- Email: [email protected]
Astragalus membranaceus nanoparticles markedly improve immune and anti-oxidative responses; and protection against Aeromonas veronii in Nile tilapia Oreochromis niloticus
Fish and Shellfish Immunology 97 (2020) 248–256
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Astragalus membranaceus nanoparticles markedly improve immune and antioxidative responses; and protection against Aeromonas veronii in Nile tilapia Oreochromis niloticus
T
Hiam Elabda,∗, Han-Ping Wangb, Adel Shaheena, Aya Mattera a b
Department of Aquatic Animals Diseases and Management, Faculty of Veterinary Medicine, Benha University, Moshtohor, Toukh, 13736, Egypt Ohio Center for Aquaculture Research and Development, The Ohio State University South Centers, 1864 Shyville Road, Piketon, OH, 45661, USA
ARTICLE INFO
ABSTRACT
Keywords: O. niloticus Astragalus membranaceus nanoparticles Immune response Anti-oxidative response Growth performance Digestive enzymes Gene expression A. veronii Physical stress
The effects of dietary administration of Astragalus membranaceus nanoparticles (ANP) on immune and antioxidative responses, growth performance and disease resistance of Oreochromis niloticus were evaluated in the present study. Fish were divided into three groups and received the ANP at rates of 0 (control), 1, and 2%/kg diet for four weeks. After the four-week feeding trial, three fish from each replicate were sampled for immune and anti-oxidative responses evaluation, ten fish from each group were challenged with A. veronii, and nine fish from each group were subjected to cold and hypoxia challenges. It was obvious from the results that ANP significantly enhanced lysozyme activity and nitrous oxide (NO) activities, as well as improved superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) activities. Also, aspartate aminotransferase, alanine transaminase, glucose, and cortisol measurements showed significantly lower levels in incorporated groups compared to the control. Growth performance; and amylase and lipase digestive enzymes activities also showed markedly improved results. Expression of heat shock protein 70 (HSP70) and interleukin 1, beta (IL-1β) genes were significantly upregulated throughout the entire experimental period. When challenged with A. veronii, the mortality of treated groups was significantly (P < 0.05) lower than the control. Current results proofs that dietary ANP had a synergistic effect on immune and anti-oxidative responses, growth performance and disease resistance of Oreochromis niloticus.
1. Introduction Tilapia is considered the top produced fish species (~75.54%) in Egypt [1]. Bacterial disease is one of the great challenges for tilapia culture, specially Motile Aeromonads [2]. A. veronii is incriminated to cause high mortality rates in fish [3]. In addition, tilapia culture is subjected to many critical managemental procedures that deteriorate the immune response system and leave the fish more susceptible to infection, including, but not limited to, hypoxia and cold stressful conditions [2,4–10]. Most cases are associated with oxidative stress and the production of Reactive oxygen species (ROS) [11]. Currently, attention is being paid toward naturally safe phytotherapies as promising replacements for chemical therapies and antibiotics in an effort to avoid harmful effects for humans, fish, and the aquaculture industry [1,7,8]. Nano-dietary delivery of several nutraceuticals is considered a novel method in aquaculture, as it ensures
that the targeted elements reach the blood stream more effectively and, thus, increase the bioavailability and effectiveness of nutraceuticals [12,13]. Astragalus membranaceus belongs to family Leguminosae, and is spread through temperate regions, principally in China [14]. Astragalus polysaccharides (APS) is among its active ingredients that is reported to have immunostimulating and hepatoprotective effects [7,9,14]. There is a lack of previous literature on the effect of A. membranaceus nanoparticles incorporation in O. niloticus diets. Based on the promising results that we obtained in our previous studies on traditional A. membranaceus [7,9,10], we designed the current study to evaluate the effect of A. membranaceus nanoparticles incorporation in O. niloticus diets on immune and anti-oxidative responses, growth performance, and disease resistance to cold, hypoxia, and A. veronii infection challenges.
Corresponding author. E-mail addresses: [email protected] (H. Elabd), [email protected] (H.-P. Wang), [email protected] (A. Shaheen), [email protected] (A. Matter). ∗
https://doi.org/10.1016/j.fsi.2019.12.025 Received 18 October 2019; Received in revised form 21 November 2019; Accepted 9 December 2019 Available online 17 December 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved.
Fish and Shellfish Immunology 97 (2020) 248–256
(Shi et al., 2015)
(Castro et al., 2011)
60 °C 1 min.
Fish (Initial weight 26 ± 0.5 g) were obtained from a commercial farm (Kafr El Sheikh Governorate, Egypt). Fish were acclimatized to the experimental conditions for one week, and then randomly distributed into three groups into fiberglass tanks (750 L) in triplicates for the growth trial (30 fish/tank). Fish were fed to satiation two times daily for four weeks. Throughout the experiment, water temperature ranged from 26.1 to 26.6 °C and dissolved oxygen content was ~6.6 mg/L. At the end of the 30-day feeding trial, nine fish from each group (3 fish/replicate) were randomly moved to 50 L tanks for performing hypoxia and cold stressors as follows;
60 °C 30 s.
94 °C 1 min. 62 °C 30 s.
72 °C 30 s.
62 °C 1 min.
94 °C 1 min.
A commercial tilapia basal diet KOUDIJS® Tilapia fish feed 30% sinking, Kapo feed, Borg El Arab, Alexandria, Egypt (crude protein 30%, crude fat 5.30%, crude fiber 5.80%, Calcium Minimum 1.9%, Phosphorous (P) Minimum 1.1%, Sodium (NA) Minimum 0.2% and Ash Maximum 10.0%) was used for the control group, and two experimental groups were fed the basal diet supplemented with 1% and 2% ANP/kg, respectively. A. membranaceus was supplied by Oregon's Wild Harvest (Sandy, Oregon, USA) in powder form and prepared in nanoform by ball mill method (stainless steel vial, mounted on a vibrating plate, and the stainless steel balls collide repeatedly with the plate and the powder inside the drum for 36 h) by a series of variable size mill balls (1, 0.5, and 0.25). The ratio of mill balls' weight to A. membranaceus particles weight was control constant 10:1, and mill balls' volume to dill seed particles volume was also control constant 5:1 g, and charge of A. membranaceus was loaded into the ball milling drum of ball mills. Doses of APS were selected based on our previous work on traditional A. membranaceus [7,9,10]. All ingredients were finely ground, mixed and pelleted, then air-dried and stored at 4 °C.
In hypoxia trial: Fish were moved to 50 L tanks after aeration had been stopped, and the water column was decreased and left monitored until signs of hypoxia appeared as mentioned by Refs. [7,8]. In cold stress trial: Fish were moved (from ambient temperature of 26.1–26.6 °C) to the 50 L tanks containing water supplied with aeration and pre-cooled to 12 °C for 30 min. The entire experiment was performed according to the guidelines of Faculty of veterinary medicine, Benha university for laboratory procedures and animal care instructions. 2.3. Sample collection Fish were anesthetized using MS-222 (Sigma, USA). Blood was then collected by caudal venipuncture using a 1 ml syringe. The blood samples were collected into heparinized tubes to obtain plasma (n = 9, 3 fish/replicate) in harmony with procedures previously described in our studies [7,9,10]. After blood sampling, liver samples were collected from the same fish and placed in RNAlater (Ambion, USA) and stored at −20 °C until used, according to Refs. [7,9,10]. 2.4. Immune-related parameters Nitric oxide (NO) was determined following the method described by Ref. [15] and lysozyme activity was performed using Lysozyme Detection kits (Sigma-Aldrich, USA) at 450 nm according to the protocol previously mentioned in our studies [7,9,10].
Hsp70
IL1B
50 °C 30 min. EF-1α
CCTTCAACGCTCAGGTCATC TGTGGGCAGTGTGGCAATC GCTGGAGAGTGCTGTGGAAGAACATATAG CCTGGAGCATCATGGCGTG CTCCTGTGTGGGGGTTTTCC TTTGGGCTTCCCTCCGTCTG
94 °C 15 min.
94 °C 15 s.
2nd denaturation Annealing 2nd denaturation
Extension
Annealing
2.1. Experimental diets and ANP preparation
2.2. Fish and experimental design
Reverse transcription
Primary denaturation
2. Materials and methods
Primers sequences Gene of interest
Table 1 Targeted gene primers sequences used in the analysis of gene expression in Nile tilapia O. niloticus.
Amplification (40 cycles)
Dissociation curve (1 cycle)
Final denaturation
Reference
(Gröner et al., 2015)
H. Elabd, et al.
249
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
Fig. 1. Nitric oxide (A) and lysozyme (B) activities in Nile tilapia (O. niloticus) supplied with 1 and 2% ANP at the end of feeding trial, and at post-exposure to cold and hypoxia challenges. Results are described as mean ± SEM (n = 9). Values with asterisk (*) are significantly different at (P < 0.05).
2.5. Liver antioxidant enzymes
Wf is the final weight of fish, and Wi is the weight of fish at stocking. Plasma amylase and lipase digestive enzymes activities were estimated according company protocols (Cusabio Biotech Co. Ltd., China) according to Ref. [22].
Liver samples kept in phosphate-buffered saline (PBS), pH 7.4 were assayed for measuring SOD, CAT, and GPx activities following procedures previously described by Refs. [16,17]; and [18].
2.8. Expression of heat shock protein 70 (HSP70) and interleukin 1, beta (IL-1β) genes
2.6. Biochemical assays Liver AST and ALT activities; and plasma glucose and cortisol concentrations were assayed according to protocols and equations described by Refs. [19,20]; and [21].
At the end of the feeding trial and after exposure to both cold and hypoxia stressors, total RNA was extracted from liver samples (n = 9 per group) usingTRIzol according to the manufacturer's protocol (Invitrogen, USA). Complementary DNA was synthesized from extracted total RNA using a High-Capacity cDNA Reverse Transcription Kit (Invitrogen, USA), following [7,9,10]. SYBR Green master mix (Invitrogen, USA) was used for performing the real-time PCR analysis. Primers for HSP70 and IL-1β genes are listed in Table 1. To determine the change in gene expression of tested samples, the Ct of each sample was matched with that of the control group using the “ΔΔCt” method described by Refs. [7,9,10].
2.7. Growth performance and digestive enzymes At the start and end of the feeding trial, fish were counted and average bodyweights were estimated. Specific growth rate (SGR), body mass gain (BMG), length gain rate (LGR), and feed conversion ratio (FCR) were calculated using the following equations: Specific growth rate (SGR) (% day−1) = [(ln final body mass in g) - ln initial body mass in g)/number of trial days] X 100, BMG (%) = 100 × [final body mass (g) - initial body mass (g)]/initial body mass (g)], length gain rate (%) = 100 × [average terminal body length (cm) – average initial body length(cm)]/average initial body length (cm), feed conversion ratio (FCR) = F/(Wf _ Wi); where F is the weight of feed offered to fish,
2.9. Bacterial challenge The Aeromonas veronii was isolated from diseased O. niloticus, with mortalities reaching 80%. A. veronii was produced overnight in brain
250
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
heart infusion broth (BHB at 28 °C for 18 h), and then washed with PBS in order to adjust the density to 9 × 108 cells/ml. At the end of the feeding trial, fish (30 ± 5 g body weight; 15 fish/group) were injected intraperitoneally with 0.2 ml bacterial suspension (9 × 108 cells/ml in PBS). Dead O. niloticus were removed and mortality was recorded daily for 15 days. Clinical signs and post mortem findings in dead and moribund fish were recorded.
3. Results 3.1. Immune-related parameters ANP incorporation significantly decreased NO levels at pre and post exposure to cold and hypoxia stressors compared to the control, and effectively decreased the increased levels caused by both stressors, with the highest decrease in the 1% ANP group (Fig. 1A). ANP dietary supplementation successfully increased lysozyme activity all over the experiment, especially after being dramatically decreased with exposure to cold and hypoxia stressful conditions. The 1% ANP group gave the maximum increase in lysozyme activity at pre and post exposure to cold stress and the 2% ANP group revealed the maximum increase after exposure to hypoxia, compared to the control (Fig. 1B).
2.10. Statistical analysis Results were statistically analyzed using one-way analysis of variance (ANOVA) and data was presented as Means ± Standard Error (M ± SE), and Duncan's multiple range tests were used to estimate significant differences between groups using the Statistical Package for the Social Sciences (SPSS) software (version 22.0). Values are expressed as means ± standard error and a value of P < 0.05 was considered significant.
Fig. 2. Effect of 1 and 2% ANP incorporation on antioxidants SOD (A), GPx (B), and CAT (C) activities in the liver of Nile tilapia (O. niloticus) at end of 30 days feeding trial and at post-exposure to cold and hypoxia challenges. Results are described as mean ± SEM (n = 9). Values with asterisk (*) are significantly different at (P < 0.05).
251
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
Fig. 3. Liver AST (A) and ALT (B); and plasma glucose (C) and cortisol (D) in Nile tilapia (O. niloticus) fed with 1 and 2% ANP at pre- and post-exposure to cold and hypoxia challenges. Results are described as mean ± SEM (n = 9). Values with asterisk (*) are significantly different at (P < 0.05).
3.2. Antioxidant enzymes
Table 2 Effect of dietary incorporation of O. niloticus with 0, 1, and 2% ANP on SGR, BMG, LGR, and FCR growth performance for 30 days feeding trial.
Although ANP incorporation did not show significant differences in SOD activity throughout the experimental period (Fig. 2A), it effectively decreased the GPx activity that was increased in response to both hypoxia and cold, with the highest decrease for the 1% ANP group after exposure to cold, and for the 2% ANP group after exposure to hypoxia (Fig. 2B). In addition, CAT activity was markedly elevated with subjection to cold and ANP ameliorated this effect through decreasing this level, and the 1% ANP group showed the maximum decrease in CAT activity over the control (Fig. 2C).
ANP %/kg feed
SGR (%)
BMG (%)
LGR (%)
FCR
0 1 2
0.14 ± 0.05 0.7 ± 0.02 0.51 ± 0.05*
10 ± 0.7 66.3 ± 0.5 42 ± 0.5*
14.3 ± 0.7 41.1 ± 0.7* 24.4 ± 0.5
19.4 ± 0.5 2.6 ± 0.1* 4.2 ± 0.3*
Values are mean (n = 30) ± SEM. Mean values with asterisk (*) are different significantly (P < 0.05). SGR: Specific growth rate, BMG: Body Mass Gain, LGR: Length Gain Rate, and FCR: Feed Conversion Ratio.
3.3. Biochemical assays
for the 1% ANP group at the end of feeding trial and after exposure to cold, and for the 2% ANP group, after exposure to hypoxia (Fig. 4A). Lipase activity was markedly higher in ANP groups after exposure to cold and hypoxia, with the highest value for the 1% ANP group after exposure to cold, and for the 2% group after exposure to hypoxia, compared to control (Fig. 4B).
However, ANP did not show decreases in neither AST nor ALT activities during the experiment (Fig. 3A and B), it noticeably decreased glucose concentration at pre and post exposure to cold, with the most significant decrease for the 1% ANP group (Fig. 3C). Also, ANP groups gave a significant decrease in cortisol concentration during the entire experiment, with best results for the 2% ANP group compared to the control (Fig. 3D).
3.5. Expression of heat shock protein 70 (HSP70) and interleukin 1, beta (IL-1β) genes
3.4. Growth performance and digestive enzymes
ANP groups showed significant upregulation of HSP70 and IL-1β genes along the experiment, with the highest upregulation for the 2% group at pre and post exposure to cold and hypoxia challenges, compared to the control (Fig. 5A and B).
ANP incorporation significantly increased the growth performance parameters (Table 2). The most marked increase in SGR% and BMG% was for the 2% ANP group, and in LGR%, the most marked increase was in the 1% ANP group. The most significant decrease in FCR was for both ANP groups when compared to control after the 30 day-feeding trial (Table 2). Amylase activity was higher in the ANP groups compared to the control along the experiment, even after exposure to cold and hypoxia challenges that decreased the enzyme activity, with the highest increase
3.6. Bacterial challenge After 30 days of the feeding trial, O. niloticus challenged with A. veronii showed loss of appetite, skin darkness, ascitis, and external hemorrhage. All internal organs, especially kidney, liver, and spleen
252
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
Fig. 4. Digestive enzyme (lipase and amylase) activities in plasma in Nile tilapia (O. niloticus) fed with 1 and 2% ANP-incorporated diets at the end of feeding trial and at post-exposure to cold and hypoxia challenges. Results are described as mean ± SEM (n = 9). Values with asterisk (*) are significantly different at (P < 0.05).
revealed congestion. The mortality percentage was significantly higher in the control group (60%) than in ANP groups (13.33% in the 1% ANP group and 6.66% in the 2% ANP group). (Fig. 6).
attributed to A. membranaceus active components such as APS (glucan and heteropolysaccharide) that could stimulate immune response [27–29]. Antioxidants SOD, Gpx, and CAT play a significant role in reducing oxidative stress and removing the reactive oxygen species [30,31]. Present results showed that the 1% ANP group gave the most significant decrease in both GPx and CAT activities, mainly after exposure to cold challenge. Our results come in accordance with other results recorded by Refs. [7,9,26]; and [29]. This effect can be because of the antioxidant and hepatoprotective effects of APS [8,14,29] However, it did not show significant effect on SOD activity. Similarly [32], found that SOD activity of turbot Scophthalmus maximus was not significantly affected with different concentrations of soybean meal after the feeding trial. Biochemical indexes are critical procedures in the diagnosis and assessment of fish status and condition [29,33]. Present work shows a marked decrease in glucose and cortisol concentrations for ANP-incorporated groups, especially after subjection to cold stress, which can be as a result of the anti-oxidative and hepatoprotective activities of APS [8,14,29]. Current findings are supported by those of [29]; who reported the effective role of APS on biochemical indices of yellow catfish Pelteobagrus fulvidraco, and [7] reported the same effect on
4. Discussion Present study targets the evaluation of incorporating Astragalus membranaceus nanoparticles in Nile tilapia diets, depending on the promising results we obtained from traditional Astragalus membranaceus [7,9,10]. ANP effectively improved overall status and performance of O. niloticus. Evaluation of immune response parameters are necessary for evaluation of fish health status [23]. Lysozyme and NO activities are well-known to play great roles in immune response and defense mechanisms [24,25]. Results of the current study showed that both nitrous oxide and lysozyme activities were significantly enhanced with ANP incorporation, with best result mostly for group receiving 2% ANP compared to the control group. Similarly [26], reported that Astragalus polysaccharides (APS) significantly increased immune parameters, particularly lysozyme activity (P < 0.05), of largemouth bass Micropterus salmoides compared with the control. Additionally, in our previous results [7,9,10], we also reported an immunostimulating activity of A. membranaceus in yellow perch over the control. This can be
253
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
Fig. 5. HSP70 (A) and IL-1β (B) genes expression in Nile tilapia (O. niloticus) incorporated with 1 and 2% ANP at end of feeding trial and at post-exposure to cold and hypoxia challenges. Results are described as mean ± SEM (n = 9). Values with asterisk (*) are significantly different at (P < 0.05).
yellow perch and on blue gill sun fish (2016b). Supplementation with A. membranaceus nanoparticles was effective in improving growth performance; that was clear with improved SGR, BMG, LGR, and FCR in ANP-supplemented groups, with the best results mostly for the 2% ANP group over the control. The positive effect can be a result of A. membranaceus active ingredients that promote growth and digestion [9,10,26]. In the current study, we got positive results with a smaller amount of ANP than we previously obtained with the traditional from Refs. [9,10]; this can be because nanoform can maximize the A. membranaceus efficiency. The digestion process was also improved with ANP incorporation, which was manifested by increased amylase and lipase activities in ANP groups over the control throughout the experiment, even after exposure to cold and hypoxia challenges that decreased enzyme activity. Those activities can be attributed to the ability of A. membranaceus and APS to enhance growth, promote
utilization of feed efficiently and, thus, improve digestion [9,10,26]. Accordingly [9,10,26], reported the same positive results in yellow catfish, yellow perch, and bluegill sunfish, respectively. IL-1β is one of the cytokines involved in the induction of immune response [34,35], and heat shock proteins (HSPs) are known as stress proteins [36], among which HSP70 is the member most responsible for stress reactions [37]. Here in our current study, the expression study of both genes revealed significantly high upregulation for ANP groups over the control throughout the entire experimental period. In the same instance, expressions of IL-1β were improved with APS application in P. fulvidraco [29], expression of HSP70 in yellow perch was also upregulated with A. membranaceus incorporation, and upregulation continued after exposure to different physical stressors including cold and hypoxia [7,8]. The upregulation is supposed to be due to the active components of A. membranaceus, as APS that are well known to stimulate immune
254
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
Fig. 6. Cumulative mortality rate of Nile tilapia (O. niloticus) fed with 1 and 2% ANP diets after feeding trial of 30 days and challenged with A. veronii infection for 15 days.
response and perform an anti-oxidative role [8,14,27,29], plus its presence in the nanoform maximizes its positive effects [12,13]. APS improvement to immunity can consequently result in improved resistance to pathogenic bacteria infection [38,39]. The present study recorded that ANP markedly reduced the cumulative mortality of O. niloticus against A. veronii, mostly through enhancing immune parameters such as lysozyme and NO; revealing an increased resistance to A. veronii in ANP-supplemented groups. This comes in agreement with [26]; who reported an increased resistance of M. salmoides to A. hydrophila in APS groups. In conclusion, dietary ANP markedly enhanced disease and stress resistance of Oreochromis niloticus through improving immune and antioxidative responses. No previous literature described the effect of ANP on fish, and further studies are required to cover more immune pathways.
[8] H. Elabd, H.-P. Wang, A. Shaheen, H. Yao, A. Abbass, Anti-oxidative effects of some dietary supplements on Yellow perch (Perca flavescens) exposed to different physical stressors, Aquacult. Rep. 8 (2017) 21–30, https://doi.org/10.1016/j.aqrep. 2017.09.002. [9] H. Elabd, H.-P. Wang, A. Shaheen, H. Yao, A. Abbass, Feeding Glycyrrhiza glabra (liquorice) and Astragalus membranaceus (AM) alters innate immune and physiological responses in yellow perch (Perca flavescens), Fish Shellfish Immunol. 54 (2016) 374–384, https://doi.org/10.1016/j.fsi.2016.04.024. [10] H. Elabd, H.-P. Wang, A. Shaheen, H. Yao, A. Abbass, Astragalus membranaceus (AM) enhances growth performance and antioxidant stress profiles in bluegill sunfish (Lepomis macrochirus), Fish Physiol. Biochem. 42 (2016) 955–966, https:// doi.org/10.1007/s10695-015-0188-9. [11] H.T. Dong, C. Techatanakitarnan, P. Jindakittikul, A. Thaiprayoon, S. Taengphu, W. Charoensapsri, P. Khunrae, T. Rattanarojpong, S. Senapin, Aeromonas jandaei and Aeromonas veronii caused disease and mortality in Nile tilapia, Oreochromis niloticus (L.), J. Fish Dis. 40 (2017) 1395–1403, https://doi.org/10.1111/jfd. 12617. [12] E.K. Hill, J. Li, Current and future prospects for nanotechnology in animal production, J. Anim. Sci. Biotechnol. 8 (26) (2017), https://doi.org/10.1186/s40104017-0157-5. [13] M. Nair, R.D. Jayant, A. Kaushik, V. Sagar, Getting into the brain: potential of nanotechnology in the management of NeuroAIDS, Adv. Drug Deliv. Rev. 103 (2016) 202–217, https://doi.org/10.1016/j.addr.2016.02.008. [14] R. Li, W. Chen, W. Wang, W. Tian, X. Zhang, Antioxidant activity of Astragalus polysaccharides and antitumour activity of the polysaccharides and siRNA, Carbohydr. Polym. 82 (2010) 240–244, https://doi.org/10.1016/j.carbpol.2010. 02.048. [15] K.M. Miranda, M.G. Espey, D.A. Wink, A rapid, simple spectrophotometric method for simultaneous detection of nitrate and nitrite, Nitric Oxide Biol. Chem. 5 (2001) 62–71, https://doi.org/10.1006/niox.2000.0319. [16] H. Aebi, [13] Catalase in vitro, Methods in Enzymology, Oxygen Radicals in Biological Systems, Academic Press, 1984, pp. 121–126, , https://doi.org/10.1016/ S0076-6879(84)05016–3. [17] J.M. McCord, I. Fridovich, Superoxide dismutase an enzymic function for erythrocuprein (Hemocuprein), J. Biol. Chem. 244 (1969) 6049–6055. [18] D.E. Paglia, W.N. Valentine, Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase, J. Lab. Clin. Med. 70 (1967) 158–169, https://doi.org/10.5555/uri:pii:0022214367900765. [19] X.-J. Huang, Y.-K. Choi, H.-S. Im, O. Yarimaga, E. Yoon, H.-S. Kim, Aspartate aminotransferase (AST/GOT) and alanine aminotransferase (ALT/GPT) detection techniques, Sensors 6 (2006) 756–782. [20] Z. Liu, S. Que, J. Xu, T. Peng, Alanine aminotransferase-old biomarker and new concept: a review, Int. J. Med. Sci. 11 (2014) 925–935, https://doi.org/10.7150/ ijms.8951. [21] P. Trinder, Determination of blood glucose using an oxidase-peroxidase system with a non-carcinogenic chromogen, J. Clin. Pathol. 22 (1969) 158–161. [22] N.W. Ross, K.J. Firth, A. Wang, J.F. Burka, S.C. Johnson, Changes in hydrolytic enzyme activities of naïve Atlantic salmon Salmo salar skin mucus due to infection with the salmon louse Lepeophtheirus salmonis and cortisol implantation, Dis. Aquat. Org. 41 (2000) 43–51, https://doi.org/10.3354/dao041043. [23] M.M.A. Mahmoud, M.M.M. El-Lamie, O.E. Kilany, A.A. Dessouki, Spirulina (Arthrospira platensis) supplementation improves growth performance, feed
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.fsi.2019.12.025. References [1] A.A. Shaheen, An Industry Assessment of tilapia Farming in Egypt. African Union – Inter-african Bureau for Animal Resources (AU-IBAR), (2013). [2] S.M. Aly, M.A.A. Zohairy, A.H. Rahmani, M. Fathi, N.M.A. Atti, Trials to improve the response of Orechromis niloticus to Aeromonas hydrophila vaccine using immunostimulants (garlic, Echinacea) and probiotics (Organic Green TM and VetYeast TM), Afr. J. Biotechnol. 15 (2016) 989–994–994. [3] N.F. Soliman, D.M.M. Yacout, Aquaculture in Egypt: status, constraints and potentials, Aquacult. Int. 24 (2016) 1201–1227, https://doi.org/10.1007/s10499016-9989-9. [4] T.J. Bowden, Modulation of the immune system of fish by their environment, Fish Shellfish Immunol. 25 (2008) 373–383, https://doi.org/10.1016/j.fsi.2008.03.017. [5] N. Eissa, H.-P. Wang, H. Yao, Z.-G. Shen, A.A. Shaheen, E.N. Abou-ElGheit, Expression of Hsp70, Igf1, and three oxidative stress biomarkers in response to handling and salt treatment at different water temperatures in yellow perch, Perca flavescens, Front. Physiol. 8 (2017), https://doi.org/10.3389/fphys.2017.00683. [6] N. Eissa, H.-P. Wang, Transcriptional stress responses to environmental and husbandry stressors in aquaculture species, Rev. Aquac. 8 (2016) 61–88, https://doi. org/10.1111/raq.12081. [7] H. Elabd, H.-P. Wang, A. Shaheen, H. Yao, A. Abbass, Anti-oxidative effects of some dietary supplements on Yellow perch (Perca flavescens) exposed to different physical stressors, Aquacult. Rep. 8 (2017) 21–30, https://doi.org/10.1016/j.aqrep. 2017.09.002.
255
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
[24]
[25] [26]
[27] [28]
[29]
[30]
[31]
utilization, immune response, and relieves oxidative stress in Nile tilapia (Oreochromis niloticus) challenged with Pseudomonas fluorescens, Fish Shellfish Immunol. 72 (2018) 291–300, https://doi.org/10.1016/j.fsi.2017.11.006. R. Chakrabarti, P.K. Srivastava, N. Verma, J. Sharma, Effect of seeds of Achyranthes aspera on the immune responses and expression of some immune-related genes in carp Catla catla, Fish Shellfish Immunol. 41 (2014) 64–69, https://doi.org/10. 1016/j.fsi.2014.03.007. B. Magnadóttir, Innate immunity of fish (overview), Fish Shellfish Immunol., Rev.Fish Immunol. 20 (2006) 137–151, https://doi.org/10.1016/j.fsi.2004.09.006. S.-M. Lin, Y. Jiang, Y.-J. Chen, L. Luo, S. Doolgindachbaporn, B. Yuangsoi, Effects of Astragalus polysaccharides (APS) and chitooligosaccharides (COS) on growth, immune response and disease resistance of juvenile largemouth bass, Micropterus salmoides, Fish Shellfish Immunol. 70 (2017) 40–47, https://doi.org/10.1016/j.fsi. 2017.08.035. J. Galina, G. Yin, L. Ardó, Z. Jeney, The use of immunostimulating herbs in fish. An overview of research, Fish Physiol. Biochem. 35 (2009) 669–676, https://doi.org/ 10.1007/s10695-009-9304-z. V. Vetvicka, B. Dvorak, J. Vetvickova, J. Richter, J. Krizan, P. Sima, J.-C. Yvin, Orally administered marine (1– > 3)-beta-D-glucan Phycarine stimulates both humoral and cellular immunity, Int. J. Biol. Macromol. 40 (2007) 291–298, https:// doi.org/10.1016/j.ijbiomac.2006.08.009. W. Zhu, Y. Zhang, J. Zhang, G. Yuan, X. Liu, T. Ai, J. Su, Astragalus polysaccharides, chitosan and poly(I: C) obviously enhance inactivated Edwardsiella ictaluri vaccine potency in yellow catfish Pelteobagrus fulvidraco, Fish Shellfish Immunol. 87 (2019) 379–385, https://doi.org/10.1016/j.fsi.2019.01.033. S.-T. Chiu, R.-T. Tsai, J.-P. Hsu, C.-H. Liu, W. Cheng, Dietary sodium alginate administration to enhance the non-specific immune responses, and disease resistance of the juvenile grouper Epinephelus fuscoguttatus, Aquaculture 277 (2008) 66–72, https://doi.org/10.1016/j.aquaculture.2008.01.032. D. Madeira, L. Narciso, H.N. Cabral, C. Vinagre, M.S. Diniz, Influence of temperature in thermal and oxidative stress responses in estuarine fish, Comp. Biochem.
[32]
[33]
[34] [35] [36]
[37] [38] [39]
256
Physiol. A Mol. Integr. Physiol. 166 (2013) 237–243, https://doi.org/10.1016/j. cbpa.2013.06.008. M. Peng, W. Xu, Q. Ai, K. Mai, Z. Liufu, K. Zhang, Effects of nucleotide supplementation on growth, immune responses and intestinal morphology in juvenile turbot fed diets with graded levels of soybean meal (Scophthalmus maximus L.), Aquaculture 392–395 (2013) 51–58, https://doi.org/10.1016/j.aquaculture.2013. 02.002. A.G.M. Osman, M. Koutb, A.E.-D.H. Sayed, Use of hematological parameters to assess the efficiency of quince (Cydonia oblonga Miller) leaf extract in alleviation of the effect of ultraviolet–A radiation on African catfish Clarias gariepinus (Burchell, 1822), J. Photochem. Photobiol., B 99 (2010) 1–8, https://doi.org/10.1016/j. jphotobiol.2010.01.002. S. Reyes-Cerpa, K. Maisey, F. Reyes-López, D. Toro-Ascuy, A.M. Sandino, M. Imarai, Fish cytokines and immune response, New Adv. Contrib. Fish Biol. (2012), https:// doi.org/10.5772/53504. T. Wang, W. Huang, M.M. Costa, C.J. Secombes, The gamma-chain cytokine/receptor system in fish: more ligands and receptors, Fish Shellfish Immunol. 31 (2011) 673–687, https://doi.org/10.1016/j.fsi.2011.05.016. R.J. Roberts, C. Agius, C. Saliba, P. Bossier, Y.Y. Sung, Heat shock proteins (chaperones) in fish and shellfish and their potential role in relation to fish health: a review, J. Fish Dis. 33 (2010) 789–801, https://doi.org/10.1111/j.1365-2761. 2010.01183.x. B.M. Sanders, Stress proteins in aquatic organisms: an environmental perspective, Crit. Rev. Toxicol. 23 (1993) 49–75, https://doi.org/10.3109/ 10408449309104074. S.K. Song, B.R. Beck, D. Kim, J. Park, J. Kim, H.D. Kim, E. Ringø, Prebiotics as immunostimulants in aquaculture: a review, Fish Shellfish Immunol. 40 (2014) 40–48, https://doi.org/10.1016/j.fsi.2014.06.016. N. Van Hai, The use of medicinal plants as immunostimulants in aquaculture: a review, Aquaculture 446 (2015) 88–96, https://doi.org/10.1016/j.aquaculture. 2015.03.014.
Contents lists available at ScienceDirect
Fish and Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi
Full length article
Astragalus membranaceus nanoparticles markedly improve immune and antioxidative responses; and protection against Aeromonas veronii in Nile tilapia Oreochromis niloticus
T
Hiam Elabda,∗, Han-Ping Wangb, Adel Shaheena, Aya Mattera a b
Department of Aquatic Animals Diseases and Management, Faculty of Veterinary Medicine, Benha University, Moshtohor, Toukh, 13736, Egypt Ohio Center for Aquaculture Research and Development, The Ohio State University South Centers, 1864 Shyville Road, Piketon, OH, 45661, USA
ARTICLE INFO
ABSTRACT
Keywords: O. niloticus Astragalus membranaceus nanoparticles Immune response Anti-oxidative response Growth performance Digestive enzymes Gene expression A. veronii Physical stress
The effects of dietary administration of Astragalus membranaceus nanoparticles (ANP) on immune and antioxidative responses, growth performance and disease resistance of Oreochromis niloticus were evaluated in the present study. Fish were divided into three groups and received the ANP at rates of 0 (control), 1, and 2%/kg diet for four weeks. After the four-week feeding trial, three fish from each replicate were sampled for immune and anti-oxidative responses evaluation, ten fish from each group were challenged with A. veronii, and nine fish from each group were subjected to cold and hypoxia challenges. It was obvious from the results that ANP significantly enhanced lysozyme activity and nitrous oxide (NO) activities, as well as improved superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GPx) activities. Also, aspartate aminotransferase, alanine transaminase, glucose, and cortisol measurements showed significantly lower levels in incorporated groups compared to the control. Growth performance; and amylase and lipase digestive enzymes activities also showed markedly improved results. Expression of heat shock protein 70 (HSP70) and interleukin 1, beta (IL-1β) genes were significantly upregulated throughout the entire experimental period. When challenged with A. veronii, the mortality of treated groups was significantly (P < 0.05) lower than the control. Current results proofs that dietary ANP had a synergistic effect on immune and anti-oxidative responses, growth performance and disease resistance of Oreochromis niloticus.
1. Introduction Tilapia is considered the top produced fish species (~75.54%) in Egypt [1]. Bacterial disease is one of the great challenges for tilapia culture, specially Motile Aeromonads [2]. A. veronii is incriminated to cause high mortality rates in fish [3]. In addition, tilapia culture is subjected to many critical managemental procedures that deteriorate the immune response system and leave the fish more susceptible to infection, including, but not limited to, hypoxia and cold stressful conditions [2,4–10]. Most cases are associated with oxidative stress and the production of Reactive oxygen species (ROS) [11]. Currently, attention is being paid toward naturally safe phytotherapies as promising replacements for chemical therapies and antibiotics in an effort to avoid harmful effects for humans, fish, and the aquaculture industry [1,7,8]. Nano-dietary delivery of several nutraceuticals is considered a novel method in aquaculture, as it ensures
that the targeted elements reach the blood stream more effectively and, thus, increase the bioavailability and effectiveness of nutraceuticals [12,13]. Astragalus membranaceus belongs to family Leguminosae, and is spread through temperate regions, principally in China [14]. Astragalus polysaccharides (APS) is among its active ingredients that is reported to have immunostimulating and hepatoprotective effects [7,9,14]. There is a lack of previous literature on the effect of A. membranaceus nanoparticles incorporation in O. niloticus diets. Based on the promising results that we obtained in our previous studies on traditional A. membranaceus [7,9,10], we designed the current study to evaluate the effect of A. membranaceus nanoparticles incorporation in O. niloticus diets on immune and anti-oxidative responses, growth performance, and disease resistance to cold, hypoxia, and A. veronii infection challenges.
Corresponding author. E-mail addresses: [email protected] (H. Elabd), [email protected] (H.-P. Wang), [email protected] (A. Shaheen), [email protected] (A. Matter). ∗
https://doi.org/10.1016/j.fsi.2019.12.025 Received 18 October 2019; Received in revised form 21 November 2019; Accepted 9 December 2019 Available online 17 December 2019 1050-4648/ © 2019 Elsevier Ltd. All rights reserved.
Fish and Shellfish Immunology 97 (2020) 248–256
(Shi et al., 2015)
(Castro et al., 2011)
60 °C 1 min.
Fish (Initial weight 26 ± 0.5 g) were obtained from a commercial farm (Kafr El Sheikh Governorate, Egypt). Fish were acclimatized to the experimental conditions for one week, and then randomly distributed into three groups into fiberglass tanks (750 L) in triplicates for the growth trial (30 fish/tank). Fish were fed to satiation two times daily for four weeks. Throughout the experiment, water temperature ranged from 26.1 to 26.6 °C and dissolved oxygen content was ~6.6 mg/L. At the end of the 30-day feeding trial, nine fish from each group (3 fish/replicate) were randomly moved to 50 L tanks for performing hypoxia and cold stressors as follows;
60 °C 30 s.
94 °C 1 min. 62 °C 30 s.
72 °C 30 s.
62 °C 1 min.
94 °C 1 min.
A commercial tilapia basal diet KOUDIJS® Tilapia fish feed 30% sinking, Kapo feed, Borg El Arab, Alexandria, Egypt (crude protein 30%, crude fat 5.30%, crude fiber 5.80%, Calcium Minimum 1.9%, Phosphorous (P) Minimum 1.1%, Sodium (NA) Minimum 0.2% and Ash Maximum 10.0%) was used for the control group, and two experimental groups were fed the basal diet supplemented with 1% and 2% ANP/kg, respectively. A. membranaceus was supplied by Oregon's Wild Harvest (Sandy, Oregon, USA) in powder form and prepared in nanoform by ball mill method (stainless steel vial, mounted on a vibrating plate, and the stainless steel balls collide repeatedly with the plate and the powder inside the drum for 36 h) by a series of variable size mill balls (1, 0.5, and 0.25). The ratio of mill balls' weight to A. membranaceus particles weight was control constant 10:1, and mill balls' volume to dill seed particles volume was also control constant 5:1 g, and charge of A. membranaceus was loaded into the ball milling drum of ball mills. Doses of APS were selected based on our previous work on traditional A. membranaceus [7,9,10]. All ingredients were finely ground, mixed and pelleted, then air-dried and stored at 4 °C.
In hypoxia trial: Fish were moved to 50 L tanks after aeration had been stopped, and the water column was decreased and left monitored until signs of hypoxia appeared as mentioned by Refs. [7,8]. In cold stress trial: Fish were moved (from ambient temperature of 26.1–26.6 °C) to the 50 L tanks containing water supplied with aeration and pre-cooled to 12 °C for 30 min. The entire experiment was performed according to the guidelines of Faculty of veterinary medicine, Benha university for laboratory procedures and animal care instructions. 2.3. Sample collection Fish were anesthetized using MS-222 (Sigma, USA). Blood was then collected by caudal venipuncture using a 1 ml syringe. The blood samples were collected into heparinized tubes to obtain plasma (n = 9, 3 fish/replicate) in harmony with procedures previously described in our studies [7,9,10]. After blood sampling, liver samples were collected from the same fish and placed in RNAlater (Ambion, USA) and stored at −20 °C until used, according to Refs. [7,9,10]. 2.4. Immune-related parameters Nitric oxide (NO) was determined following the method described by Ref. [15] and lysozyme activity was performed using Lysozyme Detection kits (Sigma-Aldrich, USA) at 450 nm according to the protocol previously mentioned in our studies [7,9,10].
Hsp70
IL1B
50 °C 30 min. EF-1α
CCTTCAACGCTCAGGTCATC TGTGGGCAGTGTGGCAATC GCTGGAGAGTGCTGTGGAAGAACATATAG CCTGGAGCATCATGGCGTG CTCCTGTGTGGGGGTTTTCC TTTGGGCTTCCCTCCGTCTG
94 °C 15 min.
94 °C 15 s.
2nd denaturation Annealing 2nd denaturation
Extension
Annealing
2.1. Experimental diets and ANP preparation
2.2. Fish and experimental design
Reverse transcription
Primary denaturation
2. Materials and methods
Primers sequences Gene of interest
Table 1 Targeted gene primers sequences used in the analysis of gene expression in Nile tilapia O. niloticus.
Amplification (40 cycles)
Dissociation curve (1 cycle)
Final denaturation
Reference
(Gröner et al., 2015)
H. Elabd, et al.
249
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
Fig. 1. Nitric oxide (A) and lysozyme (B) activities in Nile tilapia (O. niloticus) supplied with 1 and 2% ANP at the end of feeding trial, and at post-exposure to cold and hypoxia challenges. Results are described as mean ± SEM (n = 9). Values with asterisk (*) are significantly different at (P < 0.05).
2.5. Liver antioxidant enzymes
Wf is the final weight of fish, and Wi is the weight of fish at stocking. Plasma amylase and lipase digestive enzymes activities were estimated according company protocols (Cusabio Biotech Co. Ltd., China) according to Ref. [22].
Liver samples kept in phosphate-buffered saline (PBS), pH 7.4 were assayed for measuring SOD, CAT, and GPx activities following procedures previously described by Refs. [16,17]; and [18].
2.8. Expression of heat shock protein 70 (HSP70) and interleukin 1, beta (IL-1β) genes
2.6. Biochemical assays Liver AST and ALT activities; and plasma glucose and cortisol concentrations were assayed according to protocols and equations described by Refs. [19,20]; and [21].
At the end of the feeding trial and after exposure to both cold and hypoxia stressors, total RNA was extracted from liver samples (n = 9 per group) usingTRIzol according to the manufacturer's protocol (Invitrogen, USA). Complementary DNA was synthesized from extracted total RNA using a High-Capacity cDNA Reverse Transcription Kit (Invitrogen, USA), following [7,9,10]. SYBR Green master mix (Invitrogen, USA) was used for performing the real-time PCR analysis. Primers for HSP70 and IL-1β genes are listed in Table 1. To determine the change in gene expression of tested samples, the Ct of each sample was matched with that of the control group using the “ΔΔCt” method described by Refs. [7,9,10].
2.7. Growth performance and digestive enzymes At the start and end of the feeding trial, fish were counted and average bodyweights were estimated. Specific growth rate (SGR), body mass gain (BMG), length gain rate (LGR), and feed conversion ratio (FCR) were calculated using the following equations: Specific growth rate (SGR) (% day−1) = [(ln final body mass in g) - ln initial body mass in g)/number of trial days] X 100, BMG (%) = 100 × [final body mass (g) - initial body mass (g)]/initial body mass (g)], length gain rate (%) = 100 × [average terminal body length (cm) – average initial body length(cm)]/average initial body length (cm), feed conversion ratio (FCR) = F/(Wf _ Wi); where F is the weight of feed offered to fish,
2.9. Bacterial challenge The Aeromonas veronii was isolated from diseased O. niloticus, with mortalities reaching 80%. A. veronii was produced overnight in brain
250
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
heart infusion broth (BHB at 28 °C for 18 h), and then washed with PBS in order to adjust the density to 9 × 108 cells/ml. At the end of the feeding trial, fish (30 ± 5 g body weight; 15 fish/group) were injected intraperitoneally with 0.2 ml bacterial suspension (9 × 108 cells/ml in PBS). Dead O. niloticus were removed and mortality was recorded daily for 15 days. Clinical signs and post mortem findings in dead and moribund fish were recorded.
3. Results 3.1. Immune-related parameters ANP incorporation significantly decreased NO levels at pre and post exposure to cold and hypoxia stressors compared to the control, and effectively decreased the increased levels caused by both stressors, with the highest decrease in the 1% ANP group (Fig. 1A). ANP dietary supplementation successfully increased lysozyme activity all over the experiment, especially after being dramatically decreased with exposure to cold and hypoxia stressful conditions. The 1% ANP group gave the maximum increase in lysozyme activity at pre and post exposure to cold stress and the 2% ANP group revealed the maximum increase after exposure to hypoxia, compared to the control (Fig. 1B).
2.10. Statistical analysis Results were statistically analyzed using one-way analysis of variance (ANOVA) and data was presented as Means ± Standard Error (M ± SE), and Duncan's multiple range tests were used to estimate significant differences between groups using the Statistical Package for the Social Sciences (SPSS) software (version 22.0). Values are expressed as means ± standard error and a value of P < 0.05 was considered significant.
Fig. 2. Effect of 1 and 2% ANP incorporation on antioxidants SOD (A), GPx (B), and CAT (C) activities in the liver of Nile tilapia (O. niloticus) at end of 30 days feeding trial and at post-exposure to cold and hypoxia challenges. Results are described as mean ± SEM (n = 9). Values with asterisk (*) are significantly different at (P < 0.05).
251
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
Fig. 3. Liver AST (A) and ALT (B); and plasma glucose (C) and cortisol (D) in Nile tilapia (O. niloticus) fed with 1 and 2% ANP at pre- and post-exposure to cold and hypoxia challenges. Results are described as mean ± SEM (n = 9). Values with asterisk (*) are significantly different at (P < 0.05).
3.2. Antioxidant enzymes
Table 2 Effect of dietary incorporation of O. niloticus with 0, 1, and 2% ANP on SGR, BMG, LGR, and FCR growth performance for 30 days feeding trial.
Although ANP incorporation did not show significant differences in SOD activity throughout the experimental period (Fig. 2A), it effectively decreased the GPx activity that was increased in response to both hypoxia and cold, with the highest decrease for the 1% ANP group after exposure to cold, and for the 2% ANP group after exposure to hypoxia (Fig. 2B). In addition, CAT activity was markedly elevated with subjection to cold and ANP ameliorated this effect through decreasing this level, and the 1% ANP group showed the maximum decrease in CAT activity over the control (Fig. 2C).
ANP %/kg feed
SGR (%)
BMG (%)
LGR (%)
FCR
0 1 2
0.14 ± 0.05 0.7 ± 0.02 0.51 ± 0.05*
10 ± 0.7 66.3 ± 0.5 42 ± 0.5*
14.3 ± 0.7 41.1 ± 0.7* 24.4 ± 0.5
19.4 ± 0.5 2.6 ± 0.1* 4.2 ± 0.3*
Values are mean (n = 30) ± SEM. Mean values with asterisk (*) are different significantly (P < 0.05). SGR: Specific growth rate, BMG: Body Mass Gain, LGR: Length Gain Rate, and FCR: Feed Conversion Ratio.
3.3. Biochemical assays
for the 1% ANP group at the end of feeding trial and after exposure to cold, and for the 2% ANP group, after exposure to hypoxia (Fig. 4A). Lipase activity was markedly higher in ANP groups after exposure to cold and hypoxia, with the highest value for the 1% ANP group after exposure to cold, and for the 2% group after exposure to hypoxia, compared to control (Fig. 4B).
However, ANP did not show decreases in neither AST nor ALT activities during the experiment (Fig. 3A and B), it noticeably decreased glucose concentration at pre and post exposure to cold, with the most significant decrease for the 1% ANP group (Fig. 3C). Also, ANP groups gave a significant decrease in cortisol concentration during the entire experiment, with best results for the 2% ANP group compared to the control (Fig. 3D).
3.5. Expression of heat shock protein 70 (HSP70) and interleukin 1, beta (IL-1β) genes
3.4. Growth performance and digestive enzymes
ANP groups showed significant upregulation of HSP70 and IL-1β genes along the experiment, with the highest upregulation for the 2% group at pre and post exposure to cold and hypoxia challenges, compared to the control (Fig. 5A and B).
ANP incorporation significantly increased the growth performance parameters (Table 2). The most marked increase in SGR% and BMG% was for the 2% ANP group, and in LGR%, the most marked increase was in the 1% ANP group. The most significant decrease in FCR was for both ANP groups when compared to control after the 30 day-feeding trial (Table 2). Amylase activity was higher in the ANP groups compared to the control along the experiment, even after exposure to cold and hypoxia challenges that decreased the enzyme activity, with the highest increase
3.6. Bacterial challenge After 30 days of the feeding trial, O. niloticus challenged with A. veronii showed loss of appetite, skin darkness, ascitis, and external hemorrhage. All internal organs, especially kidney, liver, and spleen
252
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
Fig. 4. Digestive enzyme (lipase and amylase) activities in plasma in Nile tilapia (O. niloticus) fed with 1 and 2% ANP-incorporated diets at the end of feeding trial and at post-exposure to cold and hypoxia challenges. Results are described as mean ± SEM (n = 9). Values with asterisk (*) are significantly different at (P < 0.05).
revealed congestion. The mortality percentage was significantly higher in the control group (60%) than in ANP groups (13.33% in the 1% ANP group and 6.66% in the 2% ANP group). (Fig. 6).
attributed to A. membranaceus active components such as APS (glucan and heteropolysaccharide) that could stimulate immune response [27–29]. Antioxidants SOD, Gpx, and CAT play a significant role in reducing oxidative stress and removing the reactive oxygen species [30,31]. Present results showed that the 1% ANP group gave the most significant decrease in both GPx and CAT activities, mainly after exposure to cold challenge. Our results come in accordance with other results recorded by Refs. [7,9,26]; and [29]. This effect can be because of the antioxidant and hepatoprotective effects of APS [8,14,29] However, it did not show significant effect on SOD activity. Similarly [32], found that SOD activity of turbot Scophthalmus maximus was not significantly affected with different concentrations of soybean meal after the feeding trial. Biochemical indexes are critical procedures in the diagnosis and assessment of fish status and condition [29,33]. Present work shows a marked decrease in glucose and cortisol concentrations for ANP-incorporated groups, especially after subjection to cold stress, which can be as a result of the anti-oxidative and hepatoprotective activities of APS [8,14,29]. Current findings are supported by those of [29]; who reported the effective role of APS on biochemical indices of yellow catfish Pelteobagrus fulvidraco, and [7] reported the same effect on
4. Discussion Present study targets the evaluation of incorporating Astragalus membranaceus nanoparticles in Nile tilapia diets, depending on the promising results we obtained from traditional Astragalus membranaceus [7,9,10]. ANP effectively improved overall status and performance of O. niloticus. Evaluation of immune response parameters are necessary for evaluation of fish health status [23]. Lysozyme and NO activities are well-known to play great roles in immune response and defense mechanisms [24,25]. Results of the current study showed that both nitrous oxide and lysozyme activities were significantly enhanced with ANP incorporation, with best result mostly for group receiving 2% ANP compared to the control group. Similarly [26], reported that Astragalus polysaccharides (APS) significantly increased immune parameters, particularly lysozyme activity (P < 0.05), of largemouth bass Micropterus salmoides compared with the control. Additionally, in our previous results [7,9,10], we also reported an immunostimulating activity of A. membranaceus in yellow perch over the control. This can be
253
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
Fig. 5. HSP70 (A) and IL-1β (B) genes expression in Nile tilapia (O. niloticus) incorporated with 1 and 2% ANP at end of feeding trial and at post-exposure to cold and hypoxia challenges. Results are described as mean ± SEM (n = 9). Values with asterisk (*) are significantly different at (P < 0.05).
yellow perch and on blue gill sun fish (2016b). Supplementation with A. membranaceus nanoparticles was effective in improving growth performance; that was clear with improved SGR, BMG, LGR, and FCR in ANP-supplemented groups, with the best results mostly for the 2% ANP group over the control. The positive effect can be a result of A. membranaceus active ingredients that promote growth and digestion [9,10,26]. In the current study, we got positive results with a smaller amount of ANP than we previously obtained with the traditional from Refs. [9,10]; this can be because nanoform can maximize the A. membranaceus efficiency. The digestion process was also improved with ANP incorporation, which was manifested by increased amylase and lipase activities in ANP groups over the control throughout the experiment, even after exposure to cold and hypoxia challenges that decreased enzyme activity. Those activities can be attributed to the ability of A. membranaceus and APS to enhance growth, promote
utilization of feed efficiently and, thus, improve digestion [9,10,26]. Accordingly [9,10,26], reported the same positive results in yellow catfish, yellow perch, and bluegill sunfish, respectively. IL-1β is one of the cytokines involved in the induction of immune response [34,35], and heat shock proteins (HSPs) are known as stress proteins [36], among which HSP70 is the member most responsible for stress reactions [37]. Here in our current study, the expression study of both genes revealed significantly high upregulation for ANP groups over the control throughout the entire experimental period. In the same instance, expressions of IL-1β were improved with APS application in P. fulvidraco [29], expression of HSP70 in yellow perch was also upregulated with A. membranaceus incorporation, and upregulation continued after exposure to different physical stressors including cold and hypoxia [7,8]. The upregulation is supposed to be due to the active components of A. membranaceus, as APS that are well known to stimulate immune
254
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
Fig. 6. Cumulative mortality rate of Nile tilapia (O. niloticus) fed with 1 and 2% ANP diets after feeding trial of 30 days and challenged with A. veronii infection for 15 days.
response and perform an anti-oxidative role [8,14,27,29], plus its presence in the nanoform maximizes its positive effects [12,13]. APS improvement to immunity can consequently result in improved resistance to pathogenic bacteria infection [38,39]. The present study recorded that ANP markedly reduced the cumulative mortality of O. niloticus against A. veronii, mostly through enhancing immune parameters such as lysozyme and NO; revealing an increased resistance to A. veronii in ANP-supplemented groups. This comes in agreement with [26]; who reported an increased resistance of M. salmoides to A. hydrophila in APS groups. In conclusion, dietary ANP markedly enhanced disease and stress resistance of Oreochromis niloticus through improving immune and antioxidative responses. No previous literature described the effect of ANP on fish, and further studies are required to cover more immune pathways.
[8] H. Elabd, H.-P. Wang, A. Shaheen, H. Yao, A. Abbass, Anti-oxidative effects of some dietary supplements on Yellow perch (Perca flavescens) exposed to different physical stressors, Aquacult. Rep. 8 (2017) 21–30, https://doi.org/10.1016/j.aqrep. 2017.09.002. [9] H. Elabd, H.-P. Wang, A. Shaheen, H. Yao, A. Abbass, Feeding Glycyrrhiza glabra (liquorice) and Astragalus membranaceus (AM) alters innate immune and physiological responses in yellow perch (Perca flavescens), Fish Shellfish Immunol. 54 (2016) 374–384, https://doi.org/10.1016/j.fsi.2016.04.024. [10] H. Elabd, H.-P. Wang, A. Shaheen, H. Yao, A. Abbass, Astragalus membranaceus (AM) enhances growth performance and antioxidant stress profiles in bluegill sunfish (Lepomis macrochirus), Fish Physiol. Biochem. 42 (2016) 955–966, https:// doi.org/10.1007/s10695-015-0188-9. [11] H.T. Dong, C. Techatanakitarnan, P. Jindakittikul, A. Thaiprayoon, S. Taengphu, W. Charoensapsri, P. Khunrae, T. Rattanarojpong, S. Senapin, Aeromonas jandaei and Aeromonas veronii caused disease and mortality in Nile tilapia, Oreochromis niloticus (L.), J. Fish Dis. 40 (2017) 1395–1403, https://doi.org/10.1111/jfd. 12617. [12] E.K. Hill, J. Li, Current and future prospects for nanotechnology in animal production, J. Anim. Sci. Biotechnol. 8 (26) (2017), https://doi.org/10.1186/s40104017-0157-5. [13] M. Nair, R.D. Jayant, A. Kaushik, V. Sagar, Getting into the brain: potential of nanotechnology in the management of NeuroAIDS, Adv. Drug Deliv. Rev. 103 (2016) 202–217, https://doi.org/10.1016/j.addr.2016.02.008. [14] R. Li, W. Chen, W. Wang, W. Tian, X. Zhang, Antioxidant activity of Astragalus polysaccharides and antitumour activity of the polysaccharides and siRNA, Carbohydr. Polym. 82 (2010) 240–244, https://doi.org/10.1016/j.carbpol.2010. 02.048. [15] K.M. Miranda, M.G. Espey, D.A. Wink, A rapid, simple spectrophotometric method for simultaneous detection of nitrate and nitrite, Nitric Oxide Biol. Chem. 5 (2001) 62–71, https://doi.org/10.1006/niox.2000.0319. [16] H. Aebi, [13] Catalase in vitro, Methods in Enzymology, Oxygen Radicals in Biological Systems, Academic Press, 1984, pp. 121–126, , https://doi.org/10.1016/ S0076-6879(84)05016–3. [17] J.M. McCord, I. Fridovich, Superoxide dismutase an enzymic function for erythrocuprein (Hemocuprein), J. Biol. Chem. 244 (1969) 6049–6055. [18] D.E. Paglia, W.N. Valentine, Studies on the quantitative and qualitative characterization of erythrocyte glutathione peroxidase, J. Lab. Clin. Med. 70 (1967) 158–169, https://doi.org/10.5555/uri:pii:0022214367900765. [19] X.-J. Huang, Y.-K. Choi, H.-S. Im, O. Yarimaga, E. Yoon, H.-S. Kim, Aspartate aminotransferase (AST/GOT) and alanine aminotransferase (ALT/GPT) detection techniques, Sensors 6 (2006) 756–782. [20] Z. Liu, S. Que, J. Xu, T. Peng, Alanine aminotransferase-old biomarker and new concept: a review, Int. J. Med. Sci. 11 (2014) 925–935, https://doi.org/10.7150/ ijms.8951. [21] P. Trinder, Determination of blood glucose using an oxidase-peroxidase system with a non-carcinogenic chromogen, J. Clin. Pathol. 22 (1969) 158–161. [22] N.W. Ross, K.J. Firth, A. Wang, J.F. Burka, S.C. Johnson, Changes in hydrolytic enzyme activities of naïve Atlantic salmon Salmo salar skin mucus due to infection with the salmon louse Lepeophtheirus salmonis and cortisol implantation, Dis. Aquat. Org. 41 (2000) 43–51, https://doi.org/10.3354/dao041043. [23] M.M.A. Mahmoud, M.M.M. El-Lamie, O.E. Kilany, A.A. Dessouki, Spirulina (Arthrospira platensis) supplementation improves growth performance, feed
Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.fsi.2019.12.025. References [1] A.A. Shaheen, An Industry Assessment of tilapia Farming in Egypt. African Union – Inter-african Bureau for Animal Resources (AU-IBAR), (2013). [2] S.M. Aly, M.A.A. Zohairy, A.H. Rahmani, M. Fathi, N.M.A. Atti, Trials to improve the response of Orechromis niloticus to Aeromonas hydrophila vaccine using immunostimulants (garlic, Echinacea) and probiotics (Organic Green TM and VetYeast TM), Afr. J. Biotechnol. 15 (2016) 989–994–994. [3] N.F. Soliman, D.M.M. Yacout, Aquaculture in Egypt: status, constraints and potentials, Aquacult. Int. 24 (2016) 1201–1227, https://doi.org/10.1007/s10499016-9989-9. [4] T.J. Bowden, Modulation of the immune system of fish by their environment, Fish Shellfish Immunol. 25 (2008) 373–383, https://doi.org/10.1016/j.fsi.2008.03.017. [5] N. Eissa, H.-P. Wang, H. Yao, Z.-G. Shen, A.A. Shaheen, E.N. Abou-ElGheit, Expression of Hsp70, Igf1, and three oxidative stress biomarkers in response to handling and salt treatment at different water temperatures in yellow perch, Perca flavescens, Front. Physiol. 8 (2017), https://doi.org/10.3389/fphys.2017.00683. [6] N. Eissa, H.-P. Wang, Transcriptional stress responses to environmental and husbandry stressors in aquaculture species, Rev. Aquac. 8 (2016) 61–88, https://doi. org/10.1111/raq.12081. [7] H. Elabd, H.-P. Wang, A. Shaheen, H. Yao, A. Abbass, Anti-oxidative effects of some dietary supplements on Yellow perch (Perca flavescens) exposed to different physical stressors, Aquacult. Rep. 8 (2017) 21–30, https://doi.org/10.1016/j.aqrep. 2017.09.002.
255
Fish and Shellfish Immunology 97 (2020) 248–256
H. Elabd, et al.
[24]
[25] [26]
[27] [28]
[29]
[30]
[31]
utilization, immune response, and relieves oxidative stress in Nile tilapia (Oreochromis niloticus) challenged with Pseudomonas fluorescens, Fish Shellfish Immunol. 72 (2018) 291–300, https://doi.org/10.1016/j.fsi.2017.11.006. R. Chakrabarti, P.K. Srivastava, N. Verma, J. Sharma, Effect of seeds of Achyranthes aspera on the immune responses and expression of some immune-related genes in carp Catla catla, Fish Shellfish Immunol. 41 (2014) 64–69, https://doi.org/10. 1016/j.fsi.2014.03.007. B. Magnadóttir, Innate immunity of fish (overview), Fish Shellfish Immunol., Rev.Fish Immunol. 20 (2006) 137–151, https://doi.org/10.1016/j.fsi.2004.09.006. S.-M. Lin, Y. Jiang, Y.-J. Chen, L. Luo, S. Doolgindachbaporn, B. Yuangsoi, Effects of Astragalus polysaccharides (APS) and chitooligosaccharides (COS) on growth, immune response and disease resistance of juvenile largemouth bass, Micropterus salmoides, Fish Shellfish Immunol. 70 (2017) 40–47, https://doi.org/10.1016/j.fsi. 2017.08.035. J. Galina, G. Yin, L. Ardó, Z. Jeney, The use of immunostimulating herbs in fish. An overview of research, Fish Physiol. Biochem. 35 (2009) 669–676, https://doi.org/ 10.1007/s10695-009-9304-z. V. Vetvicka, B. Dvorak, J. Vetvickova, J. Richter, J. Krizan, P. Sima, J.-C. Yvin, Orally administered marine (1– > 3)-beta-D-glucan Phycarine stimulates both humoral and cellular immunity, Int. J. Biol. Macromol. 40 (2007) 291–298, https:// doi.org/10.1016/j.ijbiomac.2006.08.009. W. Zhu, Y. Zhang, J. Zhang, G. Yuan, X. Liu, T. Ai, J. Su, Astragalus polysaccharides, chitosan and poly(I: C) obviously enhance inactivated Edwardsiella ictaluri vaccine potency in yellow catfish Pelteobagrus fulvidraco, Fish Shellfish Immunol. 87 (2019) 379–385, https://doi.org/10.1016/j.fsi.2019.01.033. S.-T. Chiu, R.-T. Tsai, J.-P. Hsu, C.-H. Liu, W. Cheng, Dietary sodium alginate administration to enhance the non-specific immune responses, and disease resistance of the juvenile grouper Epinephelus fuscoguttatus, Aquaculture 277 (2008) 66–72, https://doi.org/10.1016/j.aquaculture.2008.01.032. D. Madeira, L. Narciso, H.N. Cabral, C. Vinagre, M.S. Diniz, Influence of temperature in thermal and oxidative stress responses in estuarine fish, Comp. Biochem.
[32]
[33]
[34] [35] [36]
[37] [38] [39]
256
Physiol. A Mol. Integr. Physiol. 166 (2013) 237–243, https://doi.org/10.1016/j. cbpa.2013.06.008. M. Peng, W. Xu, Q. Ai, K. Mai, Z. Liufu, K. Zhang, Effects of nucleotide supplementation on growth, immune responses and intestinal morphology in juvenile turbot fed diets with graded levels of soybean meal (Scophthalmus maximus L.), Aquaculture 392–395 (2013) 51–58, https://doi.org/10.1016/j.aquaculture.2013. 02.002. A.G.M. Osman, M. Koutb, A.E.-D.H. Sayed, Use of hematological parameters to assess the efficiency of quince (Cydonia oblonga Miller) leaf extract in alleviation of the effect of ultraviolet–A radiation on African catfish Clarias gariepinus (Burchell, 1822), J. Photochem. Photobiol., B 99 (2010) 1–8, https://doi.org/10.1016/j. jphotobiol.2010.01.002. S. Reyes-Cerpa, K. Maisey, F. Reyes-López, D. Toro-Ascuy, A.M. Sandino, M. Imarai, Fish cytokines and immune response, New Adv. Contrib. Fish Biol. (2012), https:// doi.org/10.5772/53504. T. Wang, W. Huang, M.M. Costa, C.J. Secombes, The gamma-chain cytokine/receptor system in fish: more ligands and receptors, Fish Shellfish Immunol. 31 (2011) 673–687, https://doi.org/10.1016/j.fsi.2011.05.016. R.J. Roberts, C. Agius, C. Saliba, P. Bossier, Y.Y. Sung, Heat shock proteins (chaperones) in fish and shellfish and their potential role in relation to fish health: a review, J. Fish Dis. 33 (2010) 789–801, https://doi.org/10.1111/j.1365-2761. 2010.01183.x. B.M. Sanders, Stress proteins in aquatic organisms: an environmental perspective, Crit. Rev. Toxicol. 23 (1993) 49–75, https://doi.org/10.3109/ 10408449309104074. S.K. Song, B.R. Beck, D. Kim, J. Park, J. Kim, H.D. Kim, E. Ringø, Prebiotics as immunostimulants in aquaculture: a review, Fish Shellfish Immunol. 40 (2014) 40–48, https://doi.org/10.1016/j.fsi.2014.06.016. N. Van Hai, The use of medicinal plants as immunostimulants in aquaculture: a review, Aquaculture 446 (2015) 88–96, https://doi.org/10.1016/j.aquaculture. 2015.03.014.