- Email: [email protected]
Astrocytic glutamate transporter-dependent neuroprotection against glutamate toxicity: An in vitro study of maslinic acid
European Journal of Pharmacology 651 (2011) 59–65
Contents lists available at ScienceDirect
European Journal of Pharmacology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / e j p h a r
Molecular and Cellular Pharmacology
Astrocytic glutamate transporter-dependent neuroprotection against glutamate toxicity: An in vitro study of maslinic acid Yisong Qian a,1, Teng Guan a,1, Xuzhen Tang a, Longfei Huang a, Menghao Huang a, Yunman Li a,⁎, Hongbin Sun b, Rong Yu c, Fan Zhang c a b c
Department of Physiology, China Pharmaceutical University, 24 Tongjiaxiang Street, Nanjing 210009, PR China Center for Drug Discovery, China Pharmaceutical University, 24 Tongjiaxiang Street, Nanjing 210009, PR China Basic Pharmacy, School of Pharmacy, China Pharmaceutical University, 24 Tongjiaxiang Street, Nanjing 210009, PR China
a r t i c l e
i n f o
Article history: Received 13 July 2010 Received in revised form 17 October 2010 Accepted 31 October 2010 Available online 29 November 2010 Keywords: Astrocyte GLAST GLT-1 Maslinic acid Glutamate
a b s t r a c t The astrocytic glutamate transporters GLAST/EAAT1 and GLT-1/EAAT2 are crucial for the removal of glutamate from the synaptic cleft and are essential for maintaining a low concentration of extracellular glutamate in the brain. Enhanced transporter expression is neuroprotective. In the present study, we tested the neuropotective effects of maslinic acid, a natural product from the Olea europaea plant, on cultures of primary neurons from the cerebral cortex. Studies showed that astrocyte-conditioned medium from maslinic acid-treated astrocytes dose-dependently promoted neuron survival during glutamate toxicity by enhancing extracellular glutamate clearance. Real-time PCR and western blot analysis revealed that maslinic acid pre-treatment significantly increased the expression of GLAST and GLT-1 at the protein and mRNA levels. In addition, this neuroprotection was abolished by the glutamate transporter inhibitor, L-Threohydroxy aspartate (THA), in a co-culture of astrocytes and neurons. These findings suggest that maslinic acid regulates the extracellular glutamate concentration by increasing the expression of astrocytic glutamate transporters, which may, in turn, provide neuroprotection. © 2010 Elsevier B.V. All rights reserved.
1. Introduction Astrocytes are the most abundant glial cell type in the brain and act as a metabolic and tropic support for neurons. They have diverse and important functions during ischemic brain damage, which may be linked to glycogen storage, lactate production, glutamate homeostasis and the pH buffering capacity (Rossi et al., 2007). The astrocytic sodiumdependent glutamate transporters GLAST (EAAT1) and GLT-1 (EAAT2) stabilize the concentration of extracellular excitatory amino acids and are responsible for removal of more than 90% of the extracellular glutamate. This buffers the glutamate level, thus avoiding excessive stimulation of neuronal glutamate receptors and protecting neurons from glutamate toxicity (Dunlop, 2006). Accumulating evidence suggests that activation of glial glutamate transport may be an effective therapy for the treatment of acute ischemic stroke (Lizasoain et al., 2006). A previous report (Rothstein et al., 2005) revealed that betalactam antibiotics, which directly increase GLT-1 expression and activity in animals, are neuroprotective against ischemic injury in vitro and in vivo. In addition, a novel pharmaceutical agent, ONO-2506, enhances glutamate transporter expression and glutamate uptake in the rats subjected to transient middle cerebral artery occlusion. These effects
⁎ Corresponding author. Tel./fax: + 86 25 83271173. E-mail address: [email protected] (Y. Li). 1 These two authors contributed equally to this work. 0014-2999/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.ejphar.2010.10.095
lead to an amelioration of delayed infarct expansion and neurological deficits in this animal model (Mori et al., 2004). Maslinic acid (Fig. 1) is a triterpenoid compound abundantly expressed in Olea europaea plants. Evidence suggests that this compound has potent antioxidant (Montilla et al., 2003), anti-cancer (Juan et al., 2008), anti-HIV (Parra et al., 2009) and anti-inflammatory (Marquez Martin et al., 2006) activities. Our in vitro studies have demonstrated that maslinic acid treatment dose-dependently increases glycogen synthesis and prevents norepinephrine-dependent glycogenolysis in cultured cortical astrocytes by inhibiting glycogen phosphorylase (Guan et al., 2009). We also examined the hypoglycemic effects of maslinic acid in KK-A(y) mice that received maslinic acid daily at 10 mg/kg and 30 mg/kg for 2 weeks. Mice had a significant reduction in blood glucose level (Liu et al., 2007). However, the ability of this anti-diabetic agent to confer neuroprotection is not well understood. In this study, we investigated the neuroprotective effects of maslinic acid in an in vitro model. Glutamate excitotoxicity was performed on neuron-enriched cell cultures or astrocyte-neuron co-cultures. We examined the survival of primary neurons taken from the rat cortex and measured the extracellular glutamate concentration. We also evaluated the effects of maslinic acid treatment on the expression of the two astrocytic glutamate transporters, GLAST and GLT-1, by real-time PCR and western blot analysis. Astrocyte-conditioned medium from maslinic acidtreated astrocytes elicited dose-dependent neuroprotection against glutamate excitotoxicity. In addition, maslinic acid treatment promoted extracellular glutamate clearance and increased the expression of
60
Y. Qian et al. / European Journal of Pharmacology 651 (2011) 59–65
Neurobasal medium. After co-culturing for 4–6 d, the assay was performed.
2.3. Cell culture treatment
Fig. 1. Chemical structure of maslinic acid.
transporter protein and mRNA. In summary, our study elucidated the novel effects of maslinic acid to prevent glutamate-induced neuronal injury through an astrocyte-dependent manner.
2. Materials and methods 2.1. Materials L-Glutamate, (5R, 10S)-(+)-5-Methyl-10, 11-dihydro-5H-dibenzo [a,d]cyclohepten-5,10-imine hydrogen maleate (MK801) and L-Threohydroxy aspartate (THA) were obtained from Sigma (St. Louis, MO). Maslinic acid (2-α, 3-β- dihydroxyolean-12-en-28-oic acid, 96.5% purity) was obtained from the Center for Drug Discovery, China Pharmaceutical University (Nanjing, China). Rabbit anti-glial fibrillary acidic protein (GFAP) was obtained from DAKO (Glostrup, Denmark), rabbit anti-microtubule-associated protein 2 (MAP2) was obtained from Chemicon (Temecula, CA, USA), and rabbit anti-GLAST and anti-GLT-1 antibodies were obtained from Santa Cruz Biotechnology (CA, USA). Minimum Essential Medium (MEM), Neurobasal medium (without Phenol Red and estrogen-free) and B-27 were purchased from Gibco (Grand Island, NY).
2.2. Cell cultures Cerebral cortical astrocytes were prepared as previously described (McCarthy and de Vellis, 1980) with slight modification. Briefly, cortices were taken from newborn Spraque–Dawley rats and passed through a nylon sieve (80 μm pore size) into MEM supplemented with 10% fetal bovine serum (FBS) and 5.55 mM glucose. The cell suspension was seeded in poly-L-lysine (PLL)-coated flasks at 37 °C in a humidified atmosphere with 5% CO2. The medium was changed after two days and twice weekly thereafter. After 7 to 10 days, the microglia and oligodendrocyte progenitors were depleted by shaking and the remaining astrocyte-enriched cultures were harvested from the flasks with trypsin. These cells were subcultured at a density of approximately 105 cells/ml for further experiment. The culture purity was assessed by GFAP-specific immunocytochemical detection. Cortical neurons were dissociated from embryonic day 16 (E16) rat embryos and plated on PLL-treated coverslips. Neurons were maintained in Neurobasal medium supplemented with 0.02% B-27 and L-glutamine (0.5 mM) for 24 h. Cytosine arabinoside (Ara-C, 5 μM) was then added to these cultures to inhibit cell proliferation. The culture purity was assessed by MAP2-specific immunocytochemical detection. Astrocyte-neuron co-cultures were established using the approach of Stefanie Kaech and Gary Banker (Kaech and Banker, 2006) with modification. Neurons that were plated on PLL-treated coverslips were suspended above an astrocyte feeder layer and maintained in Neurobasal medium supplemented with B-27, L-glutamine and Ara-C. In order to maintain the conditioned environment, the cultures were fed every three days by replacing one-third of the volume with fresh
To evaluate the vulnerability of neurons to glutamate exposure, various concentrations of glutamate were added to neuron-enriched cultures or astrocyte-neuron co-cultures. To achieve the comparable results response to toxic insult, glutamate was added 24 h after replacing one-third of the medium after weekly co-culture and the cultures were incubated with glutamate for 24 h. Neuronal viability was quantified using the 3-(4, 5-dimethyl-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) reduction test. Cell viability was measured by optical density at 492 nm with a background subtraction at 630 nm. Results were expressed as the percent of the optical density of vehicle-treated cells. Cultured primary neurons were pre-treated with maslinic acid (0.1 μM, 1 μM and 10 μM) or MK801 (10 μM) for 24 h. Cultures were then exposed to fresh medium containing 10 μM glutamate for an additional 24 h. Similarly, astrocyte cultures were pre-treated with maslinic acid (0.1 μM, 1 μM and 10 μM) or MK801 (10 μM) for 24 h followed by exposure to 200-μM glutamate for an additional 24 h. After drug treatment, astrocyte-conditioned medium was collected and centrifuged for 10 min at 1000 ×g to remove cellular debris. A 50-μl aliquot of astrocyte-conditioned medium was added to the neuron cultures in a total volume of 500 μl/well and cells were incubated for 24 h. For astrocyte-neuron co-cultures, maslinic acid (10 μM) in combination with THA (100 μM) was added to the co-cultures and the cells were incubated for 24 h. Neuronal injury was quantitatively assessed by measuring lactate dehydrogenase (LDH) release into the culture medium 24 h after glutamate exposure using a commercially available kit (Jiancheng Bioengineering Institute, Nanjing, China). Cytotoxicity was determined by LDH release (OD 490 nm) and total LDH was determined after cell lysis.
2.4. Measurement of the extracellular glutamate concentration The L-Glutamic Acid (L-Glutamate/MSG) Assay Kit (Megazyme International Ireland Ltd., Bray Business Park, Bray,Co. Wicklow, Ireland) was used to measure the extracellular glutamate concentration. An aliquot of culture supernatant was deproteinized by adding an equal volume of ice-cold 1 M perchloric acid. The supernatant was centrifuged at 1500×g for 10 min and neutralised with 1 M KOH. The amount of glutamate was quantified by a colorimetric method following the manufacturer's instructions.
2.5. Immunocytochemistry Cells were rinsed with phosphate-buffered saline (PBS) three times, fixed with 4% paraformaldehyde for 30 min at room temperature and permeabilised in 0.1% Triton X-100 for 10 min. An incubation in 5% bovine serum albumin (BSA) in PBS for 1 h was performed to prevent antibody non-specific binding. The cultures were incubated with primary antibodies overnight at 4 °C. The rabbit polyclonal anti-MAP2 antibody (1:1000) was used to immunostain neurons, the rabbit polyclonal anti-GFAP antibody (1:500) was used to immunostain astrocytes, and the rabbit polyclonal anti-GLAST (1:100) and anti-GLT1 (1:100) antibodies were used to immunostain astrocytic GLAST and GLT-1. After incubation with primary antibodies, cells were incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG (Alexa 488; 1:200; invitrogen) and the nuclei were stained with Hoechst's 33258. Immunostained cells were examined under a fluorescence microscope (Olympus IX71, Tokyo, Japan), and digital images were obtained using Image-Pro Plus software.
Y. Qian et al. / European Journal of Pharmacology 651 (2011) 59–65
61
2.6. Real-time PCR Total RNA was isolated from cultured astrocytes and 1 μl of total RNA was reverse transcribed using the 1st Strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan) on a thermocycler (GeneAmpR PCR System 2720; Applied Biosystems). Real-time PCR was performed using the ABI 7500 sequence detection system (Applied Biosystems, Foster City, CA) with a reaction mixture that consisted of TaqMan 2× PCR Master Mix (Applied Biosystems), cDNA template, probe and forward primer and reverse primers. Primer sequences were as follows: 5'-CCGAGCTGGACACCATTGA-3' and 5'-TGGACTGCGTCTTGGTCAT-3' (GLT-1), 5'-CCGTCAGCGCTGTCATTG-3' and 5'-AAGTACTTGACCTCCCGGTAGCT-3' (GLAST) and 5'-TCTGTGTGGATTGGTGGCTCTA-3' and 5'CTGCTTGCTGATCCACATCTG-3' (Beta-actin, for an endogenous control). Probes to GLAST (ATCCTTGGATTTGCCCTCCGACCGTATA), GLT-1 (CAACACCGAATGCACGAAGACATCGA) and beta-actin (CCTGGCCTCACTGTCCACCTTCCA) were used. The PCR protocol consisted of 40 cycles of the following profile: 95 °C for 15 s (denaturation step) and 60 °C for 1 min (to allow extension and amplification of the target sequence). Data were analyzed using the ABI 7500 sequence detection system software. The amount of GLAST and GLT-1 mRNA was normalized to beta-actin expression using the CT method. 2.7. Western Blot GLAST and GLT-1 protein expression was determined in the astrocyte homogenate. The cells were rinsed twice in PBS and lysed in RIPA lysis buffer for 20 min using a cell scraper. Fifty micrograms of protein were loaded into each lane, separated by 10% SDS-PAGE and transferred to nitrocellulose membranes (Pall Corporation, USA) in Tris-glycine buffer (48 mM Tris, 39 mM glycine, pH 9.2) containing 20% methanol. The membranes were blocked with skimmed milk for 1 h, washed in Trisbuffered saline containing 0.1% Tween-20 (TBST) and incubated overnight with rabbit anti-GLAST (1:400) or rabbit anti-GLT-1 (1:400) antibodies. After washing three times with TBST, nitrocellulose membranes were incubated for 1 h at room temperature with horseradish peroxidase-conjugated goat anti-rabbit IgG (1:5000; Santa Cruz, CA, USA). Bands were visualized using the SuperSignal West Pico Chemiluminescent Substrate Trial Kit (Pierce, Rockford, IL, USA). Images were taken using the ChemiDoc XRS system with Quantity One software (Bio-Rad, Richmond, CA, USA). The expression of GLAST and GLT-1 were normalized to α-tublin expression and compared to the control. 2.8. Statistical analysis All values are expressed as the mean ± S.E.M. Differences among the groups were compared using a one-way ANOVA followed by a Tukey post-hoc test. An unpaired Student's t-test was used to compare data between two groups. The level of significance was set to P b 0.05. 3. Results
Fig. 2. Glutamate-induced neuron death in neuron-enriched cultures (A) and astrocyteneuron co-cultures (B). Cells were pre-treated with glutamate for 24 h and cell viability was measured by the MTT reduction test (**P b 0.01 vs the vehicle-treated group). Data represent the mean ± S.E.M. of three independent experiments performed in triplicate and are expressed as the percentage of the control values. Statistical significance was analyzed by a one-way ANOVA followed by a Tukey post-hoc test.
3.2. Astrocyte-conditioned medium from maslinic acid-treated astrocytes prevents glutamate-induced neurotoxicity To examine whether maslinic acid directly prevents glutamate toxicity in cortical neuron cultures, cells were treated with maslinic acid (0.1 μM, 1 μM and 10 μM) for 24 h followed by incubation with glutamate (10 μM) for 24 h. As shown in Fig. 3A, glutamate induced a significant increase in LDH release (76.72 ± 2.15% of maximal LDH release) in cortical neuron cultures. Maslinic acid treatment (0.1– 10 μM) minimally affected neuron survival. In contrast, pre-treatment with MK801 (10 μM), a N-methyl-D-aspartate (NMDA) receptor antagonist, significantly prevented glutamate-induced neuron injury (20.46 ± 0.82% of maximal LDH release). To investigate whether astrocytes mediate the effects, astrocytes were pre-treated with maslinic acid (0.1 μM, 1 μM and 10 μM) for 24 h. Astrocyte-conditioned medium from maslinic acid-treated astrocytes displayed neuroprotection in a dose-dependent manner and significantly inhibited LDH release (24.45 ± 0.80%, 48.02 ± 1.28% and 65.39 ± 1.49% of maximal LDH release, respectively) (Fig. 3B). Maximal neuroprotection was produced by treatment with 10 μM maslinic acid. Maslinic acid, at this concentration, did not affect cell viability.
3.1. Glutamate concentration in neuron cultures and astrocyte-neuron co-cultures
3.3. Maslinic acid enhances extracellular glutamate clearance in astrocytes
Cortical neuron cultures and astrocyte-neuron co-cultures were treated with glutamate for 24 h. Cytotoxicity assay including LDH release and MTT reduction assay measures the cell death which may include both necrotic and apoptotic cells. Our results suggest that cortical neurons were more sensitive to glutamate toxicity when cultured alone than with astrocytes (Fig. 2). Neuron viability was analysed and glutamate induced neuron toxicity with an IC50 value of 9.98 μM in pure cultures and 188.82 μM in co-cultures. Therefore, 10 μM and 200 μM glutamate was used in our experiment to induce neurotoxicity in pure cultures and co-cultures, respectively.
To investigate whether neuroprotection was due to the modulation of extracellular glutamate, the extracellular glutamate concentration was determined in the astrocyte-conditioned medium. After a 24 h incubation with 200 μM glutamate, approximately 50% of the glutamate was removed by astrocytes. As the maslinic acid concentration was increased, the extracellular glutamate concentration was significantly reduced. In 10 μM, 1 μM and 0.1 μM maslinic acid treatment group, the residual glutamate concentration was 62.00 ± 8.58 μmol/l, 71.33 ± 8.76 μmol/l and 87.11 ± 5.82 μmol/l (Fig. 4) respectively.
62
Y. Qian et al. / European Journal of Pharmacology 651 (2011) 59–65
Fig. 3. Effects of maslinic acid treatment on glutamate-induced neurotoxicity. (A) Maslinic acid treatment did not directly affect neuroprotection in cortical neuron cultures. Maslinic acid (0.1 μM, 1 μM and 10 μM) or MK801 (10 μM) were added to neuron cultures for 24 h followed by a 24 h incubation with glutamate. (B) Astrocyte-conditioned medium from maslinic acid-treated astrocytes protected neurons from glutamate toxicity in a dosedependent manner. Various concentrations of maslinic acid (0.1 μM, 1 μM and 10 μM) or MK801 (10 μM) were added to astrocyte cultures for 24 h followed by a 24 h incubation with glutamate. The astrocyte-conditioned medium with or without drug treatment was then added to neuron cultures and cells were incubated for 24 h. Neuron survival was estimated by measuring LDH release (#P b 0.01 vs control group; **P b 0.01 vs the vehicle group). Data represent the mean ± S.E.M. of three independent experiments performed in triplicate and are expressed as the percentage of the control values. Statistical significance was determined by a one-way ANOVA followed by a Tukey post-hoc test.
3.4. Maslinic acid treatment increases GLAST and GLT-1 expression in astrocytes The localization of GLAST and GLT-1 in cortical astrocytes is shown in Fig. 5. Cells were grown in the presence or absence of 10 μM
Fig. 4. Maslinic acid treatment decreased the extracellular glutamate concentration in astrocytes in a dose-dependent manner. Maslinic acid (0.1 μM, 1 μM and 10 μM) or MK801 (10 μM) were added to astrocyte cultures for 24 h followed by a 24 h incubation with glutamate (200 μM) (*P b 0.05, **P b 0.01 vs the vehicle group). Data represent the mean ± S.E.M. of three independent experiments performed in triplicate and are expressed as the percentage of the control values. Statistical significance was determined by a one-way ANOVA followed by a Tukey post-hoc test.
Fig. 5. GLAST and GLT-1 distribution in control and maslinic acid-treated astrocytes. Immunocytochemistry of cortical astrocyte cultures demonstrates positive staining of GFAP, GLAST and GLT-1, as visualized with FITC (green), in control and maslinic acid-treated cell cultures. Cell nuclei were visualized by Hoechst's 33258 (blue). The control astrocytes expressed a minimal amount of GLAST and GLT-1. Maslinic acid (10 μM, 24 h) pre-treatment increased glutamate transporter expression (Scale bar, 50 μm). Each experiment was repeated three times and similar results were obtained. The results are representative of three independent experiments.
maslinic acid for 24 h and were then fixed and immunostained. GFAP, a specific biomarker for astrocytes, is a major intermediate filament protein in the cytoskeleton. Maslinic acid treatment minimally affected GFAP expression. GLAST and GLT-1 expression was low in GFAP-positive astrocytes and was mainly distributed around the nuclei. However, GLAST and GLT-1 immunoreactivity was more intense in maslinic acid-treated astrocytes. GLAST and GLT-1 mRNA expression was determined by real-time PCR. Total RNA was extracted from astrocyte cultures grown in the presence or absence of maslinic acid (10 μM) for 4 h, 12 h and 24 h. Maslinic acid pretreatment affected gene expression in a time-dependent manner (Fig. 6). Maslinic acid treatment significantly increased GLAST gene expression at 4 h and 12 h; expression was increased 3.39±0.39-fold and 2.02±0.48fold, respectively, in comparison to the control treatment. Maslinic acid treatment also increased GLT-1 gene expression within 12 h; however, this effect was significant only at the 4 h time point (1.68±0.20-fold increase compared to the control treatment). To determine whether changes in gene transcription affect protein expression, western blot analysis was performed to determine GLAST and GLT-1 expression under the conditions indicated above. No significant effects were observed after a 4 h and 12 h incubation (data not shown), whereas GLAST and GLT-1 expression increased 2.11 ± 0.18-fold and 2.62±0.19-fold, respectively, after a 24 h maslinic acid treatment (Fig. 7). 3.5. Maslinic acid treatment protects cortical neurons from glutamate toxicity via the regulation of astrocytic glutamate transporters To further test whether astrocytic glutamate transporters are important for the mediation of maslinic acid-dependent neuroprotection,
Y. Qian et al. / European Journal of Pharmacology 651 (2011) 59–65
63
improved neuron survival and morphology in the co-cultures (Fig. 8C). 4. Discussion
Fig. 6. Maslinic acid treatment increased astrocytic GLAST and GLT-1 mRNA expression in a time-dependent manner. Cells were treated with maslinic acid (10 μM) for 4 h, 12 h and 24 h (*P b 0.05, **P b 0.01 vs the control group). Data represent the mean ± S.E.M. of three independent experiments performed in triplicate and are expressed as the percentage of the control values. Statistical significance was determined by a one-way ANOVA followed by a Tukey post-hoc test.
we used a astrocyte-neuron co-culture. Cells were incubated with maslinic acid (10 μM) for 24 h followed by incubation with glutamate (200 μM, 24 h). Glutamate did not affect astrocyte viability (data not shown), whereas in the co-culture system, it caused about 4.67-fold increase in the relative LDH release of control levels after a 24 h incubation. Maslinic acid-treated astrocytes significantly improved neuron survival, as assessed by LDH release. However, inclusion of THA (100 μM), one of the glutamate transporter antagonists, with maslinic acid treatment blocked astrocyte-mediated neuroprotection. THA alone did not affect neuron survival (Fig. 8A). In addition, maslinic acid treatment decreased the extracellular glutamate concentration (Fig. 8B). MAP2 staining of neurons in the co-cultures indicated that control neurons were very confluent and were structurally intact with round, smooth soma. Neuronal processes were uniform and smooth in appearance. In contrast, glutamate treatment severely reduced the neuron cell number. After treatment, neurons had rough and irregular soma and fragmented processes. Maslinic acid treatment significantly
Fig. 7. Maslinic acid treatment increased astrocytic GLAST and GLT-1 protein expression. Cells were treated with maslinic acid (10 μM) for 24 h. (A) The expression of GLAST and GLT-1 was normalized to α-tublin expression. (B) Immunoblots of GLAST and GLT-1 in control and maslinic acid-treated astrocytes (**P b 0.01 vs the control group). Each experiment was repeated three times and similar results were obtained. The results are representative of three independent experiments. Statistical significance was determined by the Student's t-test.
Maslinic acid, a natural compound, has antioxidant properties and prevents lipid peroxidation in vitro (Montilla et al., 2003). It has been suggested that this compound has potential biopharmaceutical use to prevent oxidative stress and pro-inflammatory cytokine generation (Marquez Martin et al., 2006). maslinic acid treatment significantly inhibits the production of nitric oxide (NO) by inhibiting LPS-induced iNOS gene expression. In addition, maslinic acid treatment reduces the secretion of inflammatory cytokines, such as interleukin-6 and TNF-α. Taken together, these data suggest that maslinic acid treatment may protect the central nervous system (CNS) against inflammation-induced injury, which contributes to acute and chronic CNS disorders (Lucas et al., 2006). In the present study, we determined whether maslinic acid is neuroprotective and investigated its mechanism of action. Our results demonstrate that maslinic acid treatment increased the mRNA and protein expression of astrocyte glutamate transporters, which may account for the protective effect of maslinic acid treatment in an in vitro model of glutamate-elicited neurotoxicity. In addition to being the most important excitatory neurotransmitter in the brain, glutamate is a potent neurotoxin and is considered the primary cause of neuron death during acute insults to the brain and in neurodegenerative diseases. Defects in glutamate metabolism and increased extracellular glutamate concentration cause neuronal depolarization, activation of NMDA receptors, increase the intracellular calcium concentration and enhance free radical generation (Beal, 1995; Sims and Robinson, 1999). Thus, the effective treatment of excitotoxic injury requires modulation of glutamate release, glutamate receptor activation, ROS generation and glutamate transport. Astrocytes are multifunctional cells in the CNS that are involved in cell signalling and metabolic functions. Astrocytes resist pathophysiological conditions and decrease tissue loss by providing metabolic support and nutrients (Dienel and Hertz, 2005). In this study, the astrocyte-neuron co-culture system was resistant to excititoxicity, suggesting that pharmaceutical agents that target astrocyte-neuron interactions may be neuroprotective. Our results showed that, compared with the non-competitive NMDA receptor antagonist, MK801, maslinic acid treatment did not prevent glutamate-induced neurotoxicity. However, dose-dependent protection was observed when astrocyte-conditioned medium from maslinic acid-treated astrocytes was added to the neuron culture. We performed a control experiment in which the astrocytes were treated with vehicle. As seen in Fig. 3B, the conditioned medium from vehicle-treated astrocytes cannot protect neuron from excitotoxicity. However, the medium from maslinic acid-treated astrocytes elicited remarkable protection, which was closely related with glutamate levels in the medium. Therefore, our findings suggest that maslinic acid treatment may alleviate glutamate-induced neurotoxicity by increasing astrocytic glutamate clearance, in contrast to the effects of MK801, which acts by blocking NMDA receptors. Highly efficient glutamate transporters remove synaptically-released glutamate to maintain a low extracellular concentration. In the CNS, the precise control of extracellular glutamate concentration is primarily mediated by the astrocytic glutamate transporters GLAST and GLT-1. These proteins transport glutamate into cells, a mechanism that is coupled to the Na+/K+-ATPase-mediated sodium electrochemical gradient. Thus, the extracellular glutamate concentration is lowered and over-activation of glutamate receptors is prevented. Therefore, this limits or prevents glutamate excitotoxicity and neuron death (Rothstein et al., 1996). Accordingly, inhibiting glutamate uptake by blocking these transporters leads to rapid accumulation of extracellular glutamate and consequent activation of glutamate receptors; activation of these receptors may indirectly influence neuronal survival. Astrocytes elicit
64
Y. Qian et al. / European Journal of Pharmacology 651 (2011) 59–65
Fig. 8. The neuroprotective effects of maslinic acid against glutamate toxicity in neuron-astrocyte co-cultures. Maslinic acid (10 μM) and maslinic acid (10 μM) in combination with THA (100 μM) were added to co-cultures for 24 h followed by a 24 h incubation with glutamate (200 μM). Treatment with THA, a glutamate transporter inhibitor, abolished the effects of maslinic acid. (A) Maslinic acid treatment prevented LDH release. (B) Maslinic acid treatment decreased the extracellular glutamate concentration. (C) MAP2-positive (green) staining of neurons in the co-cultures Scale bar, 50 μm; #P b 0.01 vs control group; **P b 0.01 vs the glutamate group. Data represent the mean± S.E.M. of three independent experiments performed in triplicate and are expressed as the percentage of the control values. Statistical significance was analyzed by one-way ANOVA followed by a Tukey post-hoc test.
neuroprotection in global and focal ischemia models by maintaining the activity of glutamate transporters. Therefore, compounds that increase the expression or activity of glial glutamate transporters may be therapeutically useful (Rossi et al., 2007). In our study, wide distribution of GLAST and GLT-1 transporters was observed in cultured astrocytes after maslinic acid treatment. Astrocytic transporters are modulated at numerous levels, including regulation of protein expression, cell surface trafficking, protein binding and post-translational modification (Anderson and Swanson, 2000). Therefore, we determined the expression of GLAST and GLT-1 mRNA and protein in astrocytes. Maslinic acid treatment increased the expression of GLAST and GLT-1 mRNA, with a maximal induction at 4 h, whereas the transporter protein expression remained constant up to 24 h. GLT-1 modulates cellular signalling pathways, such as protein kinase B (PKB), phosphatidylinositol 3-kinase (PI3-K) and the nuclear transcription factor-κB (NF-κB) (Li et al., 2006). Recently, it was determined that certain compounds influence astrocytic glutamate transporter activity through various signalling pathways. For example, estrogen administration increases the mRNA and protein expression of GLAST and GLT-1 in cultured astrocytes via the activation of nuclear estrogen receptors (Pawlak et al., 2005). Thyroid hormone treatment enhances the expression of GLAST and GLT-1 via a cyclic AMP-dependent signalling pathway (Mendes-de-Aguiar et al., 2008). In addition, Phencyclidine treatment increases GLT-1 expression in the cerebral cortex through a NMDAR-mediated mechanism and affects Ca2+/ calcineurin and Ca2+/calmodulin activity. In turn, these pathways
regulate numerous downstream physiological effectors and modulate glutamate transport (Fattorini et al., 2008). In conclusion, we suggest that maslinic acid treatment may modulate the expression of glutamate transporters through a genomic mechanism, although for the genes involved are unknown. We tested whether the maslinic acid-dependent increase in GLAST and GLT-1 expression may be beneficial to neuron survival during glutamate toxicity. In this experiment, the ability of astrocytic glutamate transporters to modulate glutamate-induced neuron injury was tested in the astrocyte-neuron co-culture system. Continuous glutamate exposure elicited neurotoxicity in the co-cultures, which was significantly attenuated by maslinic acid pre-treatment. The protective effects of maslinic acid were antagonized by THA, an irreversible inhibitor of glutamate transport. These data suggest that maslinic acid-dependent neuroprotection, at least in part, may be caused by increased extracellular glutamate clearance via astrocytic glutamate transporters. Furthermore, our data suggest that compounds that enhance GLAST and GLT-1 expression may have neuroprotective effects and preventing glutamate-induced neuronal damage. Therefore, the development of specific stimulators of glutamate transporter function or expression may be clinically useful. In sum, we propose a novel mechanism of maslinic acid to induce neuroprotection by increasing astrocytic glutamate transporter expression. Astrocytes are central to the maslinic acid mechanism of action, which includes glutamate uptake, metabolism maintenance and antioxidant defense. However, there are several important questions arising from this study for future research. For instance, how is glutamate
Y. Qian et al. / European Journal of Pharmacology 651 (2011) 59–65
transporter up-regulated by the maslinic acid treatment? The pathways related to activation of GLAST and GLT-1 by maslinic acid remains unknown. Furthermore, although we proposed that maslinic acid treatment may alleviate glutamate-induced neurotoxicity by increasing astrocytic glutamate clearance, hypothetically, possible release of gliaderived trophic factors, which induced by maslinic acid exposure may also lead to the neuroprotection. To support the concept that targeting astrocyte is an effective neuroprotective strategy, future studies are necessary to test this hypothesis in in vitro as well as in vivo models and we are currently pursuing these studies in our laboratory. Acknowledgements This work was supported by the National Natural Science Foundation of China (grants 30672523 and 90713037) and research grants from the Chinese Ministry of Education (grants 706030 and 20050316008). We would like to thank Xiaolin Wang and Jun Yan for their skilled technical assistance with real-time PCR and immunocytochemistry. References Anderson, C.M., Swanson, R.A., 2000. Astrocyte glutamate transport: review of properties, regulation, and physiological functions. Glia 32, 1–14. Beal, M.F., 1995. Aging, energy, and oxidative stress in neurodegenerative diseases. Ann. Neurol. 38, 357–366. Dienel, G.A., Hertz, L., 2005. Astrocytic contributions to bioenergetics of cerebral ischemia. Glia 50, 362–388. Dunlop, J., 2006. Glutamate-based therapeutic approaches: targeting the glutamate transport system. Curr. Opin. Pharmacol. 6, 103–107. Fattorini, G., Melone, M., Bragina, L., Candiracci, C., Cozzi, A., Pellegrini Giampietro, D.E., Torres-Ramos, M., Perez-Samartin, A., Matute, C., Conti, F., 2008. GLT-1 expression and Glu uptake in rat cerebral cortex are increased by phencyclidine. Glia 56, 1320–1327. Guan, T., Li, Y., Sun, H., Tang, X., Qian, Y., 2009. Effects of maslinic acid, a natural triterpene, on glycogen metabolism in cultured cortical astrocytes. Planta Med. 75, 1141–1143. Juan, M.E., Planas, J.M., Ruiz-Gutierrez, V., Daniel, H., Wenzel, U., 2008. Antiproliferative and apoptosis-inducing effects of maslinic and oleanolic acids, two pentacyclic triterpenes from olives, on HT-29 colon cancer cells. Br. J. Nutr. 100, 36–43. Kaech, S., Banker, G., 2006. Culturing hippocampal neurons. Nat. Protoc. 1, 2406–2415.
65
Li, L.B., Toan, S.V., Zelenaia, O., Watson, D.J., Wolfe, J.H., Rothstein, J.D., Robinson, M.B., 2006. Regulation of astrocytic glutamate transporter expression by Akt: evidence for a selective transcriptional effect on the GLT-1/EAAT2 subtype. J. Neurochem. 97, 759–771. Liu, J., Sun, H., Duan, W., Mu, D., Zhang, L., 2007. Maslinic acid reduces blood glucose in KK-Ay mice. Biol. Pharm. Bull. 30, 2075–2078. Lizasoain, I., Cardenas, A., Hurtado, O., Romera, C., Mallolas, J., Lorenzo, P., Castillo, J., Moro, M.A., 2006. Targets of cytoprotection in acute ischemic stroke: present and future. Cerebrovasc. Dis. 21 (Suppl 2), 1–8. Lucas, S.M., Rothwell, N.J., Gibson, R.M., 2006. The role of inflammation in CNS injury and disease. Br. J. Pharmacol. 147 (Suppl 1), S232–S240. Marquez Martin, A., de la Puerta Vazquez, R., Fernandez-Arche, A., Ruiz-Gutierrez, V., 2006. Supressive effect of maslinic acid from pomace olive oil on oxidative stress and cytokine production in stimulated murine macrophages. Free Radic. Res. 40, 295–302. McCarthy, K.D., de Vellis, J., 1980. Preparation of separate astroglial and oligodendroglial cell cultures from rat cerebral tissue. J. Cell Biol. 85, 890–902. Mendes-de-Aguiar, C.B., Alchini, R., Decker, H., Alvarez-Silva, M., Tasca, C.I., Trentin, A.G., 2008. Thyroid hormone increases astrocytic glutamate uptake and protects astrocytes and neurons against glutamate toxicity. J. Neurosci. Res. 86, 3117–3125. Montilla, M.P., Agil, A., Navarro, M.C., Jimenez, M.I., Garcia-Granados, A., Parra, A., Cabo, M.M., 2003. Antioxidant activity of maslinic acid, a triterpene derivative obtained from Olea europaea. Planta Med. 69, 472–474. Mori, T., Tateishi, N., Kagamiishi, Y., Shimoda, T., Satoh, S., Ono, S., Katsube, N., Asano, T., 2004. Attenuation of a delayed increase in the extracellular glutamate level in the peri-infarct area following focal cerebral ischemia by a novel agent ONO-2506. Neurochem. Int. 45, 381–387. Parra, A., Rivas, F., Lopez, P.E., Garcia-Granados, A., Martinez, A., Albericio, F., Marquez, N., Munoz, E., 2009. Solution- and solid-phase synthesis and anti-HIV activity of maslinic acid derivatives containing amino acids and peptides. Bioorg. Med. Chem. 17, 1139–1145. Pawlak, J., Brito, V., Kuppers, E., Beyer, C., 2005. Regulation of glutamate transporter GLAST and GLT-1 expression in astrocytes by estrogen. Brain Res. Mol. Brain Res. 138, 1–7. Rossi, D.J., Brady, J.D., Mohr, C., 2007. Astrocyte metabolism and signaling during brain ischemia. Nat. Neurosci. 10, 1377–1386. Rothstein, J.D., Dykes-Hoberg, M., Pardo, C.A., Bristol, L.A., Jin, L., Kuncl, R.W., Kanai, Y., Hediger, M.A., Wang, Y., Schielke, J.P., Welty, D.F., 1996. Knockout of glutamate transporters reveals a major role for astroglial transport in excitotoxicity and clearance of glutamate. Neuron 16, 675–686. Rothstein, J.D., Patel, S., Regan, M.R., Haenggeli, C., Huang, Y.H., Bergles, D.E., Jin, L., Dykes Hoberg, M., Vidensky, S., Chung, D.S., Toan, S.V., Bruijn, L.I., Su, Z.Z., Gupta, P., Fisher, P.B., 2005. Beta-lactam antibiotics offer neuroprotection by increasing glutamate transporter expression. Nature 433, 73–77. Sims, K.D., Robinson, M.B., 1999. Expression patterns and regulation of glutamate transporters in the developing and adult nervous system. Crit. Rev. Neurobiol. 13, 169–197.
Contents lists available at ScienceDirect
European Journal of Pharmacology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / e j p h a r
Molecular and Cellular Pharmacology
Astrocytic glutamate transporter-dependent neuroprotection against glutamate toxicity: An in vitro study of maslinic acid Yisong Qian a,1, Teng Guan a,1, Xuzhen Tang a, Longfei Huang a, Menghao Huang a, Yunman Li a,⁎, Hongbin Sun b, Rong Yu c, Fan Zhang c a b c
Department of Physiology, China Pharmaceutical University, 24 Tongjiaxiang Street, Nanjing 210009, PR China Center for Drug Discovery, China Pharmaceutical University, 24 Tongjiaxiang Street, Nanjing 210009, PR China Basic Pharmacy, School of Pharmacy, China Pharmaceutical University, 24 Tongjiaxiang Street, Nanjing 210009, PR China
a r t i c l e
i n f o
Article history: Received 13 July 2010 Received in revised form 17 October 2010 Accepted 31 October 2010 Available online 29 November 2010 Keywords: Astrocyte GLAST GLT-1 Maslinic acid Glutamate
a b s t r a c t The astrocytic glutamate transporters GLAST/EAAT1 and GLT-1/EAAT2 are crucial for the removal of glutamate from the synaptic cleft and are essential for maintaining a low concentration of extracellular glutamate in the brain. Enhanced transporter expression is neuroprotective. In the present study, we tested the neuropotective effects of maslinic acid, a natural product from the Olea europaea plant, on cultures of primary neurons from the cerebral cortex. Studies showed that astrocyte-conditioned medium from maslinic acid-treated astrocytes dose-dependently promoted neuron survival during glutamate toxicity by enhancing extracellular glutamate clearance. Real-time PCR and western blot analysis revealed that maslinic acid pre-treatment significantly increased the expression of GLAST and GLT-1 at the protein and mRNA levels. In addition, this neuroprotection was abolished by the glutamate transporter inhibitor, L-Threohydroxy aspartate (THA), in a co-culture of astrocytes and neurons. These findings suggest that maslinic acid regulates the extracellular glutamate concentration by increasing the expression of astrocytic glutamate transporters, which may, in turn, provide neuroprotection. © 2010 Elsevier B.V. All rights reserved.
1. Introduction Astrocytes are the most abundant glial cell type in the brain and act as a metabolic and tropic support for neurons. They have diverse and important functions during ischemic brain damage, which may be linked to glycogen storage, lactate production, glutamate homeostasis and the pH buffering capacity (Rossi et al., 2007). The astrocytic sodiumdependent glutamate transporters GLAST (EAAT1) and GLT-1 (EAAT2) stabilize the concentration of extracellular excitatory amino acids and are responsible for removal of more than 90% of the extracellular glutamate. This buffers the glutamate level, thus avoiding excessive stimulation of neuronal glutamate receptors and protecting neurons from glutamate toxicity (Dunlop, 2006). Accumulating evidence suggests that activation of glial glutamate transport may be an effective therapy for the treatment of acute ischemic stroke (Lizasoain et al., 2006). A previous report (Rothstein et al., 2005) revealed that betalactam antibiotics, which directly increase GLT-1 expression and activity in animals, are neuroprotective against ischemic injury in vitro and in vivo. In addition, a novel pharmaceutical agent, ONO-2506, enhances glutamate transporter expression and glutamate uptake in the rats subjected to transient middle cerebral artery occlusion. These effects
⁎ Corresponding author. Tel./fax: + 86 25 83271173. E-mail address: [email protected] (Y. Li). 1 These two authors contributed equally to this work. 0014-2999/$ – see front matter © 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.ejphar.2010.10.095
lead to an amelioration of delayed infarct expansion and neurological deficits in this animal model (Mori et al., 2004). Maslinic acid (Fig. 1) is a triterpenoid compound abundantly expressed in Olea europaea plants. Evidence suggests that this compound has potent antioxidant (Montilla et al., 2003), anti-cancer (Juan et al., 2008), anti-HIV (Parra et al., 2009) and anti-inflammatory (Marquez Martin et al., 2006) activities. Our in vitro studies have demonstrated that maslinic acid treatment dose-dependently increases glycogen synthesis and prevents norepinephrine-dependent glycogenolysis in cultured cortical astrocytes by inhibiting glycogen phosphorylase (Guan et al., 2009). We also examined the hypoglycemic effects of maslinic acid in KK-A(y) mice that received maslinic acid daily at 10 mg/kg and 30 mg/kg for 2 weeks. Mice had a significant reduction in blood glucose level (Liu et al., 2007). However, the ability of this anti-diabetic agent to confer neuroprotection is not well understood. In this study, we investigated the neuroprotective effects of maslinic acid in an in vitro model. Glutamate excitotoxicity was performed on neuron-enriched cell cultures or astrocyte-neuron co-cultures. We examined the survival of primary neurons taken from the rat cortex and measured the extracellular glutamate concentration. We also evaluated the effects of maslinic acid treatment on the expression of the two astrocytic glutamate transporters, GLAST and GLT-1, by real-time PCR and western blot analysis. Astrocyte-conditioned medium from maslinic acidtreated astrocytes elicited dose-dependent neuroprotection against glutamate excitotoxicity. In addition, maslinic acid treatment promoted extracellular glutamate clearance and increased the expression of
60
Y. Qian et al. / European Journal of Pharmacology 651 (2011) 59–65
Neurobasal medium. After co-culturing for 4–6 d, the assay was performed.
2.3. Cell culture treatment
Fig. 1. Chemical structure of maslinic acid.
transporter protein and mRNA. In summary, our study elucidated the novel effects of maslinic acid to prevent glutamate-induced neuronal injury through an astrocyte-dependent manner.
2. Materials and methods 2.1. Materials L-Glutamate, (5R, 10S)-(+)-5-Methyl-10, 11-dihydro-5H-dibenzo [a,d]cyclohepten-5,10-imine hydrogen maleate (MK801) and L-Threohydroxy aspartate (THA) were obtained from Sigma (St. Louis, MO). Maslinic acid (2-α, 3-β- dihydroxyolean-12-en-28-oic acid, 96.5% purity) was obtained from the Center for Drug Discovery, China Pharmaceutical University (Nanjing, China). Rabbit anti-glial fibrillary acidic protein (GFAP) was obtained from DAKO (Glostrup, Denmark), rabbit anti-microtubule-associated protein 2 (MAP2) was obtained from Chemicon (Temecula, CA, USA), and rabbit anti-GLAST and anti-GLT-1 antibodies were obtained from Santa Cruz Biotechnology (CA, USA). Minimum Essential Medium (MEM), Neurobasal medium (without Phenol Red and estrogen-free) and B-27 were purchased from Gibco (Grand Island, NY).
2.2. Cell cultures Cerebral cortical astrocytes were prepared as previously described (McCarthy and de Vellis, 1980) with slight modification. Briefly, cortices were taken from newborn Spraque–Dawley rats and passed through a nylon sieve (80 μm pore size) into MEM supplemented with 10% fetal bovine serum (FBS) and 5.55 mM glucose. The cell suspension was seeded in poly-L-lysine (PLL)-coated flasks at 37 °C in a humidified atmosphere with 5% CO2. The medium was changed after two days and twice weekly thereafter. After 7 to 10 days, the microglia and oligodendrocyte progenitors were depleted by shaking and the remaining astrocyte-enriched cultures were harvested from the flasks with trypsin. These cells were subcultured at a density of approximately 105 cells/ml for further experiment. The culture purity was assessed by GFAP-specific immunocytochemical detection. Cortical neurons were dissociated from embryonic day 16 (E16) rat embryos and plated on PLL-treated coverslips. Neurons were maintained in Neurobasal medium supplemented with 0.02% B-27 and L-glutamine (0.5 mM) for 24 h. Cytosine arabinoside (Ara-C, 5 μM) was then added to these cultures to inhibit cell proliferation. The culture purity was assessed by MAP2-specific immunocytochemical detection. Astrocyte-neuron co-cultures were established using the approach of Stefanie Kaech and Gary Banker (Kaech and Banker, 2006) with modification. Neurons that were plated on PLL-treated coverslips were suspended above an astrocyte feeder layer and maintained in Neurobasal medium supplemented with B-27, L-glutamine and Ara-C. In order to maintain the conditioned environment, the cultures were fed every three days by replacing one-third of the volume with fresh
To evaluate the vulnerability of neurons to glutamate exposure, various concentrations of glutamate were added to neuron-enriched cultures or astrocyte-neuron co-cultures. To achieve the comparable results response to toxic insult, glutamate was added 24 h after replacing one-third of the medium after weekly co-culture and the cultures were incubated with glutamate for 24 h. Neuronal viability was quantified using the 3-(4, 5-dimethyl-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) reduction test. Cell viability was measured by optical density at 492 nm with a background subtraction at 630 nm. Results were expressed as the percent of the optical density of vehicle-treated cells. Cultured primary neurons were pre-treated with maslinic acid (0.1 μM, 1 μM and 10 μM) or MK801 (10 μM) for 24 h. Cultures were then exposed to fresh medium containing 10 μM glutamate for an additional 24 h. Similarly, astrocyte cultures were pre-treated with maslinic acid (0.1 μM, 1 μM and 10 μM) or MK801 (10 μM) for 24 h followed by exposure to 200-μM glutamate for an additional 24 h. After drug treatment, astrocyte-conditioned medium was collected and centrifuged for 10 min at 1000 ×g to remove cellular debris. A 50-μl aliquot of astrocyte-conditioned medium was added to the neuron cultures in a total volume of 500 μl/well and cells were incubated for 24 h. For astrocyte-neuron co-cultures, maslinic acid (10 μM) in combination with THA (100 μM) was added to the co-cultures and the cells were incubated for 24 h. Neuronal injury was quantitatively assessed by measuring lactate dehydrogenase (LDH) release into the culture medium 24 h after glutamate exposure using a commercially available kit (Jiancheng Bioengineering Institute, Nanjing, China). Cytotoxicity was determined by LDH release (OD 490 nm) and total LDH was determined after cell lysis.
2.4. Measurement of the extracellular glutamate concentration The L-Glutamic Acid (L-Glutamate/MSG) Assay Kit (Megazyme International Ireland Ltd., Bray Business Park, Bray,Co. Wicklow, Ireland) was used to measure the extracellular glutamate concentration. An aliquot of culture supernatant was deproteinized by adding an equal volume of ice-cold 1 M perchloric acid. The supernatant was centrifuged at 1500×g for 10 min and neutralised with 1 M KOH. The amount of glutamate was quantified by a colorimetric method following the manufacturer's instructions.
2.5. Immunocytochemistry Cells were rinsed with phosphate-buffered saline (PBS) three times, fixed with 4% paraformaldehyde for 30 min at room temperature and permeabilised in 0.1% Triton X-100 for 10 min. An incubation in 5% bovine serum albumin (BSA) in PBS for 1 h was performed to prevent antibody non-specific binding. The cultures were incubated with primary antibodies overnight at 4 °C. The rabbit polyclonal anti-MAP2 antibody (1:1000) was used to immunostain neurons, the rabbit polyclonal anti-GFAP antibody (1:500) was used to immunostain astrocytes, and the rabbit polyclonal anti-GLAST (1:100) and anti-GLT1 (1:100) antibodies were used to immunostain astrocytic GLAST and GLT-1. After incubation with primary antibodies, cells were incubated with fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit IgG (Alexa 488; 1:200; invitrogen) and the nuclei were stained with Hoechst's 33258. Immunostained cells were examined under a fluorescence microscope (Olympus IX71, Tokyo, Japan), and digital images were obtained using Image-Pro Plus software.
Y. Qian et al. / European Journal of Pharmacology 651 (2011) 59–65
61
2.6. Real-time PCR Total RNA was isolated from cultured astrocytes and 1 μl of total RNA was reverse transcribed using the 1st Strand cDNA Synthesis Kit (Takara Bio, Shiga, Japan) on a thermocycler (GeneAmpR PCR System 2720; Applied Biosystems). Real-time PCR was performed using the ABI 7500 sequence detection system (Applied Biosystems, Foster City, CA) with a reaction mixture that consisted of TaqMan 2× PCR Master Mix (Applied Biosystems), cDNA template, probe and forward primer and reverse primers. Primer sequences were as follows: 5'-CCGAGCTGGACACCATTGA-3' and 5'-TGGACTGCGTCTTGGTCAT-3' (GLT-1), 5'-CCGTCAGCGCTGTCATTG-3' and 5'-AAGTACTTGACCTCCCGGTAGCT-3' (GLAST) and 5'-TCTGTGTGGATTGGTGGCTCTA-3' and 5'CTGCTTGCTGATCCACATCTG-3' (Beta-actin, for an endogenous control). Probes to GLAST (ATCCTTGGATTTGCCCTCCGACCGTATA), GLT-1 (CAACACCGAATGCACGAAGACATCGA) and beta-actin (CCTGGCCTCACTGTCCACCTTCCA) were used. The PCR protocol consisted of 40 cycles of the following profile: 95 °C for 15 s (denaturation step) and 60 °C for 1 min (to allow extension and amplification of the target sequence). Data were analyzed using the ABI 7500 sequence detection system software. The amount of GLAST and GLT-1 mRNA was normalized to beta-actin expression using the CT method. 2.7. Western Blot GLAST and GLT-1 protein expression was determined in the astrocyte homogenate. The cells were rinsed twice in PBS and lysed in RIPA lysis buffer for 20 min using a cell scraper. Fifty micrograms of protein were loaded into each lane, separated by 10% SDS-PAGE and transferred to nitrocellulose membranes (Pall Corporation, USA) in Tris-glycine buffer (48 mM Tris, 39 mM glycine, pH 9.2) containing 20% methanol. The membranes were blocked with skimmed milk for 1 h, washed in Trisbuffered saline containing 0.1% Tween-20 (TBST) and incubated overnight with rabbit anti-GLAST (1:400) or rabbit anti-GLT-1 (1:400) antibodies. After washing three times with TBST, nitrocellulose membranes were incubated for 1 h at room temperature with horseradish peroxidase-conjugated goat anti-rabbit IgG (1:5000; Santa Cruz, CA, USA). Bands were visualized using the SuperSignal West Pico Chemiluminescent Substrate Trial Kit (Pierce, Rockford, IL, USA). Images were taken using the ChemiDoc XRS system with Quantity One software (Bio-Rad, Richmond, CA, USA). The expression of GLAST and GLT-1 were normalized to α-tublin expression and compared to the control. 2.8. Statistical analysis All values are expressed as the mean ± S.E.M. Differences among the groups were compared using a one-way ANOVA followed by a Tukey post-hoc test. An unpaired Student's t-test was used to compare data between two groups. The level of significance was set to P b 0.05. 3. Results
Fig. 2. Glutamate-induced neuron death in neuron-enriched cultures (A) and astrocyteneuron co-cultures (B). Cells were pre-treated with glutamate for 24 h and cell viability was measured by the MTT reduction test (**P b 0.01 vs the vehicle-treated group). Data represent the mean ± S.E.M. of three independent experiments performed in triplicate and are expressed as the percentage of the control values. Statistical significance was analyzed by a one-way ANOVA followed by a Tukey post-hoc test.
3.2. Astrocyte-conditioned medium from maslinic acid-treated astrocytes prevents glutamate-induced neurotoxicity To examine whether maslinic acid directly prevents glutamate toxicity in cortical neuron cultures, cells were treated with maslinic acid (0.1 μM, 1 μM and 10 μM) for 24 h followed by incubation with glutamate (10 μM) for 24 h. As shown in Fig. 3A, glutamate induced a significant increase in LDH release (76.72 ± 2.15% of maximal LDH release) in cortical neuron cultures. Maslinic acid treatment (0.1– 10 μM) minimally affected neuron survival. In contrast, pre-treatment with MK801 (10 μM), a N-methyl-D-aspartate (NMDA) receptor antagonist, significantly prevented glutamate-induced neuron injury (20.46 ± 0.82% of maximal LDH release). To investigate whether astrocytes mediate the effects, astrocytes were pre-treated with maslinic acid (0.1 μM, 1 μM and 10 μM) for 24 h. Astrocyte-conditioned medium from maslinic acid-treated astrocytes displayed neuroprotection in a dose-dependent manner and significantly inhibited LDH release (24.45 ± 0.80%, 48.02 ± 1.28% and 65.39 ± 1.49% of maximal LDH release, respectively) (Fig. 3B). Maximal neuroprotection was produced by treatment with 10 μM maslinic acid. Maslinic acid, at this concentration, did not affect cell viability.
3.1. Glutamate concentration in neuron cultures and astrocyte-neuron co-cultures
3.3. Maslinic acid enhances extracellular glutamate clearance in astrocytes
Cortical neuron cultures and astrocyte-neuron co-cultures were treated with glutamate for 24 h. Cytotoxicity assay including LDH release and MTT reduction assay measures the cell death which may include both necrotic and apoptotic cells. Our results suggest that cortical neurons were more sensitive to glutamate toxicity when cultured alone than with astrocytes (Fig. 2). Neuron viability was analysed and glutamate induced neuron toxicity with an IC50 value of 9.98 μM in pure cultures and 188.82 μM in co-cultures. Therefore, 10 μM and 200 μM glutamate was used in our experiment to induce neurotoxicity in pure cultures and co-cultures, respectively.
To investigate whether neuroprotection was due to the modulation of extracellular glutamate, the extracellular glutamate concentration was determined in the astrocyte-conditioned medium. After a 24 h incubation with 200 μM glutamate, approximately 50% of the glutamate was removed by astrocytes. As the maslinic acid concentration was increased, the extracellular glutamate concentration was significantly reduced. In 10 μM, 1 μM and 0.1 μM maslinic acid treatment group, the residual glutamate concentration was 62.00 ± 8.58 μmol/l, 71.33 ± 8.76 μmol/l and 87.11 ± 5.82 μmol/l (Fig. 4) respectively.
62
Y. Qian et al. / European Journal of Pharmacology 651 (2011) 59–65
Fig. 3. Effects of maslinic acid treatment on glutamate-induced neurotoxicity. (A) Maslinic acid treatment did not directly affect neuroprotection in cortical neuron cultures. Maslinic acid (0.1 μM, 1 μM and 10 μM) or MK801 (10 μM) were added to neuron cultures for 24 h followed by a 24 h incubation with glutamate. (B) Astrocyte-conditioned medium from maslinic acid-treated astrocytes protected neurons from glutamate toxicity in a dosedependent manner. Various concentrations of maslinic acid (0.1 μM, 1 μM and 10 μM) or MK801 (10 μM) were added to astrocyte cultures for 24 h followed by a 24 h incubation with glutamate. The astrocyte-conditioned medium with or without drug treatment was then added to neuron cultures and cells were incubated for 24 h. Neuron survival was estimated by measuring LDH release (#P b 0.01 vs control group; **P b 0.01 vs the vehicle group). Data represent the mean ± S.E.M. of three independent experiments performed in triplicate and are expressed as the percentage of the control values. Statistical significance was determined by a one-way ANOVA followed by a Tukey post-hoc test.
3.4. Maslinic acid treatment increases GLAST and GLT-1 expression in astrocytes The localization of GLAST and GLT-1 in cortical astrocytes is shown in Fig. 5. Cells were grown in the presence or absence of 10 μM
Fig. 4. Maslinic acid treatment decreased the extracellular glutamate concentration in astrocytes in a dose-dependent manner. Maslinic acid (0.1 μM, 1 μM and 10 μM) or MK801 (10 μM) were added to astrocyte cultures for 24 h followed by a 24 h incubation with glutamate (200 μM) (*P b 0.05, **P b 0.01 vs the vehicle group). Data represent the mean ± S.E.M. of three independent experiments performed in triplicate and are expressed as the percentage of the control values. Statistical significance was determined by a one-way ANOVA followed by a Tukey post-hoc test.
Fig. 5. GLAST and GLT-1 distribution in control and maslinic acid-treated astrocytes. Immunocytochemistry of cortical astrocyte cultures demonstrates positive staining of GFAP, GLAST and GLT-1, as visualized with FITC (green), in control and maslinic acid-treated cell cultures. Cell nuclei were visualized by Hoechst's 33258 (blue). The control astrocytes expressed a minimal amount of GLAST and GLT-1. Maslinic acid (10 μM, 24 h) pre-treatment increased glutamate transporter expression (Scale bar, 50 μm). Each experiment was repeated three times and similar results were obtained. The results are representative of three independent experiments.
maslinic acid for 24 h and were then fixed and immunostained. GFAP, a specific biomarker for astrocytes, is a major intermediate filament protein in the cytoskeleton. Maslinic acid treatment minimally affected GFAP expression. GLAST and GLT-1 expression was low in GFAP-positive astrocytes and was mainly distributed around the nuclei. However, GLAST and GLT-1 immunoreactivity was more intense in maslinic acid-treated astrocytes. GLAST and GLT-1 mRNA expression was determined by real-time PCR. Total RNA was extracted from astrocyte cultures grown in the presence or absence of maslinic acid (10 μM) for 4 h, 12 h and 24 h. Maslinic acid pretreatment affected gene expression in a time-dependent manner (Fig. 6). Maslinic acid treatment significantly increased GLAST gene expression at 4 h and 12 h; expression was increased 3.39±0.39-fold and 2.02±0.48fold, respectively, in comparison to the control treatment. Maslinic acid treatment also increased GLT-1 gene expression within 12 h; however, this effect was significant only at the 4 h time point (1.68±0.20-fold increase compared to the control treatment). To determine whether changes in gene transcription affect protein expression, western blot analysis was performed to determine GLAST and GLT-1 expression under the conditions indicated above. No significant effects were observed after a 4 h and 12 h incubation (data not shown), whereas GLAST and GLT-1 expression increased 2.11 ± 0.18-fold and 2.62±0.19-fold, respectively, after a 24 h maslinic acid treatment (Fig. 7). 3.5. Maslinic acid treatment protects cortical neurons from glutamate toxicity via the regulation of astrocytic glutamate transporters To further test whether astrocytic glutamate transporters are important for the mediation of maslinic acid-dependent neuroprotection,
Y. Qian et al. / European Journal of Pharmacology 651 (2011) 59–65
63
improved neuron survival and morphology in the co-cultures (Fig. 8C). 4. Discussion
Fig. 6. Maslinic acid treatment increased astrocytic GLAST and GLT-1 mRNA expression in a time-dependent manner. Cells were treated with maslinic acid (10 μM) for 4 h, 12 h and 24 h (*P b 0.05, **P b 0.01 vs the control group). Data represent the mean ± S.E.M. of three independent experiments performed in triplicate and are expressed as the percentage of the control values. Statistical significance was determined by a one-way ANOVA followed by a Tukey post-hoc test.
we used a astrocyte-neuron co-culture. Cells were incubated with maslinic acid (10 μM) for 24 h followed by incubation with glutamate (200 μM, 24 h). Glutamate did not affect astrocyte viability (data not shown), whereas in the co-culture system, it caused about 4.67-fold increase in the relative LDH release of control levels after a 24 h incubation. Maslinic acid-treated astrocytes significantly improved neuron survival, as assessed by LDH release. However, inclusion of THA (100 μM), one of the glutamate transporter antagonists, with maslinic acid treatment blocked astrocyte-mediated neuroprotection. THA alone did not affect neuron survival (Fig. 8A). In addition, maslinic acid treatment decreased the extracellular glutamate concentration (Fig. 8B). MAP2 staining of neurons in the co-cultures indicated that control neurons were very confluent and were structurally intact with round, smooth soma. Neuronal processes were uniform and smooth in appearance. In contrast, glutamate treatment severely reduced the neuron cell number. After treatment, neurons had rough and irregular soma and fragmented processes. Maslinic acid treatment significantly
Fig. 7. Maslinic acid treatment increased astrocytic GLAST and GLT-1 protein expression. Cells were treated with maslinic acid (10 μM) for 24 h. (A) The expression of GLAST and GLT-1 was normalized to α-tublin expression. (B) Immunoblots of GLAST and GLT-1 in control and maslinic acid-treated astrocytes (**P b 0.01 vs the control group). Each experiment was repeated three times and similar results were obtained. The results are representative of three independent experiments. Statistical significance was determined by the Student's t-test.
Maslinic acid, a natural compound, has antioxidant properties and prevents lipid peroxidation in vitro (Montilla et al., 2003). It has been suggested that this compound has potential biopharmaceutical use to prevent oxidative stress and pro-inflammatory cytokine generation (Marquez Martin et al., 2006). maslinic acid treatment significantly inhibits the production of nitric oxide (NO) by inhibiting LPS-induced iNOS gene expression. In addition, maslinic acid treatment reduces the secretion of inflammatory cytokines, such as interleukin-6 and TNF-α. Taken together, these data suggest that maslinic acid treatment may protect the central nervous system (CNS) against inflammation-induced injury, which contributes to acute and chronic CNS disorders (Lucas et al., 2006). In the present study, we determined whether maslinic acid is neuroprotective and investigated its mechanism of action. Our results demonstrate that maslinic acid treatment increased the mRNA and protein expression of astrocyte glutamate transporters, which may account for the protective effect of maslinic acid treatment in an in vitro model of glutamate-elicited neurotoxicity. In addition to being the most important excitatory neurotransmitter in the brain, glutamate is a potent neurotoxin and is considered the primary cause of neuron death during acute insults to the brain and in neurodegenerative diseases. Defects in glutamate metabolism and increased extracellular glutamate concentration cause neuronal depolarization, activation of NMDA receptors, increase the intracellular calcium concentration and enhance free radical generation (Beal, 1995; Sims and Robinson, 1999). Thus, the effective treatment of excitotoxic injury requires modulation of glutamate release, glutamate receptor activation, ROS generation and glutamate transport. Astrocytes are multifunctional cells in the CNS that are involved in cell signalling and metabolic functions. Astrocytes resist pathophysiological conditions and decrease tissue loss by providing metabolic support and nutrients (Dienel and Hertz, 2005). In this study, the astrocyte-neuron co-culture system was resistant to excititoxicity, suggesting that pharmaceutical agents that target astrocyte-neuron interactions may be neuroprotective. Our results showed that, compared with the non-competitive NMDA receptor antagonist, MK801, maslinic acid treatment did not prevent glutamate-induced neurotoxicity. However, dose-dependent protection was observed when astrocyte-conditioned medium from maslinic acid-treated astrocytes was added to the neuron culture. We performed a control experiment in which the astrocytes were treated with vehicle. As seen in Fig. 3B, the conditioned medium from vehicle-treated astrocytes cannot protect neuron from excitotoxicity. However, the medium from maslinic acid-treated astrocytes elicited remarkable protection, which was closely related with glutamate levels in the medium. Therefore, our findings suggest that maslinic acid treatment may alleviate glutamate-induced neurotoxicity by increasing astrocytic glutamate clearance, in contrast to the effects of MK801, which acts by blocking NMDA receptors. Highly efficient glutamate transporters remove synaptically-released glutamate to maintain a low extracellular concentration. In the CNS, the precise control of extracellular glutamate concentration is primarily mediated by the astrocytic glutamate transporters GLAST and GLT-1. These proteins transport glutamate into cells, a mechanism that is coupled to the Na+/K+-ATPase-mediated sodium electrochemical gradient. Thus, the extracellular glutamate concentration is lowered and over-activation of glutamate receptors is prevented. Therefore, this limits or prevents glutamate excitotoxicity and neuron death (Rothstein et al., 1996). Accordingly, inhibiting glutamate uptake by blocking these transporters leads to rapid accumulation of extracellular glutamate and consequent activation of glutamate receptors; activation of these receptors may indirectly influence neuronal survival. Astrocytes elicit
64
Y. Qian et al. / European Journal of Pharmacology 651 (2011) 59–65
Fig. 8. The neuroprotective effects of maslinic acid against glutamate toxicity in neuron-astrocyte co-cultures. Maslinic acid (10 μM) and maslinic acid (10 μM) in combination with THA (100 μM) were added to co-cultures for 24 h followed by a 24 h incubation with glutamate (200 μM). Treatment with THA, a glutamate transporter inhibitor, abolished the effects of maslinic acid. (A) Maslinic acid treatment prevented LDH release. (B) Maslinic acid treatment decreased the extracellular glutamate concentration. (C) MAP2-positive (green) staining of neurons in the co-cultures Scale bar, 50 μm; #P b 0.01 vs control group; **P b 0.01 vs the glutamate group. Data represent the mean± S.E.M. of three independent experiments performed in triplicate and are expressed as the percentage of the control values. Statistical significance was analyzed by one-way ANOVA followed by a Tukey post-hoc test.
neuroprotection in global and focal ischemia models by maintaining the activity of glutamate transporters. Therefore, compounds that increase the expression or activity of glial glutamate transporters may be therapeutically useful (Rossi et al., 2007). In our study, wide distribution of GLAST and GLT-1 transporters was observed in cultured astrocytes after maslinic acid treatment. Astrocytic transporters are modulated at numerous levels, including regulation of protein expression, cell surface trafficking, protein binding and post-translational modification (Anderson and Swanson, 2000). Therefore, we determined the expression of GLAST and GLT-1 mRNA and protein in astrocytes. Maslinic acid treatment increased the expression of GLAST and GLT-1 mRNA, with a maximal induction at 4 h, whereas the transporter protein expression remained constant up to 24 h. GLT-1 modulates cellular signalling pathways, such as protein kinase B (PKB), phosphatidylinositol 3-kinase (PI3-K) and the nuclear transcription factor-κB (NF-κB) (Li et al., 2006). Recently, it was determined that certain compounds influence astrocytic glutamate transporter activity through various signalling pathways. For example, estrogen administration increases the mRNA and protein expression of GLAST and GLT-1 in cultured astrocytes via the activation of nuclear estrogen receptors (Pawlak et al., 2005). Thyroid hormone treatment enhances the expression of GLAST and GLT-1 via a cyclic AMP-dependent signalling pathway (Mendes-de-Aguiar et al., 2008). In addition, Phencyclidine treatment increases GLT-1 expression in the cerebral cortex through a NMDAR-mediated mechanism and affects Ca2+/ calcineurin and Ca2+/calmodulin activity. In turn, these pathways
regulate numerous downstream physiological effectors and modulate glutamate transport (Fattorini et al., 2008). In conclusion, we suggest that maslinic acid treatment may modulate the expression of glutamate transporters through a genomic mechanism, although for the genes involved are unknown. We tested whether the maslinic acid-dependent increase in GLAST and GLT-1 expression may be beneficial to neuron survival during glutamate toxicity. In this experiment, the ability of astrocytic glutamate transporters to modulate glutamate-induced neuron injury was tested in the astrocyte-neuron co-culture system. Continuous glutamate exposure elicited neurotoxicity in the co-cultures, which was significantly attenuated by maslinic acid pre-treatment. The protective effects of maslinic acid were antagonized by THA, an irreversible inhibitor of glutamate transport. These data suggest that maslinic acid-dependent neuroprotection, at least in part, may be caused by increased extracellular glutamate clearance via astrocytic glutamate transporters. Furthermore, our data suggest that compounds that enhance GLAST and GLT-1 expression may have neuroprotective effects and preventing glutamate-induced neuronal damage. Therefore, the development of specific stimulators of glutamate transporter function or expression may be clinically useful. In sum, we propose a novel mechanism of maslinic acid to induce neuroprotection by increasing astrocytic glutamate transporter expression. Astrocytes are central to the maslinic acid mechanism of action, which includes glutamate uptake, metabolism maintenance and antioxidant defense. However, there are several important questions arising from this study for future research. For instance, how is glutamate
Y. Qian et al. / European Journal of Pharmacology 651 (2011) 59–65
transporter up-regulated by the maslinic acid treatment? The pathways related to activation of GLAST and GLT-1 by maslinic acid remains unknown. Furthermore, although we proposed that maslinic acid treatment may alleviate glutamate-induced neurotoxicity by increasing astrocytic glutamate clearance, hypothetically, possible release of gliaderived trophic factors, which induced by maslinic acid exposure may also lead to the neuroprotection. To support the concept that targeting astrocyte is an effective neuroprotective strategy, future studies are necessary to test this hypothesis in in vitro as well as in vivo models and we are currently pursuing these studies in our laboratory. Acknowledgements This work was supported by the National Natural Science Foundation of China (grants 30672523 and 90713037) and research grants from the Chinese Ministry of Education (grants 706030 and 20050316008). We would like to thank Xiaolin Wang and Jun Yan for their skilled technical assistance with real-time PCR and immunocytochemistry. References Anderson, C.M., Swanson, R.A., 2000. Astrocyte glutamate transport: review of properties, regulation, and physiological functions. Glia 32, 1–14. Beal, M.F., 1995. Aging, energy, and oxidative stress in neurodegenerative diseases. Ann. Neurol. 38, 357–366. Dienel, G.A., Hertz, L., 2005. Astrocytic contributions to bioenergetics of cerebral ischemia. Glia 50, 362–388. Dunlop, J., 2006. Glutamate-based therapeutic approaches: targeting the glutamate transport system. Curr. Opin. Pharmacol. 6, 103–107. Fattorini, G., Melone, M., Bragina, L., Candiracci, C., Cozzi, A., Pellegrini Giampietro, D.E., Torres-Ramos, M., Perez-Samartin, A., Matute, C., Conti, F., 2008. GLT-1 expression and Glu uptake in rat cerebral cortex are increased by phencyclidine. Glia 56, 1320–1327. Guan, T., Li, Y., Sun, H., Tang, X., Qian, Y., 2009. Effects of maslinic acid, a natural triterpene, on glycogen metabolism in cultured cortical astrocytes. Planta Med. 75, 1141–1143. Juan, M.E., Planas, J.M., Ruiz-Gutierrez, V., Daniel, H., Wenzel, U., 2008. Antiproliferative and apoptosis-inducing effects of maslinic and oleanolic acids, two pentacyclic triterpenes from olives, on HT-29 colon cancer cells. Br. J. Nutr. 100, 36–43. Kaech, S., Banker, G., 2006. Culturing hippocampal neurons. Nat. Protoc. 1, 2406–2415.
65
Li, L.B., Toan, S.V., Zelenaia, O., Watson, D.J., Wolfe, J.H., Rothstein, J.D., Robinson, M.B., 2006. Regulation of astrocytic glutamate transporter expression by Akt: evidence for a selective transcriptional effect on the GLT-1/EAAT2 subtype. J. Neurochem. 97, 759–771. Liu, J., Sun, H., Duan, W., Mu, D., Zhang, L., 2007. Maslinic acid reduces blood glucose in KK-Ay mice. Biol. Pharm. Bull. 30, 2075–2078. Lizasoain, I., Cardenas, A., Hurtado, O., Romera, C., Mallolas, J., Lorenzo, P., Castillo, J., Moro, M.A., 2006. Targets of cytoprotection in acute ischemic stroke: present and future. Cerebrovasc. Dis. 21 (Suppl 2), 1–8. Lucas, S.M., Rothwell, N.J., Gibson, R.M., 2006. The role of inflammation in CNS injury and disease. Br. J. Pharmacol. 147 (Suppl 1), S232–S240. Marquez Martin, A., de la Puerta Vazquez, R., Fernandez-Arche, A., Ruiz-Gutierrez, V., 2006. Supressive effect of maslinic acid from pomace olive oil on oxidative stress and cytokine production in stimulated murine macrophages. Free Radic. Res. 40, 295–302. McCarthy, K.D., de Vellis, J., 1980. Preparation of separate astroglial and oligodendroglial cell cultures from rat cerebral tissue. J. Cell Biol. 85, 890–902. Mendes-de-Aguiar, C.B., Alchini, R., Decker, H., Alvarez-Silva, M., Tasca, C.I., Trentin, A.G., 2008. Thyroid hormone increases astrocytic glutamate uptake and protects astrocytes and neurons against glutamate toxicity. J. Neurosci. Res. 86, 3117–3125. Montilla, M.P., Agil, A., Navarro, M.C., Jimenez, M.I., Garcia-Granados, A., Parra, A., Cabo, M.M., 2003. Antioxidant activity of maslinic acid, a triterpene derivative obtained from Olea europaea. Planta Med. 69, 472–474. Mori, T., Tateishi, N., Kagamiishi, Y., Shimoda, T., Satoh, S., Ono, S., Katsube, N., Asano, T., 2004. Attenuation of a delayed increase in the extracellular glutamate level in the peri-infarct area following focal cerebral ischemia by a novel agent ONO-2506. Neurochem. Int. 45, 381–387. Parra, A., Rivas, F., Lopez, P.E., Garcia-Granados, A., Martinez, A., Albericio, F., Marquez, N., Munoz, E., 2009. Solution- and solid-phase synthesis and anti-HIV activity of maslinic acid derivatives containing amino acids and peptides. Bioorg. Med. Chem. 17, 1139–1145. Pawlak, J., Brito, V., Kuppers, E., Beyer, C., 2005. Regulation of glutamate transporter GLAST and GLT-1 expression in astrocytes by estrogen. Brain Res. Mol. Brain Res. 138, 1–7. Rossi, D.J., Brady, J.D., Mohr, C., 2007. Astrocyte metabolism and signaling during brain ischemia. Nat. Neurosci. 10, 1377–1386. Rothstein, J.D., Dykes-Hoberg, M., Pardo, C.A., Bristol, L.A., Jin, L., Kuncl, R.W., Kanai, Y., Hediger, M.A., Wang, Y., Schielke, J.P., Welty, D.F., 1996. Knockout of glutamate transporters reveals a major role for astroglial transport in excitotoxicity and clearance of glutamate. Neuron 16, 675–686. Rothstein, J.D., Patel, S., Regan, M.R., Haenggeli, C., Huang, Y.H., Bergles, D.E., Jin, L., Dykes Hoberg, M., Vidensky, S., Chung, D.S., Toan, S.V., Bruijn, L.I., Su, Z.Z., Gupta, P., Fisher, P.B., 2005. Beta-lactam antibiotics offer neuroprotection by increasing glutamate transporter expression. Nature 433, 73–77. Sims, K.D., Robinson, M.B., 1999. Expression patterns and regulation of glutamate transporters in the developing and adult nervous system. Crit. Rev. Neurobiol. 13, 169–197.