Associations of hypoosmotic swelling test, relative sperm volume shift, aquaporin7 mRNA abundance and bull fertility estimates

Theriogenology 89 (2017) 162e168

Contents lists available at ScienceDirect

Theriogenology journal homepage: www.theriojournal.com

Associations of hypoosmotic swelling test, relative sperm volume shift, aquaporin7 mRNA abundance and bull fertility estimates R.K. Kasimanickam a, *, V.R. Kasimanickam a, b, A. Arangasamy a, c, J.P. Kastelic d a

Department of Veterinary Clinical Sciences, Washington State University, Pullman, WA, 99164, USA Center for Reproductive Biology, Washington State University, Pullman, WA, 99164, USA c National Institute of Animal Nutrition and Physiology, Bangalore, 560030, KA, India d Department of Production Animal Health, University of Calgary Veterinary Medicine, Calgary, AB, T2N 4N1, Canada b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 26 August 2016 Received in revised form 11 November 2016 Accepted 12 November 2016 Available online 16 November 2016

Mammalian sperm are exposed to a natural hypoosmotic environment during male-to-female reproductive tract transition; although this activates sperm motility in vivo, excessive swelling can harm sperm structure and function. Aquaporins (AQPs) is a family of membrane-channel proteins implicated in sperm osmoregulation. The objective was to determine associations among relative sperm volume shift, hypoosmotic swelling test (HOST), sperm aquaporin (AQP) 7 mRNA abundances, and sire conception rate (SCR; fertility estimate) in Holstein bulls at a commercial artificial insemination center. Three or four sires for each full point SCR score from
4 to þ4 were included. Each SCR estimate for study bulls (N ¼ 30) was based on > 500 services (mean ± SEM) of 725 ± 13 services/sire). Sperm from a single collection day (two ejaculates) from these commercial Holstein bulls were used. Relative mRNA expression of AQP7 in sperm was determined by polymerase chain reaction. Mean relative sperm volume shift and percentage of sperm reacted in a HOST (% HOST) were determined (400 sperm per bull) after incubating in isoosmotic (300 mOsm/kg) and hypoosmotic (100 mOsm/kg) solutions for 30 min. There was no correlation between %HOST and SCR (r ¼ 0.28 P > 0.1). However, there was a positive correlation between relative sperm volume shift and SCR (r ¼ 0.65, P < 0.05). Furthermore, AQP7 mRNA abundance was positively correlated to both relative volume shift (r ¼ 0.73; P < 0.05) and to SCR (r ¼ 0.67; P < 0.05). The mRNA expressions of AQP7 and relative sperm volume shift differed (P < 0.05) among low- (<2 SCR), average(-2 to þ2) and high- (>2) fertility sire groups. In conclusion, bulls with higher SCR had significantly greater AQP7 mRNA abundance in frozen-thawed sperm. This plausibly contributed to greater regulation of sperm volume shift, which apparently conferred protection from detrimental swelling and impaired functions. © 2016 Elsevier Inc. All rights reserved.

Keywords: Bull Sire conception rate Sperm Hypoosmotic swelling Relative sperm volume Aquaporin Fertility

1. Introduction The purpose of a clinical andrological examination of a bull is not only to assess function of testes, epididymides and the remainder of the genital tract, but also to estimate breeding potential. Semen evaluation is critical, as they have several functional and structural features which are vital for successful fertilization and embryonic development. Hence, measures of sperm function and their relationship to sperm quality and fertility are critical. Sperm membrane integrity and its semi-permeable

* Corresponding author. Department of Veterinary Clinical Sciences, 100 Grimes Way, College of Veterinary Medicine, Pullman, WA, 99163, USA. E-mail address: [email protected] (R.K. Kasimanickam). http://dx.doi.org/10.1016/j.theriogenology.2016.11.011 0093-691X/© 2016 Elsevier Inc. All rights reserved.

characteristics are prerequisites for viability [1]. In that regard, intact, functional sperm must undergo a series of complex physiological changes in the female reproductive tract to acquire competence to fertilize an oocyte [1,2]. There are several assays to assess sperm membrane integrity, based either on permeability of the plasma membrane to various dyes [rhodamine 123 (R123), carboxyfluorescein diacetate (CFDA)/propidium iodide (PI), pisum sativum agglutinin (PSA)/R123, SYBR14/PI] or on the ability of the sperm to respond to stress (hypoosmotic swelling test; HOST) [3e10]. Mammalian sperm undergo a natural osmotic decrease during male-to-female reproductive tract transition [11,12]. This hypoosmotic exposure not only activates sperm motility, but also poses potential harm to sperm structure and function when excessive

R.K. Kasimanickam et al. / Theriogenology 89 (2017) 162e168

swelling of sperm occurs. The principle of the HOST is that intact sperm swell in response to hypo-osmotic conditions; consequently, the percentage of swollen sperm within a subpopulation should reflect sperm membrane fluidity. However, in practice, HOST had variable association with fertility. One reason for inconsistent results was use of non-return rates as sire fertility estimates. In addition, there is good evidence that HOST per se is not sufficient to predict fertilizing capacity of an ejaculate [10]. However, a modified version of HOST, using volume measurements [13], determined not only the percentage of swollen sperm, but also the extent of swelling. In that regard, evaluation of sperm volume shift in various osmotic environments has several advantages, possibly can be used to determine sperm functional and fertility parameters. Aquaporins (AQPs) are integral membrane proteins from a larger family of major intrinsic proteins (MIP) that form pores in cell membranes [14,15]. They have roles in critical cellular functions, including selectively allowing passage of water molecules in and out of the cell, while concurrently preventing movement of ions and other solutes [14,15]. Some members of this family can also transport small, nonionic compounds (e.g. glycerol or urea), and are termed aquaglyceroporins. Sperm have high water permeability compared to other mammalian cells [16,17], implying that AQPs are involved in sperm volume regulation. Both aquaporin (AQP) 7 and AQP8 were identified in human sperm and could affect water transport and glycerol metabolism [18,19]. However, in contrast to somatic cell aquaporins, little is known about those in bull sperm. The objective was to determine associations among relative sperm volume shift, % HOST, sperm AQP7 mRNA abundances and sire conception rate (SCR; fertility index) in Holstein bulls. Our hypotheses were that the sperm volumetric measurement better predict fertility than HOST and that AQP7 mRNA abundance has a role in osmoregulation. 2. Materials and methods 2.1. Bulls Holstein bulls (n ¼ 30; age 2.2 ± 0.06 y) were selected for use in this study, based on a range in SCR estimates. The SCR deviation scores (deviation from average conception rate) for each bull was retrieved from USDA SCR database. Each SCR estimate was based on at least 500 services (mean ± SEM) of 725 ± 13 services/sire), and for each full point SCR score (from -4 to þ4), there were 3 or 4 bulls used. Two ejaculates were collected in succession (artificial vagina) from each bull, combined for processing in a single batch, extended, loaded in 0.5 mL French straws, frozen using milk based semen extender, and stored in liquid nitrogen. The osmolality of the semen extender was 1500 mOsm/L (A fraction (glycerol free) - 300 mOsm/ L and B fraction (14% glycerol) e 2700 mOsm/L). Semen samples (n ¼ 10 straws/sire) were chosen randomly and shipped to the laboratory for evaluation. The protocol was approved by Institutional Animal Care and Use Committee at Washington State University (ASAF #03922-001). 2.2. Hypoosmotic swelling test (HOST) The HOST was performed by incubating 50 mL of semen (2  106 sperm) with 300 mL of a 300 (isosmotic) and a 100 mOsm (hypoosmotic) solution (9 g fructose plus 4.9 g sodium citrate per liter of distilled water [20]) at 36  C for 30 min. Both solutions were filtered and osmolality was confirmed. For all experiments, solutions were pre-incubated at 36  C. After incubation, 20 mL of the solution was spread on a warm slide with a wood stick applicator. Sperm (n ¼ 200) were evaluated with bright-field microscopy (magnification

163

1000  ) in each of two smears (400 sperm in total) and percentage of sperm reacted in a HOST (%HOST) was calculated for all bulls. The number of reactive spermatozoa in hypo-osmotic solution was deducted from the number in isosmotic solution and the resultant figure was taken as the HOS-reactive spermatozoa. Sperm with swollen head and coiled tails were considered viable. 2.3. Relative sperm volume shift 2.3.1. Volumetric measurements and parameters Immediately after thawing, 50 mL (2  106 sperm) of each ejaculate was transferred to tubes placed in a water-bath at 36  C and 300 mL of test (isotonic and hypotonic) solutions were added to each sample, mixed thoroughly and incubated for 30 min at 36  C. After incubation, 20 mL of the solution was spread on a warm slide with a wood stick applicator. Sperm images were captured under bright-field microscopy (magnification 1000  , Nikon Eclipse E 400, Nikon Instruments Inc., Melville, NY, USA) from two smears and 400 sperm (200 sperm/smear) were evaluated to determine particle size (Image J 1.42q, National Institute of Health, Bethesda, MD, USA). Briefly, the sperm images were changed to 16 bit binary images and each sperm was marked to determine the particle size. 2.3.2. Determination of sperm volume shift Sperm relative volume shift used was done as described [21,22]. Briefly, the main parameters were mean volume (Vmean) of the sperm volume distribution under isoosmotic and hypoosmotic conditions. The relative volume shift (Vr) was used as a measure of volume regulation in response to hypoosmotic conditions. It was defined on the basis of the isoosmotic and hypoosmotic volumes for each recorded distribution data as normalized sperm volume: Vr ¼ Vh/Vi, where Vh was the mean value of hypoosmotic volume distribution and Vi the mean value of isoosmotic volume distribution. A sperm subpopulation was considered osmotically active if its Vr was > 1. The scale of the volume distribution data was given as effective particle size (D, mm; range 0 ± 10 mm), calculated as follows: V ¼ p6D3 2.4. Real time polymerase chain reaction 2.4.1. Total RNA extraction from sperm Semen samples from each bull (100  106 sperm) were thawed at 36  C for 40 s and then diluted in PBS (pH ¼ 7.4; Invitrogen, Green Island, NY, USA) at room temperature, and centrifuged for 10 min at 1000  g (low brake speed). Sperm pellets were re-suspended with PBS and centrifuged three times under the same conditions. Total RNA extraction from sperm was carried out by the TRIzol method [23]. Briefly, the sperm pellet was ground in 1 mL TRIzol reagent (ThermoFischer Scientific, Waltham, MA USA) using a disposable plastic homogenizer in a microcentrifuge tube. In addition, the lysate was passed through a 26-g needle several times (to ensure homogenization). Samples were incubated for 5 min to allow dissociation of nucleoprotein complexes. Phase separation was done with chloroform; thereafter, RNA from the aqueous phase was precipitated in isopropyl alcohol and washed with 75% ethanol. Precipitates were air-dried and dissolved in nuclease-free water at 60  C. The RNA concentration was measured using a NanoDrop spectrophotometer (Thermo Fisher Scientific Inc., West Palm Beach, FL, USA) and sample absorbance ratios for 260/280 wave-length were determined to confirm RNA purity (target of close to 2.00). The RNA samples were stored at -20  C prior to preparation of complementary DNA (cDNA).

164

R.K. Kasimanickam et al. / Theriogenology 89 (2017) 162e168

2.4.2. Polymerase chain reaction of selected genes of interest The mRNA was reverse-transcribed to cDNA; the resulting samples were prepared using the iScript cDNA Synthesis kit (BioRad, Hercules, CA, USA). For this, 500 hg of RNA was reversetranscribed in a 20 mL reaction with incubating conditions of 25  C for 5 min, 42  C for 30 min and 85  C for 5 min, with a yield of 25 hg/mL RNA equivalent cDNA. Samples of total RNA were treated with Dexyribonuclease I, amplification grade (Invitrogen by Life Technologies, Grand Island, NY, USA) before reverse transcription to eliminate DNA contamination. Qiagen Tag PCR master mix (Qiagen, Valencia, CA, USA), a pre-mixed solution, was used to amplify fragment of gene of interest. Final concentration of primers was 0.3 mM. Initial denaturation was set at 94  C for 3 min, followed by 30 cycles of denaturation at 94  C for 1 min, annealing at 55  C for 1 min, and extension at 72  C. A final extension step at 72  C for 10 min was included in thermo-cycling conditions. Primers (F:GTGGTCTCGACACCTACAGC and R:ACTCCGAAGCCAAAACCCAA) were designed using Primer Express Version 3.0 (Applied Biosystems Inc., Carlsbad, CA, USA). Consideration was given to a set of primers (forward and reverse) to ensure separation of at least one intron and melting temperatures and CG content were set at (or close to) optimal. The amplicon was separated on a 2% agarose gel, stained with ethidium bromide, visually assessed to ensure a single amplicon for the set of primers, and subsequently confirmed. 2.4.3. Determination of mRNA expression using real-time PCR Relative mRNA expression was assessed with SYBR green. A fast SYBR green master mix (2X; Applied Biosystems Inc.) was used to prepare the reaction mix. The final concentration of each primer was 0.3 mM, with 20 mL of three technical replicates used for each sample (1.6 mL of 25 ng/mL RNA equivalent cDNA was present in the total volume of each replicate). StepOne Plus instrument (Applied Biosystems Inc.) was used for real time PCR. The pre-cycling stage was maintained at 95  C for 20 s. Forty cycles of amplification were done, with conditions of 95  C for 3 s and 60  C for 30 s (fast ramp speed conditions for the fast mixture). A continuous dissociation step was added to detect additional amplification products. Carboxy X rhodamine (ROX) dye (Sigma-Aldrich, St. Louis, MO, USA) was used as the passive internal reference. For each sample, the baseline was automatically adjusted to obtain threshold cycles, which were then normalized to an endogenous control (bovine ribosomal protein; F: CCAGGCTTTAGGCATCACCA, R: GGCGCCTACTTTGTCTCCTGT). A standard curve was obtained using 1 in 5 dilutions for each set of primers (to verify amplification efficiency). The correlation co-efficient for the dilution curve was  0.9900.

peptide mapping near the C-terminus (SC-17619) of AQP7 of rat origin was used to tag the presence of the enzyme AQP7 (it regulates the phosphorylation state of intracellular adenine nucleotides in bovine sperm). Epitopes used to produce antibodies had substantial similarities with bovine tissues (primary antibodies used were recommended by the manufacturer as appropriate for use with bovine cells). Following overnight incubation with primary antibodies, slides were washed in PBS three times (each wash was for 5 min). Bovine sperm were then incubated with secondary antibodies labeled with FITC. Secondary antibodies were diluted 1:100 in PBS with 10% goat serum for AQP7 targeting. Affinity-purified goat anti-rabbit IgG specific antibody conjugated with FITC (65-6111, Invitrogen) was used to target bound primary antibodies of AQP7 bound to proteins in bovine sperm. Secondary antibodies were incubated for approximately 45 min and then the slides were washed (three times) in PBS. Thereafter, slides were air-dried for 2 to 3 min (to avoid over drying) and mounted with Vectashield mounting medium containing counter-stain propidium iodide (H-1300, Vector Laboratories, Burlingame, CA, USA). The four corners of the coverslip were sealed with clear nail polish to prevent movement of the coverslip. Fluorescent-labeled, immuno-stained bovine sperm were viewed with a Zeiss LSM 510 META confocal microscope (Carl Zeiss Microscopy LLC, Thornwood, NY, USA). The objective plus water lens was used and the objective magnification was 63X. All possible negative controls were included in immunostaining procedures.

2.6. Statistical analyses Data were analyzed with a statistical software program (SAS version 9.3 for Windows, SAS Institute, Cary, NC, USA). Correlation coefficients were estimated using PROC CORR to determine the association of % sperm with HOS, relative volume shift, and mRNA abundance for AQP7 with individual bull SCR-scores. The RT-PCR data were analyzed by ANOVA, using 2-DDCt values [24] to ascertain statistical significance of any differences in mRNA expressions of AQP7 among bulls with different SCR. Partial Least Square Coefficients were plotted to test model adequacy. Differences in mRNA expressions were determined for both individual scores from -4 to þ4 and for fertility groups. For fertility groups, bulls were categorized based on SCR scores as low (<-2, N ¼ 6), average (-2 to  þ2, N ¼ 20), or high fertility (>þ2, N ¼ 8). For all analyses, SCR score ‘0’ (averaging fold values for average fertility group) was

2.5. Immunolocalization of AQP7 Frozen-thawed bull sperm were washed three times with PBS (using centrifugation steps at 800  g for 15 min at room temperature). Approximately 40 mL of each sperm sample (10  106 sperm/mL) was spread onto a poly-lysine-coated microscopic slide and air dried. Then, these smears were fixed in methanol for 5 min, followed by 30 s in acetone (both were at room temperature), and washed three times in PBS. A circular area containing sperm was marked with a wax pencil and blocked in PBS with 10% goat serum for screening AQP7 localization on bull sperm. Sperm were incubated in blocking buffer (10% rabbit serum in Dulbecco's Phosphate Buffered Saline) at least for 1 h in a humid container (to block nonspecific protein binding). After washing in PBS, sperm were incubated with primary antibodies against AQP7 (sc-28625, Santa Cruz Biotechnology Inc.) overnight at room temperature. Primary antibodies (initial concentration, 200 mg/mL) were diluted 1:50 in PBS. An affinity-purified rabbit polyclonal antibody raised against a

Fig. 1. Correlation of percentage of sperm with swollen head and coiled tails in hypoosmotic swelling test (%HOST) and sire conception rate deviations. P > 0.1; Sire conception rate (SCR) deviation scores were retrieved from USDA database. Each SCR estimate was based on at least 500 services (mean ± SEM) of 725 ± 13 services/sire), and for each full point SCR score (from -4 to þ4), there were 3 or 4 bulls used.

R.K. Kasimanickam et al. / Theriogenology 89 (2017) 162e168

165

normalized as one-fold mRNA expression. Statistical significance for all analyses was P < 0.05. 3. Results There were 3, 3, 3, 4, 4, 3, 3, 3, and 4 bulls with scores of -4, -3, -2, -1, 0, 1, 2, 3, and 4, respectively. There was no correlation observed between mean %HOST and SCR scores (r ¼ 0.28; P > 0.1; Fig. 1). However, there was a significant positive correlation found between relative sperm volume shift and SCR scores (r ¼ 0.65, P < 0.05; Fig. 2). Furthermore, there was a significant correlation between mean dCT (difference in threshold cycles) values for AQP7 and SCR deviations (r ¼ -0.80; Supplementary File 1: Fig. A; P < 0.001). Mean AQP7 (0.7 to 3.97 fold) mRNA abundances were greater for positive SCR score bulls (Supplementary File 1; Fig. B). The AQP7 mRNA abundance was positively correlated to relative sperm volume shift (r ¼ 0.73; P < 0.01; Fig. 3). Mean (±SEM) %HOST, sperm relative volume shift and AQP7 mRNA abundances among bull fertility groups are shown (Table 1). Mean % HOST and sperm volume in isosmotic solution was not different among sire fertility groups (P > 0.1), whereas sperm hypoosmotic swelling, sperm volume shift and AQP7 mRNA abundances differed among sire fertility groups (P < 0.05). Sperm volume for low-fertility bulls in iso- and hypo-osmotic solution was not different, whereas sperm volume in iso- and hypo-osmotic solutions for average and high fertile bulls differed (P < 0.05; Table 1). 3.1. Localization of aquaporin 7 Aquaporin 7 protein was abundant in the plasma membrane of the acrosome, equatorial and tail regions (Fig. 4). 4. Discussion In this study, sperm relative volume shift provided quantitative assessment of sperm volumetric parameters in response to hypoosmotic conditions. Furthermore, sperm relative volume shift was correlated with fertility estimates (expressed as SCR). In the present study, high-fertility bulls had greater AQP7 mRNA abundance in frozen-thawed sperm. Functional properties and structural features of AQP isoforms have been characterized in diverse organisms, from prokaryotes to higher vertebrates [25e32]. In mammals, twelve AQPs (from AQP0 to AQP11) including four

Fig. 2. Correlation of relative sperm volume shift and sire conception rate deviations. Relative volume shift, Vr ¼ Vh/Vi, where Vh was the mean value of hypoosmotic volume distribution, and Vi the mean value of isoosmotic volume distribution. A sperm subpopulation was considered osmotically active if its Vr was > 1 (P < 0.01). Sire conception rate (SCR) deviation scores were retrieved from USDA database. Each SCR estimate was based on at least 500 services (mean ± SEM) of 725 ± 13 and for each full point SCR score (from -4 to þ4), there were 3 or 4 bulls used.

Fig. 3. Association of relative sperm volume shift and Aquaporin (AQP) 7 mRNA abundances among bulls with different sire conception rate deviations. Relative volume shift, Vr ¼ Vh/Vi, where Vh was the mean value of hypoosmotic volume distribution, and Vi the mean value of isoosmotic volume distribution. A sperm subpopulation was considered as osmotically active if its Vr was > 1 (P < 0.01); AQP 7 mRNA abundances, where sire conception rate deviation score of zero was normalized as one fold mRNA abundance, whereas mRNA expressions were normalized to endogenous control (fold change).

Table 1 Mean (±SEM) percentage of sperm with hypoosmotic swelling, sperm relative volume shift and Aquaporin (AQP) 7 mRNA abundances among bull fertility groups. End point

Sire fertility group Low

Average

High

n %HOST Vi Vh Vr AQP7 mRNA abundances

9 13.2 11.5 15.8 1.37 0.98

11 13.8 11.9 19.8 1.67 1.15

10 15.3 12.1 24.6 2.03 2.93

± ± ± ± ±

1.92a 1.91a1 2.14a 1 0.12a 0.02a

± ± ± ± ±

3.87a 2.08a1 2.45b2 0.16b 0.06b

± ± ± ± ±

5.06a 2.23a1 3.12c2 0.12c 0.23c

Bulls were categorized based on sire conception rate (SCR) deviation scores: low fertility (SCR score  3) average fertility (SCR score -2 to þ2), and high fertility (SCR score  3) groups. a-c Within a row, means without a common superscript rows differed (P < 0.05). 1e2, Different numbers between Vi and Vh differ (P < 0.05). % HOST, Percentage of sperm with hypoosmotic swelling. Vr ¼ Vh/Vi, where Vh was the mean value of hypoosmotic volume distribution, and Vi the mean value of isoosmotic volume distribution. A sperm subpopulation was considered as osmotically active if its Vr was greater than 1; AQP7 mRNA abundances, where sire conception rate deviation score of zero was normalized as one fold mRNA abundance, whereas mRNA expressions were normalized to endogenous control (fold change).

glycerol facilitators (AQP3, AQP7, AQP9, and AQP10) have been identified [18,26e32]. In the mammalian testis, fluid homeostasis is very important for several functions, including spermatogenesis, sperm maturation, and fertilization [33,34]. The AQPs 7, 8, and 9 are present in germ cells at various stages of spermatogenesis [35e39]. Involvement of AQP7 in maintenance of motility of human sperm [40], the role of AQP8 in volume regulation of murine sperm [41], and presence of AQP1 protein in canine sperm [42] have all been reported. Aquaporins are integral membrane proteins that form “pores” in cell membranes [14,15]. The water permeability coefficient of bull sperm is relatively high, approximately four times that of bovine erythrocytes [43]. Thus, the major route for passage of water through the sperm membrane must be via “pores” [43]. Upon breeding, sperm enter the relatively hypotonic female reproductive tract and quickly undergo motility activation [44e47], indicating that osmotic changes are beneficial for initial sperm motility activation. Saito et al., (2004) reported AQP7 was expressed at the tail of spermatids and sperm in the human testis [40] and that sperm motility of patients that lacked AQP7 expression in sperm was significantly lower than that of men that expressed AQP7 in sperm. Therefore, based on these reports, it was plausible that high-

166

R.K. Kasimanickam et al. / Theriogenology 89 (2017) 162e168

Fig. 4. Confocal images of bull sperm immunostained for aquaporin (AQP) 7. A rabbit polyclonal antibody produced against amino acids at the c-terminus of AQP7 and fluorescein isothiocyanate labeled goat anti-rabbit secondary antibody were used for immunostaining. Nuclei were counter-stained with propidium iodide. Bar ¼ 25 mm. A) AQP7 (green fluorescence) was localized in the regions of acrosome, equatorial ridge and tail of bull sperm; B) Negative control for primary antibody lacked green fluorescence. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

fertility bulls had greater AQP7 mRNA abundance. In this study, relative volume shift was significantly correlated to both sire conception rates and AQP7 mRNA abundance. Sperm experience considerable changes [relative volume increase (RVI) and relative volume decrease (RVD)] in their environment, most notably during maturation within the epididymis and at ejaculation [41]. In RVI, activation of Naþ-Hþ exchangers and Naþ-Kþ-2Cl
co-transporters (NKCCs) cause cellular influx of Naþ, with a subsequent volume increase by osmotic movement of water [48]. In RVD, activation of Kþ channels allows efflux of Kþ from the cell and subsequent water loss by osmosis. The RVD is regulated either through AQPs or directly through the lipid bilayer; based on biophysical data, AQP expression can increase membrane water permeability as much as ~50 fold [49,50]. To maintain cellular functionality in face of these profound osmotic changes, bull sperm exhibit volume regulatory abilities, particularly RVD in response to hypotonic challenge [49]. This Kþ efflux can be either dependent on intracellular calcium concentration [Ca2þ] [51] or be [Ca2þ] independent [52]. The RVD involves swelling-sensitive opening of Kþ and Cl-channels to allow exit of ions, so as to maintain osmotic equilibrium, whereas maintenance of cell volume under isotonic conditions requires that these channels be maintained in an inactive (closed) state [53]. Premature activation of the channels under isotonic conditions results in entry of Cl- and Na þ down concentration gradients, from which increased osmotic pressure and resultant swelling reestablishes osmotic equilibrium. Perhaps AQP7 acted as the regulator of sperm osmoadaptation and protected sperm from detrimental excessive swelling and reduced motility when exposed to a hypoosmotic environment [54]. Current results were consistent with a previous study [40], where negative AQP7 in sperm decreased motility, increased swelling and tail bending after entering the hypotonic environment of the uterus, thereby reducing a sperm's chance of reaching the oviduct and initiating fertilization. Those defects were probably due to ineffective RVD mechanisms and consequent swelling after hypotonic stress. Another study outlined a relationship between AQP7 localization and sperm characteristics; based on transmission electron microscopy, there was expression of AQP7 within the pericentriolar region of the neck, equatorial region of the acrosome, and diffuse staining along the tail [55]. In the present study, AQP7 was localized at the plasma membrane of the acrosome, equatorial and tail region. Furthermore, morphologically abnormal sperm, characterized

by malformations of the head, mid-piece, or tail, had lower intensity and diffuse staining in the cytoplasmic residual bodies, head and tail. Based on a significant correlation observed between normal sperm AQP7 labelling and sperm motility and morphology, we inferred that AQP7 also had a role in regulation of sperm and male fertility. Post-breeding hypotonic stress has a negative effect, as it induces osmotic sperm swelling, which if uncontrolled, could be detrimental to sperm function and survival. Bull sperm effectively reduced the negative impact of hypotonic swelling by means of RVD, which was proposed to involve efficient volume regulation driven by active solute transport and rapid transmembrane water movement [47]. Therefore, AQP7 might have a role in conserving sperm quality, a prerequisite for a successful fertilization and embryonic development. Thus, it is plausible that high fertility bulls (with higher AQP7 abundance) regulated sperm volume more efficiently and protected sperm populations from detrimental swelling. It should be noted that, despite a positive correlation found between relative volume shift and AQP7 mRNA abundances in this study, sperm relative volume shift for all bulls in this study ranged from 1.21 to 2.34. In the present study, the %HOST was not significantly correlated to SCR. Although, %HOST is essentially informative, it does not seem to be a better predictor of fertility than conventional parameters of sperm evaluation. However, HOST provided more expanded characteristic of viability by evaluating the potential ability of vital sperm to respond to conditions of stress. Brito et al. (2003) reported that post-thaw HOST was the only method for sperm plasma membrane evaluation with a significant relationship with in vitro fertilization rate, compared to other vital stain methods [56]. The HOST, when evaluated separately, predicted a similar proportion of the variation in fertilization rate in vitro than sperm morphology, motility and acrosome integrity. Despite some significant correlations between HOST and fertility [57,58], other investigators were unable to establish any associations between HOST results and in vitro fertilization rates in men or bulls [59,60]. It should be noted that the osmolality of the semen extender was 1500 mOsm/L (A fraction (glycerol free) - 300 mOsm/L and B fraction (14% glycerol) e 2700). T. 4.1. Conclusion In conclusion, there was a significant correlation among sperm relative volume shift, sire conception rate and AQP7 mRNA

R.K. Kasimanickam et al. / Theriogenology 89 (2017) 162e168

abundance in sperm. However, there was no significant correlation between %HOST and SCR. Bulls with higher SCR had greater AQP7 mRNA abundance in frozen-thawed sperm. The presence of greater abundance of AQP7 plausibly contributed to better regulation of sperm volume shift, which was expected to have protected sperm from detrimental swelling and impaired functions. Acknowledgments The authors thank Select Sires Inc. Palin City, OH for providing semen samples and the College of Veterinary Medicine, Washington State University for partial financial support.

[24]

[25] [26]

[27]

[28]

Appendix A. Supplementary data Supplementary data related to this article can be found at http:// dx.doi.org/10.1016/j.theriogenology.2016.11.011. References [1] Gadella BM. Sperm membrane physiology and relevance for fertilization. Anim Reprod Sci 2008;107:229e36. [2] Gadella BM, Tsai PS, Boerke A, Brewis IA. Sperm head membrane reorganisation during capacitation. Int J Dev Biol 2008;52:473e80. [3] Hossain MS, Johannisson A, Wallgren M, Nagy S, Siqueira AP, RodriguezMartinez H. Flow cytometry for the assessment of animal sperm integrity and functionality: state of the art. Asian J Androl 2011;13:406e19. [4] Mayer DT, Squiers CD, Bogart R, Oloufa MM. The technique for characterizing mammalian spermatozoa as dead or living by differential staining. J Anim Sci 1951;10:226e35. [5] Swanson EW, Bearden HJ. An eosin/nigrosin stain for differentiating live and dead spermatozoa. J Anim Sci 1951;10:981e7. [6] Hackett AJ, Macpherson JW. A method for differential staining of bovine spermatozoa after extension in sterile milk. Can Vet J 1965;6:117e20. [7] Garner DL, Pinkel D, Johnson LA, Pace MM. Assessment of spermatozoal function using dual fluorescent staining and flow cytometric analyses. Biol Reprod 1986;34:127e38. [8] Harrison RAP, Vickers SE. Use of fluorescent probes to assess membrane integrity in mammalian spermatozoa. J Reprod Fertil 1990;88:343e52. [9] Garner DL, Johnson LA. Viability assessment of mammalian sperm using SYBR14 and propidium iodide. Biol Reprod 1995;53:276e84. [10] Jeyendran RS, Van der Ven HH, Perez-Pelaez M, Crabo BG, Zaneveld LJD. Development of an assay to assess the functional integrity of the human sperm membrane and its relationship to other semen characteristics. J Reprod Fertil 1984;70:219e28. [11] Drevius LO. Water content, specific gravity and concentrations of electrolytes in bull spermatozoa. J Reprod Fertil 1978;28:15e28. [12] Cooper TG, Yeung CH. Acquisition of volume regulatory response of sperm upon maturation in the epididymis and the role of the cytoplasmic droplet. Microsc Res Tech 2003;61:28e38. [13] Petzoldt R, Engel S. The spermatozoal volume as indicative of the plasma membrane integrity (modification of the hypoosmotic swelling test). 2. Diagnostic approach. Andrologia 1994;26:315e21. [14] King LS, Agre P. Pathophysiology of the aquaporin water channels. Ann Rev Physiol 1996;58:619e48. [15] Verkman AS. Aquaporin water channels and endothelial cell function. J Anat 2002;200:617e27. [16] Noiles EE, Mazur P, Watson PF, Kleinhans FW, Critser JK. Determination of water permeability coefficient for human spermatozoa and its activation energy. Biol Reprod 1993;48:99e109. [17] Curry MR1, Millar JD, Watson PF. The presence of water channel proteins in ram and human sperm membranes. J Reprod Fertil 1995;104:297e303. [18] Ishibashi K, Kuwahara M, Gu Y, Kageyama Y, Tohsaka A, Suzuki F, et al. Cloning and functional expression of a new water channel abundantly expressed in the testis permeable to water, glycerol, and urea. J Biol Chem 1997;272:20782e6. [19] Ishibashi K, Kuwahara M, Kageyama Y, Tohsaka A, Marumo F, Sasaki S. Cloning and functional expression of a second new aquaporin abundantly expressed in testis. Biochem Biophys Res Commun 1997;237:714e8. [20] Revell SG, Mrode RA. An osmotic resistance test for bovine semen. Anim Reprod Sci 1994;36:77e86. €pfer-Petersen E. [21] Petrunkina AM, Harrison RAP, Petzoldt R, Weitze KF, To Cyclical changes in sperm volume during in vitro incubation under capacitating conditions: a novel boar sperm characteristic. J Reprod Fertil 2000;118: 283e93. €pfer-Petersen E. [22] Petrunkina AM, Petzoldt R, Waberski D, Weitze KF, To Modified hypoosmotic swelling test for boar sperm: correlation with the vital staining. Reprod Dom Anim 2000b;35:201e6. [23] Kasimanickam V, Kasimanickam R, Arangasamy A, Saberivand A, Stevenson JS,

[29]

[30]

[31]

[32]

[33] [34]

[35]

[36]

[37]

[38] [39] [40]

[41]

[42]

[43] [44]

[45] [46] [47] [48] [49]

[50] [51]

[52]

[53]

167

Kastelic JP. Association between mRNA abundance of functional sperm function proteins and fertility of Holstein bulls. Theriogenology 2012;78: 2007e19. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(-Delta delta C(T)) method. Methods 2001;25: 402e8. Hohmann S, Nielsen S, Agre P. Aquaporins. San Diego: Academic Press; 2001. Echevarria M, Windhager EE, Tate SS, Frindt G. Cloning and expression of AQP3, a water channel from the medullary collecting duct of rat kidney. Proc Natl Acad Sci U S A 1994;91:10997e1001. Ishibashi K, Sasaki S, Fushimi K, Uchida S, Kuwahara M, Saito H, et al. Molecular cloning and expression of a member of the aquaporin family with permeability to glycerol and urea in addition to water expressed at the basolateral membrane of kidney collecting duct cells. Proc Natl Acad Sci U S A 1994;91:6269e73. Ma T, Frigeri A, Hasegawa H, Verkman AS. Cloning of a water channel homolog expressed in brain meningeal cells and kidney collecting duct that functions as a stilbene-sensitive glycerol transporter. J Biol Chem 1994;269: 21845e9. Kuriyama H, Kawamoto S, Ishida N, Ohno I, Mita S, Matsuzawa Y, et al. Molecular cloning and expression of a novel human aquaporin from adipose tissue with glycerol permeability. Biochem Biophys Res Commun 1997;241: 53e8. Tsukaguchi H, Shayakul C, Berger UV, Mackenzie B, Devidas S, Guggino WB, et al. Molecular characterization of a broad selectivity neutral solute channel. J Biol Chem 1998;273:24737e43. Hatakeyama S, Yoshida Y, Tani T, Koyama Y, Nihei K, Ohshiro K, et al. Cloning of a new aquaporin (AQP-10) abundantly expressed in duodenum and jejunum. Biochem Biophys Res Commun 2001;287:814e9. Ishibashi K, Morinaga T, Kuwahara M, Sasaki S, Imai M. Cloning and identification of a new member of water channel (AQP10) as an aquaglyceroporin. Biochim Biophys Acta 2002;1576:335e40. Dibas AI, Mia AJ, Yorio T. Aquaporins (water channels): role in vasopressinactivated water transport. Proc Soc Exp Biol Med 1998;219:183e99. Huang HF, He RH, Sun CC, Zhang Y, Meng QX, Ma YY. Function of aquaporins in female and male reproductive systems. Hum Reprod Update 2006;12: 785e95. Suzuki-Toyota F, Ishibashi K, Yuasa S. Immunohistochemical localization of a water channel, aquaporin 7 (AQP7), in the rat testis. Cell Tissue Res 1999;295: 279e85. Calamita G, Mazzone A, Bizzoca A, Svelto M. Possible involvement of aquaporin-7 and -8 in rat testis development and spermatogenesis. Biochem Biophys Res Commun 2001;288:619e25. Tani T, Koyama Y, Nihei K, Hatakeyama S, Ohshiro K, Yoshida Y, et al. Immunolocalization of aquaporin-8 in rat digestive organs and testis. Arch Histol Cytol 2001;64:159e68. Matsuzaki T, Tajiki Y, Tserentsoodol N, Suzuki T, Aoki T, Hagiwara H, et al. Aquaporins: a water channel family. Anat Sci Int 2002;77:85e93. Skoblina MN. Aquaporins in gametogenesis of vertebrate animals. Ontogenez 2008;39:39e46. Saito K, Kageyama Y, Okada Y, Kawakami S, Kihara K, Ishibashi K, et al. Localization of aquaporin-7 in human testis and ejaculated sperm: possible involvement in maintenance of sperm quality. J Urol 2004;172:2073e6. Yeung CH, Callies C, Rojek A, Nielsen S, Cooper TG. Aquaporin isoforms involved in physiological volume regulation of murine spermatozoa. Biol Reprod 2009;80:350e7. Ito J, Kawabe M, Ochiai H, Suzukamo C, Harada M, Mitsugi Y, et al. Expression and immunodetection of aquaporin 1 (AQP1) in canine spermatozoa. Cryobiology 2008;57:312e4. Drevius LO. Permeability coefficients of bull spermatozoa for water and polyhydric alcohols. Exp Cell Res 1971;69:212e6. Chen Q, Peng H, Lei L, Zhang Y, Kuang H, Cao Y, et al. Aquaporin 3 is a sperm water channel essential for postcopulatory sperm osmoadaptation and migration. Cell Res 2011;21:922e33. Willoughby CE, Mazur P, Peter AT, Critser JK. Osmotic tolerance limits and properties of murine spermatozoa. Biol Reprod 1996;55:715e27. Drevius LO, Eriksson H. Osmotic swelling of mammalian spermatozoa. Exp Cell Res 1966;42:136e56. Yeung CH, Barfi eld JP, Cooper TG. Physiological volume regulation by spermatozoa. Mol Cell Endocrinol 2006;250:98e105. Hoffmann EK, Lambert IH, Pedersen SF. Physiology of cell volume regulation in vertebrates. Physiol Rev 2009;89:193e277. Yang B, Verkman AS. Water and glycerol permeabilities of aquaporins 1-5 and MIP determined quantitatively by expression of epitope-tagged constructs in Xenopus oocytes. J Biol Chem 1997;272:16140e6. van Hoek AN, Verkman AS. Functional reconstitution of the isolated erythrocyte water channel CHIP28. J Biol Chem 1992;267:18267e9. Shen MR, Chou CY, Browning JA, Wilkins RJ, Ellory JC. Human cervical cancer cells use Ca2þ signalling, protein tyrosine phosphorylation and MAP kinase in regulatory volume decrease. J Physiol 2001;537:347e62. Jorgensen NK, Christensen S, Harbak H, Brown AM, Lambert IH, Hoffmann EK, et al. On the role of calcium in the regulatory volume decrease (RVD) response in Ehrlich mouse ascites tumor cells. J Membr Biol 1997;157:281e99. €pfer-Petersen E. Signalling Petrunkina AM, Harrison RA, Tsolova M, Jebe E, To pathways involved in the control of sperm cell volume. Reproduction

168

R.K. Kasimanickam et al. / Theriogenology 89 (2017) 162e168

2007;133:61e73. [54] Chen Q, Duan EK. Aquaporins in sperm osmoadaptation: an emerging role for volume regulation. Acta Pharmacol Sin 2011;32:721e4. [55] Moretti E, Terzuoli G, Mazzi L, Iacoponi F, Collodel G. Immunolocalization of aquaporin 7 in human sperm and its relationship with semen parameters. Syst Biol Reprod Med 2012;58:129e35. [56] Brito LF, Barth AD, Bilodeau-Goeseels S, Panich PL, Kastelic JP. Comparison of methods to evaluate the plasmalemma of bovine sperm and their relationship with in vitro fertilization rate. Theriogenology 2003;60:1539e51. [57] Correa JR, Pace MM, Zavos PM. Relationships among frozen-thawed sperm characteristics assessed via routine semen analysis, sperm functional tests and

fertility of bulls in an artificial insemination program. Theriogenology 1997;48:721e31. -Casado P. A short hypo[58] Perez-Llano B, Lorenzo JL, Yenes P, Trejo A, Garcıa osmotic swelling test for the prediction of boar sperm fertility. Theriogenology 2001;56:387e98. [59] Rota A, Penzo N, Vincenti L, Mantovani R. Hypoosmotic swelling (HOS) as a screening assay for testing in vitro fertility of bovine spermatozoa. Theriogenology 2000;53:1415e20. [60] Biljan MM, Buckett WM, Taylor CT, Luckas M, Aird I, Kingsland CR, et al. Effect of abnormal hypoosmotic swelling test on fertilization rate and pregnancy outcome in in vitro fertilization cycles. Fertil Steril 1996;66:412e6.