effects of long daily photoperiod and bovine somatotropin on milk yield in cows. J Dairy Sci 1999;82:1716–22. Kasimanickam RK, Kasimanickam VR. Effect of tocopherol supplementation on serum 8-epi-prostaglandin F2 alpha and adiponectin concentrations, and mRNA expression of PPARg and related genes in ovine placenta and uterus. Theriogenology 2011;76:482–91. Evenson D, Jost L. Sperm chromatin structure assay for fertility assessment. Curr Protoc Cytom 2001;7:7–13. Kasimanickam R, Pelzer KD, Kasimanickam V, Swecker WS, Thatcher CD. Association of classical semen parameters, sperm DNA fragmentation index, lipid peroxidation and antioxidant enzymatic activity of semen in ram-lambs. Theriogenology 2006;15:1407–21. Kasimanickam V, Kasimanickam R, Arangasamy A, Saberivand A, Stevenson JS, Kastelic JP. Association between mRNA abundance of functional sperm function proteins and fertility of Holstein bulls. Theriogenology 2012;78:2007–19. Parrish JJ, Susko-Parrish J, Winer MA, First NL. Capacitation of bovine sperm by heparin. Biol Reprod 1988;38:1171–80. Garner DL, Johnson LA. Viability assessment of mammalian sperm using SYBR-14 and propidium iodide. Biol Reprod 1995;53:276–84.

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777 [31] Rathi R, Colenbrander B, Bevers MM, Gadella BM. Evaluation of in vitro capacitation of stallion spermatozoa. Biol Reprod 2001;62:462–70. [32] Bolin HL, Svennerholm AM. Identification of Helicobacter pylori by immunological dot blot method based on reaction of a speciesspecific monoclonal antibody with a surface-exposed protein. J Clinic Microbiol 1995;33:381–4. [33] Bäuerlein R, Sandmeier BB, Villmann C, Hammo A, Gareis M, Becker C-M, et al. Development of a dot blot assay for the rapid detection of central nervous system tissue on meat and contact surfaces. J Agric Food Chem 2008;56:44–9. [34] Bjursell M, Ahnmark A, Bohlooly YM, William-Olsson L, Rhedin M, Peng XR, et al. Opposing effects of adiponectin receptors 1 and 2 on energy metabolism. Diabetes 2007;56:583–93. [35] Kotula-Balak M, Hejmej A, Lydka M, Cierpich A, Bilinska B. Detection of aromatase, androgen, and estrogen receptors in bank vole spermatozoa. Theriogenology 2012;78:385–92. [36] Hejmej A, Kopera I, Kotula-Balak M, Lydka M, Lenartowicz M, Bilinska B. Are expression and localization of tight and adherens junction proteins in testes of adult boar affected by foetal and neonatal exposure to flutamide? Int J Androl 2012;35:340–52. [37] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001;25:402–8. [38] Caminos JE, Nogueiras R, Gaytán F, Pineda R, González CR, Barreiro ML, et al. Novel expression and direct effects of adiponectin in the rat testis. Endocrinology 2008;149:3390–402. [39] Meeker JD, Godfrey-Bailey L, Hauser R. Relationships between serum hormone levels and semen quality among men from an infertility clinic. J Androl 2007;28:397–406. [40] Gray P, Franken DR, Slabber CF, Potgieter GM. A possible relationship between prolactin and spermatogenesis in humans. Andrologia 1981;13:127–30.

777

[41] Mori C, Hashimoto H, Hoshino K, Fukuda A, Noda Y, Mori T. Influences of prolactin upon spermatogenesis and spermatozoa during in vitro fertilization in mice. J In Vitro Fert Embryo Transfer 1988;5: 61–6. [42] Harris JP. Fertilization characteristics of spermatozoa collected from bulls grazing tall fescue pastures. MS thesis, University of Kentucky, 2011. [43] Petitclerc D, Chapin LT, Tucker HA. Daily changes in concentrations of prolactin in serum of prepubertal bulls exposed to short- or longday photoperiods. Proc Soc Exp Biol Med 1989;191:37–42. [44] Tucker HA, Chapin LT, Lookingland KJ, Moore KE, Dahl GE, Evers JM. Temperature effects on serum prolactin concentrations and activity of dopaminergic neurons in the infundibulum/pituitary stalk of calves. Proc Soc Exp Biol Med 1991;197:74–6. [45] Ban N, Sasaki M, Sakai H, Ueda K, Inagaki N. Cloning of ABCA17, a novel rodent sperm-specific ABC (ATP-binding cassette) transporter that regulates intracellular lipid metabolism. Biochem J 2005; 389:577–85. [46] Kitajima K, Miura S, Yamauchi T, Uehara Y, Kiya Y, Rye KA, et al. Possibility of increasing cholesterol efflux by adiponectin and its receptors through the ATP binding cassette transporter A1 in HEK293T cells. Biochem Biophys Res Commun 2011;411:305–11.  s S,  Burkus J, Bukovská A, Fabian D, Rehák P, Koppel J. [47] Ciko Expression of adiponectin receptors and effects of adiponectin isoforms in mouse preimplantation embryos. Hum Reprod 2010; 25:2247–55. [48] Bersinger NA, Wunder DM. Adiponectin isoform distribution in serum and in follicular fluid of women undergoing treatment by ICSI. Acta Obstet Gynecol Scand 2010;89:782–8. [49] Kim ST, Marquard K, Stephens S, Louden E, Allsworth J, Moley KH. Adiponectin and adiponectin receptors in the mouse preimplantation embryo and uterus. Hum Reprod 2011;26:82–95.

777.e1

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777

Supplementary Fig. 1. Photograph of ethidium bromide stained electrophoresis gel showing amplicon of the expected size. AdipoR, adiponectin receptor; bp, base pair; BRP, bovine ribosomal protein (endogenous control); Lad, ladder; Neg, negative control; Pos, positive control (testis).

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777

777.e2

Supplementary Fig. 2. Representative immunodot blots and OD plot for adiponectin AdipoQ and its receptors 1 and 2 in frozen thawed (A) precapacitated and (B) postcapacitated sperm and endogenous control. AdipoQ, adiponectin, C1Q and collagen domain containing; BRP, bovine ribosomal protein (endogenous control); Lad, ladder; Neg, negative control; OD, optical density; Pos, positive control (testis); R, receptor.

777.e3

V.R. Kasimanickam et al. / Theriogenology 79 (2013) 766–777 Supplementary Table 2 Multivariate regression analysis for the prediction of sperm DNA fragmentation index in Holstein bulls. Predictor

Coefficient

SE

T

P

Constant Testosterone Prolactin Adiponectin

3.9517 0.5128 0.026018 0.00023

0.6882 0.2665 0.00805 0.004647

5.74 1.92 3.23 0.05

d 0.054 0.002 0.961

R2 ¼ 61.4%. Abbreviation: T, test statistics.

Supplementary Fig. 3. (A) Adiponectin, (B) adiponectin receptor 1, and (C) adiponectin receptor 2 mRNA abundance in sperm and sire conception rate in Holstein bulls.

Supplementary Table 1 Correlation of sperm DNA fragmentation index (%DFI), prolactin, adiponectin, and testosterone in Holstein bulls. Hormone

%DFI

Prolactin

Adiponectin

Testosterone Adiponectin Prolactin

0.75* 0.75* 0.57*

0 0.87** d

0.97*** d d

< 0.05. < 0.01. ***P < 0.001. *P

**P