Astrocytic phospholipase A2 contributes to neuronal glutamate toxicity

brain research 1590 (2014) 97–106

Available online at www.sciencedirect.com

www.elsevier.com/locate/brainres

Research Report

Astrocytic phospholipase A2 contributes to neuronal glutamate toxicity Jong Seong Ha, So Hee Dho, Tae Hyun Youm, Ki-Sun Kwon, Sung Sup Parkn Aging Intervention Research Center, Korea Research Institute of Bioscience and Biotechnology (KRIBB), 125 Gwahak-ro, Yuseong-gu, Daejeon 305-806, Republic of Korea

art i cle i nfo

ab st rac t

Article history:

The role of astrocytes in glutamate toxicity has been controversial. Here, we show that

Accepted 10 October 2014

astrocytes in neuron–astrocyte co-cultures increased neuronal sensitivity to chronic

Available online 18 October 2014

glutamate exposure but not to acute exposure. Enhanced neuronal toxicity by chronic exposure was dependent on astrocyte cell numbers. A reduced generation of extracellular

Keywords: Chronic glutamate toxicity Pure neuron culture Neuron–astrocyte co-culture Phospholipase A2 (PLA2)

H2O2 induced by glutamate was observed in co-cultures. Further, neuronal glutamate toxicity was not suppressed by NADPH oxidase (Nox) inhibitors, catalase or Nox4 knockdown in co-cultures, whereas these compounds effectively reduced the toxicity in pure neuron cultures. Instead, the intracellular scavenger of reactive oxygen species, Nacetylcysteine (NAC), reduced neuronal cytotoxicity in co-cultures, whereas catalase worked in pure neuron cultures. Lipoxygenase (LOX) inhibitors attenuated neuronal glutamate toxicity in co-cultures but not in pure neuron cultures. Neuronal 5-LOX activity was increased only in co-cultures, whereas 12-LOX activity was increased in both types of cultures. The cyclooxygenase (COX) inhibitors, indomethacin and NS-398, and the phospholipase A2 (PLA2) inhibitors, LY311727 and MAFP, more effectively reduced neuronal glutamate toxicity in co-cultures than in pure neuron cultures. However, in co-cultures, pre-treating neurons and astrocytes with the same inhibitors generated opposite results. COX inhibitors suppressed neuronal glutamate toxicity in pre-treated neurons rather than astrocytes, whereas PLA2 inhibitors reduced the toxicity in pre-treated astrocytes rather than neurons. Gene-specific knockdown of PLA2 confirmed these results. Knockdown of cPLA2α and/or sPLA2-V in astrocytes rather than in neurons more effectively reduced glutamate toxicity in co-cultures. These findings suggest that astrocytic PLA2 activity increases neuronal sensitivity to chronic glutamate exposure in neuron–astrocyte cocultures. & 2014 Elsevier B.V. All rights reserved.

Abbreviations: DPI, siRNA,

diphenyleneiodonium; NAC,

small interfering RNAs; AA,

N-acetylcysteine; H2O2,

arachidonic acid; LOX,

LTB4, leukotriene B4; 12(S)-HETE, 12(S)-hydroxyeicosatetraenoic acid; MAFP, n Corresponding author. E-mail address: [email protected] (S.S. Park). http://dx.doi.org/10.1016/j.brainres.2014.10.015 0006-8993/& 2014 Elsevier B.V. All rights reserved.

hydrogen peroxide; LDH,

lipoxygenase; COX,

cyclooxygenase; PLA2,

lactate dehydrogenase;

phospholipase A2;

methyl arachidonyl fluorophosphonate

98

1.

brain research 1590 (2014) 97–106

Introduction

Altered glutamatergic neurotransmission has been implicated in the pathogenesis of chronic neurodegenerative diseases (Coyle and Schwarcz, 1976; McGeer and McGeer, 1976). Glutamate toxicity produces neuronal cell death primarily through the excessive activation of glutamate receptors (Coyle and Puttfarcken, 1993; Kinouchi et al., 1991; Monyer et al., 1990). In excitotoxicity, glutamate receptor activation triggers massive Ca2þ influx into neurons. Ca2þloaded mitochondria generate ROS containing superoxide (Lafon-Cazal et al., 1993) and nitric oxide (Dawson et al., 1992). In contrast, neurotoxicity mediated by N-methyl-Daspartate (NMDA) and non-NMDA glutamate receptor agonists has been observed in cortical neuron cultures following prolonged treatment (Dugan et al., 1995; Koh et al., 1990). However, neurotoxicity through chronic glutamate exposure (chronic toxicity) has been considered a slow variant of excitotoxicity (acute toxicity) because of their similar sensitivities to glutamate and receptor-specific agonists. Recently, chronic toxicity has been distinguished from acute toxicity based on extracellular H2O2 generation in pure cultures of mature primary neurons (Ha et al., 2010). The various functions of astrocytes in neuron–astrocyte interactions, including glutamate uptake, glutamine release, Kþ and Hþ buffering, and water transport, influence neuronal damage and other brain insults (Chen and Swanson, 2003). However, although astrocytes protect neurons from excitotoxicity by removing excessive neurotransmitters from the extracellular space (Maragakis et al., 2004; Rosenberg et al., 1992), the effects of astrocytes on chronic glutamate toxicity are not clear. Arachidonic acid (AA) is an important mediator of cellular signaling and is a component of cellular membranes. Stimulated cells express several forms of phospholipase A2 (PLA2), which appear to be crucial enzymes involved in the selective release of AA from membrane phospholipids (Murakami

et al., 1999). The metabolism of AA to prostaglandins, thromboxanes, leukotrienes, and epoxy fatty acids is coupled to specific terminal synthases, which include cyclooxygenase (COX), lipoxygenase (LOX), and cytochrome P450 epoxygenase (Bosetti, 2007). Altered AA metabolism in the brain has been implicated in various neurological and neurodegenerative disorders (Phillis and O'Regan, 2003; Teismann et al., 2003). We previously demonstrated that in pure neuron cultures, chronic and acute glutamate toxicity are significantly different in terms of their dependence on cell density, their activation of metabotropic glutamate receptors, and their kinetics of toxicity (Ha et al., 2009). Chronic toxicity is associated with the production of extracellular H2O2, which is dependent on NADPH oxidase (Nox) expression (Ha et al., 2010). Here, we show that neuronal sensitivity to chronic glutamate exposure, but not acute exposure, is increased in the presence of astrocytes. We investigate the differences between pure neuron cultures and astrocyte–neuron cocultures in chronic glutamate toxicity and evaluate the effects of astrocytes on neuronal toxicity during chronic glutamate exposure.

2.

Results

2.1. Neuron–astrocyte co-cultures increase neuronal sensitivity to chronic glutamate exposure Neuron–astrocyte co-cultures were generated by plating pure neurons in the wells of a 96-well plate and astrocytes in the culture strip inserts. To assess the effects of astrocytes on chronic glutamate toxicity, we measured neuronal cytotoxicity after the neuron–astrocyte co-cultures were treated with glutamate for 24 h. Neurons (1  105 cells/well) cultured with astrocytes (3  103 cells/well) revealed increased sensitivity to glutamate exposure (Fig. 1A). Compared with pure neuron cultures, neuronal cytotoxicity was significantly increased in the presence of astrocytes for all glutamate concentrations

Fig. 1 – Astrocytes increase neuronal sensitivity to chronic, rather than acute, glutamate exposure. Neurons (1  105 cells) in 96-well plates were co-cultured with astrocytes (3000 cells) in strip inserts. Co-cultures were treated with glutamate at the indicated concentrations for 24 h (A) or 15 min (B). Neuronal toxicity was determined 24 h later by measuring released LDH. Cytotoxicity is expressed as the percentage of LDH released relative to the amount of LDH released by neurons (without astrocytes) treated with lysis buffer (n ¼6–12). #po0.001 versus pure neuron cultures treated with each concentration of glutamate.

brain research 1590 (2014) 97–106

within the test range (excluding 100 μM). In contrast to chronic toxicity, acute toxicity (excitotoxicity) was induced by a brief exposure (15 min) to glutamate, followed by 24 h of incubation with the original culture medium. Acute glutamate toxicity in the presence of astrocytes was lower than that in the absence of astrocytes (Fig. 1B). A similar result was obtained in neurons overlaid with astrocyte-coated dialysis membranes: neurons co-cultured with astrocytes were more resistant to glutamate toxicity during the 20 min glutamate exposure than neurons without astrocytes (Chen et al., 2001). These observations show that astrocytes increase neuronal sensitivity to chronic glutamate exposure as opposed to acute exposure. To evaluate the astrocytic death induced by glutamate in co-cultures, we measured the cytotoxicity of astrocytes alone after astrocytes in the culture strip inserts were exposed to various concentrations of glutamate for 24 h. Astrocytic toxicity was not induced by glutamate concentrations below 2 mM

99

(Fig. 2A). To further assess whether cytotoxicity measurements in co-cultures included astrocytic death, we analyzed astrocytic survival after astrocytes with neurons (co-cultures) and astrocytes alone were treated with glutamate for 24 h. Astrocytic death was not observed with a chronic exposure of up to 100 μM glutamate in both types of cultures (Fig. 2B). These results indicate that the LDH released due to chronic glutamate exposure in co-cultures (Fig. 1A) was not derived from astrocytes but from neurons. To further investigate the role of astrocytes in the neuronal sensitivity to glutamate, we assessed cytotoxicity after the neurons were treated with various concentrations of glutamate for 24 h in the presence of the indicated numbers of astrocytes. Neuronal cytotoxicity increased depending on the number of astrocytes present (Fig. 2C). The cytotoxicity induced by 20 μM glutamate in the presence of 3000 astrocytes was similar to the cytotoxicity induced by 100 μM glutamate alone. The neuronal viability was confirmed using a cell counting assay (Fig. 2D). These

Fig. 2 – Glutamate sensitivity depends on astrocyte cell number. (A) Astrocytic glutamate toxicity was determined by measuring released LDH after astrocytes (3000 cells) were exposed to glutamate for 24 h (n ¼ 6). Astrocytic glutamate toxicity is expressed as a percentage of LDH released relative to the LDH released by astrocytes treated with lysis buffer. (B) Astrocyte survival was analyzed using the cellular LDH released by survived astrocytes treated with lysis buffer after astrocytes (3000 cells) were treated with glutamate for 24 h in the presence or absence of neurons (1  105 cells). Data are expressed as the percentage of LDH released relative to the LDH released by controls treated with PBS (n¼ 6). (C) Neuronal cultures (1  105 cells) were treated with glutamate for 24 h in the presence of the indicated numbers of astrocytes in culture strip inserts. Cytotoxicity was determined by measuring released LDH and is expressed as the percentage of LDH released relative to controls treated with lysis buffer (n ¼ 6). (D) Neurons were plated (5  105 cells/well) in 24-well plates, and the indicated number of astrocytes were co-cultured in 24-well culture strips. The co-cultures were treated with glutamate for 24 h and neuronal cell viability was measured using CCK-8 assay after culture strips containing astrocytes were removed. Cell viability is expressed as the percentage of survival neurons relative to control neurons alone treated with PBS (n¼ 6).

100

brain research 1590 (2014) 97–106

results show that higher numbers of astrocytes increase neuronal sensitivity to chronic glutamate exposure in co-cultures.

2.2. Chronic glutamate toxicity in co-cultures is not dependent on extracellular H2O2 Chronic glutamate toxicity in pure neuron cultures depends on Nox4 expression (Ha et al., 2010). Nox4-derived extracellular rather than intracellular H2O2 largely contributes to neuronal cytotoxicity in chronic glutamate exposure. We investigate whether extracellular H2O2 produced by Nox4 is involved in increased neuronal cytotoxicity in co-cultures. To first identify the involvement of Nox4 in co-cultures, we assessed chronic glutamate toxicity in the presence or absence of Nox inhibitors. Diphenyleneiodonium (DPI) at 20 μM and 50 μM glutamate slightly reduced cytotoxicity in co-cultures by 12.2% and 8.7%, respectively (Fig. 3A). However, DPI and apocynin reduced glutamate toxicity (50 μM) in pure neuron cultures by 61.2% and 61.3%, respectively. Complementary results were obtained from Nox4 knockdown: glutamate toxicity (50 μM) was reduced by 9.4% in co-cultures, whereas glutamate toxicity induced by 50 μM glutamate was decreased by 73.3% in pure neuron cultures

(Fig. 3B). When co-cultures subjected to glutamate toxicity (50 μM) were also treated with scavengers of ROS, catalase did not attenuate cytotoxicity, whereas NAC largely (by 46.3%) reduced glutamate toxicity (50 μM) in co-culture (Fig. 3C). We then measured the generation of extracellular H2O2 during chronic glutamate exposure in pure neuron cultures, astrocyte cultures, and co-cultures. H2O2 produced by glutamate for 6 h in pure neuron cultures increased in a concentration-dependent manner, consistent with previous observations (Ha et al., 2010). In contrast, the H2O2 levels in co-cultures treated with 50 and 100 μM glutamate reached approximately 43–44% of that generated by pure neuron cultures treated with 100 μM glutamate (Fig. 3D). Astrocytes produced very low levels of H2O2-less than 20% of that produced by pure neuron cultures treated with 100 μM glutamate. These results suggest that neuronal glutamate toxicity in co-cultures is dependent on intracellular ROS rather than extracellular H2O2 created by Nox4 in pure neuron cultures.

2.3.

Neuronal LOX activity is increased in co-cultures

AA has been shown to induce neuronal death through LOX (Kwon et al., 2005), and subsequent metabolism of AA by LOX

Fig. 3 – Neuronal glutamate toxicity in co-cultures is independent of extracellular H2O2. Pure neuron (1  105 cells) cultures and co-cultures (with 3000 astrocytes) were treated with glutamate (Glu) for 24 h in the presence of DPI (10 μM) or apocynin (10 μM) (A), NAC (10 mM) and/or catalase (1000 U/ml) (C). NAC pre-treatment lasted for 16 h before glutamate exposure. (B) Cultures were exposed to glutamate for 24 h after neurons were transfected with siRNA (10 nM) against Nox4 or scrambled siRNA (SC). Cytotoxicity was determined by measuring the LDH released over a 24 h period and is expressed as the percentage of LDH released relative to the LDH released by controls treated with lysis buffer (n¼ 8). nnpo0.01 and #po0.001 versus each concentration of control treated with PBS (A and C) or SC (B). (D) Glutamate-induced H2O2 accumulation in culture supernatants was measured after the cultures (1  105 neurons, 3000 astrocytes, and co-cultures) were exposed to glutamate for 6 h. Data represent H2O2 accumulation relative to control pure neuronal cultures treated with 100 μM glutamate (n ¼6). nn po0.01 and #po0.001 versus each concentration of co-culture.

brain research 1590 (2014) 97–106

and COX may generate intracellular ROS. We assessed neuronal toxicity after pure neuron cultures were simultaneously treated with various concentrations of glutamate and AA. AA induced neuronal toxicity in the absence of glutamate in a concentration-dependent manner and increased toxicity in the presence of glutamate (Fig. 4A). To investigate the contribution of LOX activity to glutamate toxicity in co-cultures, neuronal cytotoxicity was analyzed after the co-cultures were treated with varying amounts of glutamate in the presence of the LOX inhibitors AA861, baicalein, or zileuton. All of these inhibitors significantly reduced neuronal glutamate toxicity (20 and 50 μM) in the co-cultures, whereas none of the inhibitors attenuated glutamate toxicity in pure neuron cultures (Fig. 4B). These results reveal that LOX activity is involved in neuronal glutamate toxicity in co-cultures. To assess whether neuronal LOX activity was increased in the presence of astrocytes, we next measured the level of neuronal leukotriene B4 (LTB4) and 12(S)-HETE in the absence or presence (co-culture) of astrocytes after glutamate treatment. Astrocytic levels of LTB4 and 12(S)-HETE in co-cultures were excluded by the removal of culture inserts during measurements. Neuronal LTB4 levels were increased when the co-cultures were treated with 20 and 100 μM glutamate, whereas the increase was not observed when pure neuron cultures were treated with the same concentrations of

101

glutamate (Fig. 4C). The increase of LTB4 in astrocytes was negligible compared to that in co-cultures. Neuronal 12(S)HETE levels were increased in both the pure neuron cultures and the co-cultures (Fig. 4D). These results indicate that the increased activity of neuronal 5-LOX in the presence of astrocytes contributes to neuronal glutamate toxicity in cocultures.

2.4. Neuronal COX activity contributes to glutamate toxicity in co-cultures To assess the involvement of neuronal COX in glutamate sensitivity in co-culture, first we measured neuronal cytotoxicity after pure neuron cultures and co-cultures were treated with glutamate for 24 h in the presence of the COX inhibitors indomethacin and NS-398. Indomethacin (50 μM) reduced the neuronal toxicity induced by 100 μM glutamate by 27.5% in pure neuron cultures and attenuated the toxicity induced by 20 μM glutamate by 55.0% in the co-cultures (Fig. 5A). NS-398 (10 μM) reduced the neuronal toxicity induced by 100 μM glutamate by 17.0% in pure neuron cultures and attenuated the toxicity induced by 20 μM glutamate by 30.1% in the co-cultures (Fig. 5B). These results indicate that COX activity makes a larger contribution to neuronal glutamate toxicity in co-cultures than in pure

Fig. 4 – LOX inhibitors reduce neuronal cytotoxicity in co-cultures. (A) Neuronal cytotoxicity was determined by measuring the LDH released after neurons (1  105 cells) were treated with glutamate for 24 h in the presence of the indicated concentration of AA. Data are expressed as the percentage of LDH released relative to the LDH released by controls treated with lysis buffer (n ¼6). #po0.001. (B) Cytotoxicity was determined by measuring the LDH released after neuronal cultures (1  105 neurons) and co-cultures (1  105 neurons and 3000 astrocytes) were treated with glutamate (Glu) for 24 h in the presence of AA861 (10 μM), baicalein (10 μM), or zileuton (10 μM). Data are expressed as the percentage of LDH released relative to the LDH released by controls treated with lysis buffer (n ¼ 8). #po0.001 versus each concentration of control treated with DMSO. (C and D) Neuronal production of LTB4 (C) and 12(S)-HETE (D) were measured in pure neurons (PN, 1  105 neurons), astrocytes (3000 cells), and cocultures (CC, 1  105 neurons and 3000 astrocytes) using commercial kits as described in the Experimental Procedures. Cocultures were treated with glutamate for 2 or 6 h in the presence of AA861 (10 μM), baicalein (10 μM), or zileuton (10 μM) and the culture strip containing astrocytes was removed before measurements (n ¼4). npo0.05, nnpo0.01, and #po0.001.

102

brain research 1590 (2014) 97–106

Fig. 5 – COX inhibitors effectively reduce neuronal cytotoxicity in co-cultures. Neuronal cytotoxicity was determined by measuring the LDH released after pure neurons (PN, 1  105 neurons) and co-cultures (CC, 1  105 neurons and 3000 astrocytes) were treated with 100 μM and 20 μM glutamate (Glu), respectively, for 24 h in the presence of the indicated concentration of indomethacin (A) and NS-398 (B). Data are expressed as the percentage of LDH released relative to controls treated with lysis buffer (n ¼ 8). (C and D) Neurons or astrocytes were pre-incubated (Pre) with 50 μM indomethacin (C) or 10 μM NS-398 (D) for 60 min, and then co-cultures were exposed to 20 μM glutamate for 24 h. Cytotoxicity is expressed as the percentage of LDH released relative to the LDH released by controls treated with lysis buffer (n ¼ 6). npo0.05, nnnpo0.01, and # po0.001 versus controls treated with glutamate alone.

neuron cultures. We next investigated whether the COX activity of neurons or astrocytes was involved in neuronal glutamate toxicity. Neurons or astrocytes were pre-incubated with inhibitors for 60 min before the cells were washed with fresh Neurobasal medium. Co-cultures were then treated with 20 μM glutamate for 24 h. Neuronal cytotoxicity was reduced by 36.3% and 33.8% when pure neurons were preincubated with indomethacin (50 μM) and NS-398 (10 μM), respectively. In contrast, cytotoxicity was attenuated by 10.9% and 7.5% when the astrocytes were pre-incubated with indomethacin and NS-398, respectively (Fig. 5C and D). These results indicate that COX activity in neurons contributes to neuronal glutamate toxicity in co-cultures.

2.5. Astrocytic PLA2 activity contributes to neuronal glutamate toxicity in co-cultures The contribution of LOX and COX activity to glutamate toxicity, not in astrocytes but in neurons, in co-cultures suggests that astrocytic PLA2 activity may be involved in the increased sensitivity to glutamate observed in co-

cultures. We first measured neuronal cytotoxicity after pure neuron cultures and co-cultures were treated with glutamate for 24 h in the presence or absence of the PLA2 inhibitors LY311727 and MAFP. In pure neuron cultures, LY311727 (5 μM) and MAFP (1 μM) reduced the neuronal toxicity induced by 100 μM glutamate by 18.5% and 13.8%, respectively. In cocultures, they suppressed the glutamate toxicity (20 μM) by 29.2% and 32.1%, respectively (Fig. 6A and B). These results indicate that PLA2 activity makes a greater contribution to neuronal glutamate toxicity in co-cultures than in pure neuron cultures. We then assessed cytotoxicity in co-cultures after the PLA2 activity of neurons or astrocytes was suppressed. Neurons or astrocytes were pre-incubated with inhibitors for 60 min, and then the cells were washed with fresh medium. Co-cultures were then treated with 20 μM glutamate for 24 h. When astrocytes were pre-incubated with LY311727 (5 μM) and MAFP (1 μM), neuronal cytotoxicity was reduced by 19.2% and 24.8%, respectively, whereas cytotoxicity was not attenuated when neurons were pre-incubated with either of the inhibitors (Fig. 6C). More reduced cytotoxicity (by 42.2%) was observed when astrocytes were pre-incubated

brain research 1590 (2014) 97–106

103

Fig. 6 – Inhibition of astrocytic PLA2 reduces neuronal cytotoxicity in co-cultures. (A and B) Neuronal cytotoxicity was determined by measuring the LDH released after pure neurons (PN, 1  105 neurons) and co-cultures (CC, 1  105 neurons and 3000 astrocytes) were treated with glutamate (Glu) for 24 h in the presence of the indicated concentrations of LY311727 (A) and MAFP (B). Data are expressed as the percentage of LDH released relative to the LDH released by controls treated with lysis buffer (n ¼ 8). Cytotoxicity was induced by 100 μM glutamate (Glu) in pure neurons and 20 μM glutamate in co-cultures. Neurons or astrocytes were pre-incubated (Pre) with 5 μM LY311727 (LY) or 1 μM MAFP for 15 min, and then co-cultures were treated with 20 μM glutamate for 24 h (C). Neurons or astrocytes were treated with 10 nM of siRNA, and then co-cultures were treated with 20 μM glutamate for 24 h (D). Cytotoxicity is expressed as the percentage of LDH relative to the LDH released by controls treated with lysis buffer (n ¼6). #po0.001 versus controls (DMSO or SC) treated with glutamate. The transcript levels of cPLA2α and sPLA2-V were assessed (E) after cells were transfected with gene-specific siRNA. As a non-targeted control, cells were transfected with 10 nM scrambled siRNA duplexes (SC). The level of β-actin transcript was used as a control. (F) Gray intensity analysis of the electrophoresis bands (n ¼4). #po0.001 versus each control (0 nM siRNA).

with both inhibitors combined. Gene-specific knockdown (Fig. 6E and F) also supported these results. The knockdown of cPLA2α in astrocytes reduced neuronal cytotoxicity by 23.3%, knocking down sPLA2-V reduced it by 26.3%, and their double knockdown suppressed it by 35.0% (Fig. 6D). However, silencing the same genes in neurons resulted in only slightly reduced cytotoxicity compared to control knockdown cells (SC). These results indicate that astrocytic PLA2 activity contributes to increased neuronal sensitivity to glutamate in cocultures.

3.

Discussion

The neuroprotective role of astrocytes in glutamate toxicity has been reported. During 20 min glutamate exposures, neurons co-cultured with astrocytes are more resistant to glutamate toxicity than neurons without astrocytes (Chen et al., 2001). The activation of astrocytes with cytosine arabinoside (AraC) has resulted in similar protective effects during brief (1 h) glutamate exposures (Ahlemeyer et al., 2002). Although the

treatment of hippocampal cultures with AraC from 2 to 4 DIV caused an increase in glutamate-induced neurotoxicity, astrocytes might have been protective against glutamate toxicity because the percentage of astrocytes in vehicle-treated cultures was higher than in AraC-treated cultures. Glutamate clearance from the extracellular space may also protect neurons from glutamate toxicity through glutamate transporters (Maragakis et al., 2004) and glutamine synthetase (Zou et al., 2010). Astrocytes activated by AraC increase glutamate toxicity through the stimulation of protein kinase C (Ahlemeyer et al., 2002). However, increased neuronal sensitivity to glutamate has been observed in astrocyte-poor neuronal tissue cultures during both brief (30 min) and prolonged (18–24 h) exposures (Rosenberg and Aizenman, 1989; Rosenberg et al., 1992), when the number of non-neuronal cells was approximately 15 times greater in the astrocyte-rich cultures compared to the astrocyte-poor cultures. Using co-cultures of pure neurons with astrocytes, we showed different roles for astrocytes during glutamate toxicity: protective during acute (brief) exposure and detrimental during chronic (prolonged) exposure (Fig. 1A and B). In our

104

brain research 1590 (2014) 97–106

pure primary neuron cultures, astrocytes were eliminated after 14 DIV because primary neurons were obtained at embryonic day 14, treated with AraC, and cultured using serum-free Neurobasal medium (Ha et al., 2009). Cellular contact between neurons and astrocytes was not permitted in the co-cultures because of using the culture strip inserts. During chronic glutamate toxicity, co-cultures were not affected by the Nox4-dependent generation of extracellular H2O2 (Fig. 3A–D), which is a dominant cause of death in pure neuron cultures (Ha et al., 2010). It has been consistently shown that astrocytes protect neurons from H2O2 toxicity (Desagher et al., 1996). However, even though the level of extracellular H2O2 produced by glutamate is suppressed in cocultures (Fig. 3D), neuronal cytotoxicity is not reduced. The cytotoxicity is independent of the presence of catalase, a scavenger of extracellular H2O2 (Fig. 3C). Moreover, neuronal sensitivity to glutamate in co-cultures seemed to increase in a manner that depended on the number of astrocytes (Fig. 2C). This observation is a clear demonstration that neuronal sensitivity to chronic glutamate exposure is increased in the presence of astrocytes. AA is enriched in the central nervous system and is liberated from membrane lipids through the activation of PLA2 in response to various stimuli. Altered brain AA metabolism has been implicated in neurological disorders. Moreover, AA released from astrocytes (Moore et al., 1991) has been observed in cells after nervous tissue injury (Pawlas et al., 2009). The neurotoxic pathways of AA have been investigated in neuronal cell cultures (Kwon et al., 2005). Our results show that in pure neuron cultures, AA increased sensitivity to chronic glutamate exposure (Fig. 4A). Furthermore, the neuroprotective effects of LOX inhibitors were increased in co-cultures compared to pure neuron cultures (Fig. 4B). Neuronal 5-LOX activity was not increased in pure neuron cultures and was increased in co-cultures. Increased neuronal 5-LOX activity was reduced by AA861 and zileuton (Fig. 4C). We also compared the neuroprotective effects of COX inhibitors in pure neuron cultures versus co-cultures. Indomethacin and NS-398 were more effective in reducing cytotoxicity in co-cultures than in pure neuron cultures (Fig. 5A and B), similar to PLA2 inhibitors (Fig. 6A and B). The pre-incubation of neurons with COX inhibitors reduced glutamate toxicity in co-cultures (Fig. 5C and D). In contrast, the pre-incubation of astrocytes with PLA2 inhibitors reduced neuronal cytotoxicity in co-cultures, whereas pre-treating neurons with the PLA2 inhibitors did not reduce neurotoxicity (Fig. 6C). Furthermore, similar results were observed after the gene-specific knockdown of cPLA2α and sPLA2-V (Fig. 6D). The knockdown of cPLA2α and/or sPLA2-V in astrocytes more effectively reduced toxicity than knocking them down in neurons. Suppressing the expression of sPLA2-IIA, iPLA2β, and iPLA2γ did not have significant effects (data not shown). These results show that PLA2 activity in astrocytes contributes to neuronal glutamate toxicity. Although we did not observe the release of AA from astrocytes, the activation of astrocytic PLA2 in co-cultures may induce AA release into the medium, triggering an increase of neuronal LOX and COX activity and resulting in neuronal death. The neuronal production of extracellular H2O2 in response to chronic glutamate exposure might not

be involved in astrocytic PLA2 activation (Fig. 3A–D). Both cPLA2 activity and protein levels are significantly increased during the ischemic period (Saluja et al., 1997). The inhibition and overexpression of PLA2 activity in neuronal disorders has been investigated using knockout (Kennedy et al., 1995; Tabuchi et al., 2003) and transgenic (Grass et al., 1996) mice. Of interest, cPLA2α( / ) mice show a reduction in brain AA levels (Rosenberger et al., 2003) and in brain COX-2 mRNA and protein levels, indicating that cPLA2 and COX-2 are functionally coupled (Bosetti and Weerasinghe, 2003). All available data suggest that the pharmacological inhibition of cPLA2 may be promising for the treatment of neuroinflammation, ischemic brain damage, and possibly Parkinson's disease (Bosetti, 2007). In summary, in contrast to the neuroprotective role of astrocytes during acute glutamate toxicity, they increased neuronal sensitivity to chronic glutamate exposure. Astrocytes enhanced glutamate toxicity in a cell numberdependent manner. LOX, COX, and PLA2 inhibitors had a more protective effect in co-cultures than in pure neuronal cultures. 5-LOX activity was increased in co-cultures. In cocultures, the pre-incubation of neurons with COX inhibitors attenuated glutamate toxicity, whereas the pre-incubation of astrocytes with PLA2 inhibitors suppressed glutamate toxicity. Knocking down cPLA2α and sPLA2-V in astrocytes, but not in neurons, largely reduced glutamate toxicity. Accordingly, we conclude that astrocytic phospholipase A2 contributes to neuronal glutamate toxicity in co-cultures. The astrocytic PLA2 possibly induces neuronal LOX and COX activity via AA, resulting in neuronal cytotoxicity. These results imply that glutamate toxicity in the brain is complicated by the presence of glial cells.

4.

Experimental procedures

4.1.

Reagents

Glutamate, apocynin, N-acetylcysteine (NAC), catalase-agarose, AA-861, baicalein, zileuton, AA, poly-D-lysine, indomethacin, cytosine arabinoside (AraC), NS-398, LY311727, and methyl arachidonyl fluorophosphonate (MAFP) were purchased from Sigma-Aldrich (St. Louis, MO, USA). DPI was obtained from Calbiochem (La Jolla, CA, USA). Minimum essential medium (MEM), Dulbecco's modified eagle's medium (DMEM), Neurobasal medium, B-27 supplement minus AO, Hank's balanced salt solution (HBSS), fetal bovine serum (FBS), scrambled siRNA, and laminin were purchased from Invitrogen (Carlsbad, CA, USA).

4.2.

Mouse primary cell cultures

Primary cortical neuron cultures were prepared from albino ICR mice (Daehan, Daejeon, Korea) at E15 as previously described (Ha et al., 2009). After dissociation, the neurons were plated at a density of 1  105 cells/well on 96-well plates (Nunc, Naperville, IL, USA) coated with laminin and poly-D-lysine. The cells were cultured in Neurobasal medium supplemented with B-27. To prevent the proliferation of non-neuronal cells, 10 μM AraC was added to the cultures 24 h after plating. One-third of

brain research 1590 (2014) 97–106

the culture medium was replaced with fresh medium without AraC every three days, and near-pure neuron cultures were used after 14–15 days in vitro (DIV) culture. Astrocyte cultures were prepared from primary mixed glial cell cultures of newborn ICR mice. Briefly, cortices were isolated and dissected in MEM containing 10% FBS, and astrocytes were purified using more than four repetitions of trypsinization and re-plating. Astrocyte-enriched cultures were maintained using DMEM supplemented with 10% FBS. These cultures contained more than 95% astrocytes, as determined by immunostaining with an anti-glial fibrillary acidic protein (GFAP) antibody (Abcam, Cambridge, MA, USA). Astrocytes in co-cultures were incubated using Neurobasal medium supplemented with B-27.

4.3.

Neuronal cell toxicity and viability assay

Neurons (1  105 cells) and astrocytes (3  103 cells) were cultured in 96-well plates and 8-well culture strip inserts, respectively. To evaluate chronic toxicity, the cells were treated with glutamate for 24 h. To study acute toxicity, the cells were exposed to glutamate for 15 min in HBSS at room temperature, after which they were incubated in the original culture medium for 24 h (Schubert and Piasecki, 2001). All drugs were added simultaneously with glutamate (unless otherwise indicated), and the same volume of vehicle was added to controls. To determine cytotoxicity, the cellular release of lactate dehydrogenase (LDH) into the culture medium for 24 h was measured using a commercial assay kit (Promega, Madison, WI, USA) according to the manufacturer's protocol. The data represent the percentage of LDH released relative to a control treated with lysis buffer. To analyze cell survival, a total cell number assay was performed using the same kit. The values are presented relative to the vehicle-treated controls. The viability of neurons was also observed by charting the growth curve using Cell Counting Kit-8 (CCK-8, Dojindo Molecular Technologies, Kumamoto, Japan). Neurons were plated (5  105 cells/well) in 24-well plates and astrocytes (2.5  104–2.5  105 cells/well) were cultured in cell culture inserts for 24-well plates (Falcon). The cocultures were treated with glutamate for 24 h and culture strips containing astrocytes were removed. Neurons were treated with CCK-8, and then incubated at 37 1C for 4 h. The absorbance was measured at 450 nm using a microtiter plate reader (Synergy, BioTek, Winooski, USA).

4.4.

Measurement of LOX activity

To evaluate neuronal LOX activity, neurons (5  106 per well in 6-well plates) were cultured in the presence or absence of astrocytes (1  104 in 6-well strip inserts; BD Falcon, Bedford, MA, USA). After cultures were treated with glutamate (20 or 100 μM) for indicated periods, we measured the amount of leukotriene B4 (LTB4) synthesized in neuronal cells using an LTB4 EIA kit (Cayman Chemical, Ann Arbor, MI, USA) according to the manufacturer's instructions. To determine 12-LOX activity in neurons, we used a 12(S)-HETE ELISA kit (Enzo Life Sciences, Farmingdale, NY, USA). In the case of co-cultures, the 6-well strip inserts containing astrocytes were removed before the assay.

4.5.

105

Extracellular H2O2 measurement

To measure H2O2 released into the medium, we used the Amplex Reds Hydrogen Peroxide Assay kit (Invitrogen) with slight modifications (Ha et al., 2010). Briefly, neuronal cells (1  105 cells/well) were cultured in 96-well plates and exposed to either glutamate alone or glutamate plus the indicated inhibitors, for 6 h in 100 μl of Krebs-Ringer phosphate buffer (KRPG; containing 145 mM NaCl, 5.7 mM sodium phosphate, 4.9 mM KCl, 0.5 mM CaCl2, 1.2 mM MgSO4, and 5.5 mM glucose, pH 7.3). Next, 50 μl of culture buffer was transferred to 50 μl of KRPG containing 50 μM Amplex Red reagent and 0.2 U/ml horseradish peroxidase. After 10 min at room temperature, fluorescence was measured using a Fusion α microplate fluorometer (PerkinElmer, Santa Clara, CA, USA) with excitation at 545 nm and detection at 590 nm. Background fluorescence was subtracted from each value. The data represent the percentage of H2O2 accumulation relative to cultures incubated in the presence of glutamate alone.

4.6.

Knockdown of expression using siRNA

The transfection of siRNA into neurons was performed using 10 nM siRNA and Lipofectamine 2000 according to the manufacturer's (Invitrogen) protocol (Ha et al., 2010). siRNAs corresponding to murine Nox4 27-51 (GGCCAACGAAGGGGUUAA ACACCUC), sPLA2-IIA 356-374 (GUUUCGCCCGGAACAAGAATT), sPLA2-V 295-314 (AUCUGCCGAACACGACUCCCU), cPLA2α 12811300 (CCCUGAGUAGUUUGAAGGAAA), iPLA2β 123-146 (AAGGGCAGCUGAUCCUGUUACAGAA), and iPLA2γ 1652-1676 (CGCAUGUCCUAAGGUAGCUGCUAUA) were used. Six hours after transfection, the medium was replaced with fresh medium. Then, the cells were cultured for 24 h before being exposed to glutamate. Cytotoxicity was analyzed 24 h after glutamate treatment. Stealth RNAi negative control duplexes (SC, scrambled siRNA, Invitrogen) were used as a control.

4.7.

RNA isolation and semiquantitative RT-PCR

Total RNA was isolated from neurons or astrocytes 1 d after transfection using TRIzol (Invitrogen) according to the manufacturer's protocol. 5 μg of total RNA was used for firststrand cDNA synthesis with a first strand synthesis kit (Invitrogen). For RT-PCR, specific primers for cPLA2α (forward primer: 50 -ACAGCAAAGCACATCGTGAG, reverse primer: 50 CGTCCTTCTCGGGTATTGAA), sPLA2-V (forward primer: 50 GGCTTCTACGGCTGCTACTG, reverse primer: 50 -AAGGAGTC GTGTTCGCAGAT), and β-actin (forward primer: 50 -CTAGGCACCAGGGTGTGATG, reverse primer: 50 -GGGGTACTTCAGG GTCAGGA) were used. PCR was performed with Platinum Taq DNA polymerase (Invitrogen) using the following parameters: an initial 5 min denaturation step at 95 1C followed by 35 cycles of 94 1C, 62 1C, and 30 sec of 72 1C at each step and a final 10 min extension at 72 1C. The PCR-amplified (40 cycles) fragments were separated on 2% agarose gels (Invitrogen) and identified by sequencing. β-Actin was amplified as a control.

106

4.8.

brain research 1590 (2014) 97–106

Statistical analysis

Quantitative data are expressed as the means7SD. Student's t-test and ANOVA with post hoc tests were used for pairwise comparison and multicomparisons, respectively. Probability values of po0.05 were considered to be significant.

Acknowledgments This research was supported by a Grant from the KRIBB Research Initiative Program and a Biomedical Technology Development Program 20120009082.

references

Ahlemeyer, B., Kolker, S., Zhu, Y., Hoffmann, G.F., Krieglstein, J., 2002. Increase in glutamate-induced neurotoxicity by activated astrocytes involves stimulation of protein kinase C. J. Neurochem. 82, 504–515. Bosetti, F., Weerasinghe, G.R., 2003. The expression of brain cyclooxygenase-2 is down-regulated in the cytosolic phospholipase A2 knockout mouse. J. Neurochem. 87, 1471–1477. Bosetti, F., 2007. Arachidonic acid metabolism in brain physiology and pathology: lessons from genetically altered mouse models. J. Neurochem. 102, 577–586. Chen, Y., Vartiainen, N.E., Ying, W., Chan, P.H., Koistinaho, J., Swanson, R.A., 2001. Astrocytes protect neurons from nitric oxide toxicity by a glutathione-dependent mechanism. J. Neurochem. 77, 1601–1610. Chen, Y., Swanson, R.A., 2003. Astrocytes and brain injury. J. Cereb. Blood Flow Metab. 23, 137–149. Coyle, J.T., Schwarcz, R., 1976. Lesion of striatal neurones with kainic acid provides a model for Huntington’s chorea. Nature 263, 244–246. Coyle, J.T., Puttfarcken, P., 1993. Oxidative stress, glutamate, and neurodegenerative disorders. Science 262, 689–695. Dawson, T.M., Dawson, V.L., Snyder, S.H., 1992. A novel neuronal messenger molecule in brain: the free radical, nitric oxide. Ann. Neurol. 32, 297–311. Desagher, S., Glowinski, J., Premont, J., 1996. Astrocytes protect neurons from hydrogen peroxide toxicity. J. Neurosci. 16, 2553–2562. Dugan, L.L., Bruno, V.M., Amagasu, S.M., Giffard, R.G., 1995. Glia modulate the response of murine cortical neurons to excitotoxicity: glia exacerbate AMPA neurotoxicity. J. Neurosci. 15, 4545–4555. Grass, D.S., Felkner, R.H., Chiang, M.Y., Wallace, R.E., Nevalainen, T.J., Bennett, C.F., Swanson, M.E., 1996. Expression of human group II PLA2 in transgenic mice results in epidermal hyperplasia in the absence of inflammatory infiltrate. J. Clin. Investig. 97, 2233–2241. Ha, J.S., Lee, C.S., Maeng, J.S., Kwon, K.S., Park, S.S., 2009. Chronic glutamate toxicity in mouse cortical neuron culture. Brain Res. 1273, 138–143. Ha, J.S., Lee, J.E., Lee, J.R., Lee, C.S., Maeng, J.S., Bae, Y.S., Kwon, K. S., Park, S.S., 2010. Nox4-dependent H2O2 production contributes to chronic glutamate toxicity in primary cortical neurons. Exp. Cell Res. 316, 1651–1661. Kennedy, B.P., Payette, P., Mudgett, J., Vadas, P., Pruzanski, W., Kwan, M., Tang, C., Rancourt, D.E., Cromlish, W.A., 1995. A natural disruption of the secretory group II phospholipase A2 gene in inbred mouse strains. J. Biol. Chem. 270, 22378–22385.

Kinouchi, H., Epstein, C.J., Mizui, T., Carlson, E., Chen, S.F., Chan, P.H., 1991. Attenuation of focal cerebral ischemic injury in transgenic mice overexpressing CuZn superoxide dismutase. Proc. Natl. Acad. Sci. USA 88, 11158–11162. Koh, J.Y., Goldberg, M.P., Hartley, D.M., Choi, D.W., 1990. NonNMDA receptor-mediated neurotoxicity in cortical culture. J. Neurosci.: Off. J. Soc. Neurosci. 10, 693–705. Kwon, K.J., Jung, Y.S., Lee, S.H., Moon, C.H., Baik, E.J., 2005. Arachidonic acid induces neuronal death through lipoxygenase and cytochrome P450 rather than cyclooxygenase. J. Neurosci. Res. 81, 73–84. Lafon-Cazal, M., Pietri, S., Culcasi, M., Bockaert, J., 1993. NMDAdependent superoxide production and neurotoxicity. Nature 364, 535–537. Maragakis, N.J., Dykes-Hoberg, M., Rothstein, J.D., 2004. Altered expression of the glutamate transporter EAAT2b in neurological disease. Ann. Neurol. 55, 469–477. McGeer, E.G., McGeer, P.L., 1976. Duplication of biochemical changes of Huntington’s chorea by intrastriatal injections of glutamic and kainic acids. Nature 263, 517–519. Monyer, H., Hartley, D.M., Choi, D.W., 1990. 21-Aminosteroids attenuate excitotoxic neuronal injury in cortical cell cultures. Neuron 5, 121–126. Moore, S.A., Yoder, E., Murphy, S., Dutton, G.R., Spector, A.A., 1991. Astrocytes, not neurons, produce docosahexaenoic acid (22:6 omega-3) and arachidonic acid (20:4 omega-6). J. Neurochem. 56, 518–524. Murakami, M., Kambe, T., Shimbara, S., Kudo, I., 1999. Functional coupling between various phospholipase A2s and cyclooxygenases in immediate and delayed prostanoid biosynthetic pathways. J. Biol. Chem. 274, 3103–3115. Pawlas, N., Nierwinska, K., Stolecka, A., Gabryel, B., Pudelko, A., Malecki, A., 2009. Effects of N-acetylcysteine and ebselen on arachidonic acid release from astrocytes and neurons cultured in normoxic or simulated ischemic conditions. Pharmacol. Rep. 61, 941–946. Phillis, J.W., O’Regan, M.H., 2003. The role of phospholipases, cyclooxygenases, and lipoxygenases in cerebral ischemic/ traumatic injuries. Crit. Rev. Neurobiol. 15, 61–90. Rosenberg, P.A., Aizenman, E., 1989. Hundred-fold increase in neuronal vulnerability to glutamate toxicity in astrocyte-poor cultures of rat cerebral cortex. Neurosci. Lett. 103, 162–168. Rosenberg, P.A., Amin, S., Leitner, M., 1992. Glutamate uptake disguises neurotoxic potency of glutamate agonists in cerebral cortex in dissociated cell culture. J. Neurosci.: Off. J. Soc. Neurosci. 12, 56–61. Rosenberger, T.A., Villacreses, N.E., Contreras, M.A., Bonventre, J. V., Rapoport, S.I., 2003. Brain lipid metabolism in the cPLA2 knockout mouse. J. Lipid Res. 44, 109–117. Saluja, I., Song, D., O’Regan, M.H., Phillis, J.W., 1997. Role of phospholipase A2 in the release of free fatty acids during ischemia-reperfusion in the rat cerebral cortex. Neurosci. Lett. 233, 97–100. Schubert, D., Piasecki, D., 2001. Oxidative glutamate toxicity can be a component of the excitotoxicity cascade. J. Neurosci. 21, 7455–7462. Tabuchi, S., Uozumi, N., Ishii, S., Shimizu, Y., Watanabe, T., Shimizu, T., 2003. Mice deficient in cytosolic phospholipase A2 are less susceptible to cerebral ischemia/reperfusion injury. Acta Neurochir. Suppl. 86, 169–172. Teismann, P., Tieu, K., Choi, D.K., Wu, D.C., Naini, A., Hunot, S., Vila, M., Jackson-Lewis, V., Przedborski, S., 2003. Cyclooxygenase-2 is instrumental in Parkinson’s disease neurodegeneration. Proc. Natl. Acad. Sci. USA 100, 5473–5478. Zou, J., Wang, Y.X., Dou, F.F., Lu, H.Z., Ma, Z.W., Lu, P.H., Xu, X.M., 2010. Glutamine synthetase down-regulation reduces astrocyte protection against glutamate excitotoxicity to neurons. Neurochem. Int. 56, 577–584.