6+ PCR and hybridization with fluorescence polarization assay of 15 human papillomavirus genotypes in clinical samples

Journal of Clinical Virology 44 (2009) 106–110

Contents lists available at ScienceDirect

Journal of Clinical Virology journal homepage: www.elsevier.com/locate/jcv

Asymmetric GP5+/6+ PCR and hybridization with fluorescence polarization assay of 15 human papillomavirus genotypes in clinical samples Zhang Ju a,∗ , Gao Yane b , Li Ding a , Yin Guowu c , Guo Yanhai a , Liu Yonglan a a b c

Institute of Gene Diagnosis, State Key Laboratory of Cancer Biology, Fourth Military Medical University, 17 Changle West Road, Xian, Shaanxi 710032, China Department of Gynecology, Xian Jiaotong University, Xian, Shaanxi, China Department of Gynecology, Tangdu Hospital, Fourth Military Medical University, Xian, Shaanxi, China

a r t i c l e

i n f o

Article history: Received 9 July 2008 Received in revised form 27 November 2008 Accepted 3 December 2008 Keywords: Human papillomavirus genotypes Asymmetric GP5+/6+ PCR Hybridization Fluorescence polarization

a b s t r a c t Background: The detection of a broad spectrum of HPV genotypes has not been used widely in cervical cancer screening due to technical difficulties and high costs. Objectives: To develop an asymmetric GP5+/6+ PCR assay and hybridization with a fluorescence polarization (FP) assay of 15 HPV genotypes. Study design: HPV genes in controls and samples were amplified by an asymmetric GP5+/6+ PCR. Fifteen HPV genotypic probes labeled with fluorophores hybridized with target PCR product to identify the presence of specific HPV genotypes. The HPV genotypes in samples were verified by sequence assay. Results: The genotypes determined with the hybridization and FP assay were confirmed by sequence analysis when a monotypic infection was evaluated. Conclusion: A simple, economical and specific HPV genotyping assay has been developed that will be adequate for cervical cancer screening programs. © 2008 Elsevier B.V. All rights reserved.

1. Introduction The detection of a broad spectrum HPV genotypes has implication for the primary screening of cervical cancer.1 The general-primer PCR assay enables the detection of a broad spectrum of HPV genotypes by single PCR as the primers anneal with a highly conserved region of HPV genotypes that spans a polymorphic inner region. The MY09/MY11 and the GP5+/6+ PCR systems are widely used general-primer PCR assays.2,3 HPV genotypes determination after a general-primer PCR assay is usually done by a hybridization assay. It takes more than 6 h to perform the classical hybridization assay, such as Southern hybridization or reverse line blot hybridization, because the separation of bound and free probe is necessary.4–6 The fluorescence polarization (FP) assay is a method that analyzes association between molecules in solution. Small fluorescent molecules have low FP values (millipolarization, mP), while large molecules have high FP values. FP detects changes in the molecular volume of a fluorophore that occur when the probe forms a hybrid with target DNA in solution. The increasing FP value indicates molecular association such as DNA–DNA hybridization. It

Abbreviations: HPV, human papillomavirus; PCR, polymerase chain reaction; millipolarization, mP, FP values; FP, fluorescence polarization. ∗ Corresponding author. Tel.: +86 29 83025956. E-mail address: [email protected] (Z. Ju). 1386-6532/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2008.12.003

takes much less time to perform FP assay because the separation of bound and free probes is unnecessary.7 Some FP-based methods for monitoring hybridization have used as diagnostic methods for the detection of particular genes.8,9 Here we develop a method using an asymmetric GP5+/6+ PCR and hybridization with FP assay to detect 15 HPV genotypes. Cervical scrapes and tissue specimens were used to evaluate this method on clinical samples. 2. Materials and methods 2.1. HPV plasmids and clinical samples Plasmids of HPVs (pHPVs) containing the L1\L2 region of HPV6, 11, 16, 18, 31, 33, 34, 35, 39, 42, 45, 51, 52, 56 and 58 were used to determine sensitivity and specificity of the method. These pHPVs were available and identified by sequence in previous studies performed in this laboratory and the National Institute for the Control of Pharmaceutical and Biological Products.10,11 Five hundred and sixty-four clinical samples were obtained from women attending cytological testing for cervical cancer screening in the Department of Gynecology of Tangdu Hospital, Fourth Military Medical University, and Department of Gynecology of Xian Jiaotong University. Informed consent was obtained from all patients and the protocols for this study were approved by the Human Research Protective Committee of Fourth Military Medical University.

Z. Ju et al. / Journal of Clinical Virology 44 (2009) 106–110 Table 1 HPV Genotypic Probes and Fluorescein labeled. Genotype group

Sequence probe(5 → 3 )

Fluorescence labeled

Probe 6 Probe 11 Probe 16 Probe 18 Probe 31 Probe 33 Probe 35 Probe 39 Probe 42 Probe 34 Probe 45 Probe 51 Probe 52 Probe 56 Probe 58

ATCCGTAACTACATCTTCCACATACACCAA ATCTGTGTCTAAATCTGCTACATACACTAA GTCATTATGTGCTGCCATATCTACTTCAGA TGCTTCTACACAGTCTCCTGTACCTGGGCA TGTTTGTGCTGCAATTGCAAACAGTGATAC TTTATGCACACAAGTAACTAGTGACAGTAC GTCTGTGTGTTCTGCTGTGTCTTCTAGTGA TCTACCTCTATAGAGTCTTCCATACCTTCT CTGCAACATCTGGTGATACATATACAGCTG TACACAATCCACAAGTACAAATGCACCATA ACACAAAATCCTGTGCCAAGTACATATGAC AGCACTGCCACTGCTGCGGTTTCCCCAACA TGCTGAGGTTAAAAAGGAAAGCACATATAA GTACTGCTACAGAACAGTTAAGTAAATATG ATTATGCACTGAAGTAACTAAGGAAGGTAC

-FAM -TAMRA -ROX -FAM -TAMRA -ROX -FAM -TAMRA -ROX -FAM -TAMRA -ROX -FAM -TAMRA -ROX

HPV genotype probes were designed by Jacobs.13 Three type-specific probes labeled respectively with FAM, TAMRA, ROX at 3 -end.

DNA was extracted as described.10 Twenty ␮l of the extract was used as template for PCR. To check the DNA quality, integrity, and the absence of nonspecific inhibitors, the samples were first prescreened by PCR using ␤-globin primers, resulting in a 268-bp product.12 2.2. Probes design and label Fifteen HPV type-specific probes were designed within the GP5+/GP6+ amplification polymorphism regions of L1 genes by Jacobs et al.13 A database search (BLAST from National Center for Biotechnology Information) of the 30-mer probe sequences revealed complete matches with their corresponding HPV genotypes. All probes were synthesized and labeled with fluorophores at the 3 -end by Invitrogen (Table 1, Shanghai, China). It was costeffective to use probes labeled at the 3 -end.14,15 2.3. Asymmetric GP5+/6+ PCR pHPVs (105 copies, each) were amplified as positive controls, and plasmids of pGEM-T-easy Vector (105 copies) were amplified as negative control. Asymmetric PCR products were detected more readily than symmetric ones by the FP method.8 The positive and negative controls were subjected to the asymmetric GP5+/6+ PCR as described with some modifications.16 An asymmetric PCR was carried out in 100 ␮l PCR reaction buffer containing 20 ␮l template, 2.0 U Taq polymerase (Promega, USA), 0.2 mM dNTPs, 10 pmol GP5+

107

and 100 pmol GP6+ primers. The concentration of the downstream primer was 10 times greater than that of the upstream primer in order for the asymmetric PCR to generate mainly single-stranded DNA. The reaction mixture was incubated at 94 ◦ C for 5 min; then was subjected to 40 cycles of incubation at 94 ◦ C for 60 s to denature the DNA; at 45 ◦ C for 60 s to anneal the primers; and at 72 ◦ C for 60 s to extend the annealed primers. Finally, it was subjected to an additional cycle without extension. 2.4. Uniplex genotyping by hybridization and FP assay The asymmetric GP5+/GP6+ PCR products from the positive and negative controls were subjected to hybridization and FP assay as described with some modifications. A high salt concentration (0.8 M NaCl) was used to obtain a high rate of hybridization (<10 min).17 The probes were diluted to 0.6 nM with TE buffer (10 mM Tris–HCl [pH8.0] and 1 mM EDTA disodium salt) containing 0.8 M NaCl. 100 ␮l of one type-specific probe and 10 ␮l of asymmetric GP5+/GP6+ PCR products were mixed. The mix were incubated at 48 ◦ C for 30 min and cooled to 25 ◦ C for 10 min. The FP values were measured at 25 ◦ C using the Fluorescence Polarization Capable Instrument (YG-06, Yangguang, Shanxi, China). FP measurements were made for 6-carboxy-fluorescein (FAM) with excitation at 485 nm and emission at 530 nm; for tetramethyl6-carboxyrhodamine (TAMRA) with excitation at 535 nm and emission at 590 nm; for b-carboxy-x-rhodamine (ROX) with excitation at 580 nm and emission at 620 nm. 2.5. Multiplex genotyping by hybridization and FP assay Simultaneous detection of several fluorophores in solution is possible by selecting fluorophores with discrete excitation and emission frequencies.18 The specificity and sensitivity of the probes have been confirmed by Southern blot analysis of the GP5+/GP6+ PCR products generated from pHPVs both individually and in a cocktail.13 First, asymmetric GP5+/GP6+ PCR products of the positive and negative controls were subjected to hybridization and FP assay as described above with some modifications.15 The probes were diluted to 1.8 nM with TE buffer containing 0.8 M NaCl. Three typespecific probes labeled respectively with FAM, TAMRA, ROX were used in a hybridization reaction. The positive hybridization reaction contained 99 ␮l of a mixture of three HPV genotypic probes and 11 ␮l of the asymmetric GP5+/GP6+ PCR products generated from corresponding pHPVs (105 copies, each) (Table 2). The negative hybridization contained 99 ␮l mixture of three probes and

Table 2 HPV genotypic probes used in every hybridization reaction. Genotypic probe

The first hybridization

Probe 6 Probe 11 Probe 16 Probe 18 Probe 31 Probe 33 Probe 35 Probe 39 Probe 42 Probe 34 Probe 45 Probe 51 Probe 52 Probe 56 Probe 58

33 ␮l 33 ␮l 33 ␮l

The second hybridization

The third hybridization

The fourth hybridization

The fifth hybridization

33 ␮l 33 ␮l 33 ␮l 33 ␮l 33 ␮l 33 ␮l 33 ␮l 33 ␮l 33 ␮l 33 ␮l 33 ␮l 33 ␮l

The asymmetric GP5 + /GP6+ PCR products were subjected to five hybridization reactions. Three probes labeled respectively with FAM, TAMRA, ROX were used in a hybridization reaction.

108

Z. Ju et al. / Journal of Clinical Virology 44 (2009) 106–110

Table 3 FP values (mp) of controls and samples for HPV genotype. HPV genotype (n)

FAM

Negative control HPV negative (266) HPV6 (51) HPV11 (91) HPV16 (90) HPV18 (36) HPV31 (8) HPV33 (8) HPV34 (5) HPV35 (2) HPV39 (5) HPV42 (4) HPV45 (2) HPV51 (4) HPV52 (5) HPV56 (3) HPV58 (46)

27.12 28.22 80.05 26.38 27.58 82.38 29.32 25.63 81.63 85.33 29.65 25.43 25.43 29.43 88.80 26.26 28.02

TAMRA ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

1.65 1.78 2.73 1.91 1.73 2.79 1.72 1.95 1.97 2.08 1.93 1.85 1.84 1.67 2.42 1.96 1.89

36.23 33.36 34.77 89.46 34.57 37.58 106.73 38.32 31.32 37.55 101.02 35.39 95.39 39.39 38.36 99.73 38.22

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

as HPV-positive. HPV DNA was detected in 138 of 360 (38%) cervical scrapes and 160 of 204 (78%) tissue specimens. ROX

1.43 1.54 1.64 2.89 1.46 1.71 2.91 1.68 1.58 2.11 3.15 1.97 2.93 1.78 1.93 3.14 1.97

33.23 30.46 29.73 31.77 94.83 33.47 38.39 89.32 37.32 34.46 38.76 79.64 39.64 89.53 33.25 36.94 83.77

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

1.47 1.88 1.79 1.96 2.89 1.83 1.86 2.38 1.79 1.66 1.84 2.16 1.97 2.41 1.79 2.09 3.07

FP values (mp) were represented as means ± S.D. Statistical analysis of FP values was performed using a t-distribution test. Results were stratified by HPV genotypes and fluorophores.

11 ␮l of the asymmetric GP5+/GP6+ PCR products generated from negative control. The mixes were incubated at 48 ◦ C for 30 min and cooled to 25 ◦ C for 10 min. The FP values were measured at 25 ◦ C. All the ␤-globin PCR-positive samples were subjected to an asymmetric GP5+/GP6+ PCR and hybridization with FP assay. Five hybridization reactions were required for detection of 15 HPV genotypes in each sample. Each experiment was performed in duplicate. 2.6. Sequencing HPV DNA of samples The HPV genotypes of samples were verified by sequencing. The GP5+/GP6+ PCR product was analyzed by the AmpliCycle sequencing kit (PerkinElmer).10 3. Results

3.2. Genotyping PCR products by hybridization and FP assay The average FP values (means) and standard deviations (S.D.) of the negative/positive controls and samples were determined for each HPV genotype (Table 3). The negative control had low FP values for all fluorophores, which indicated no probe-PCR product hybridization. Cut-off value for positive result was established based on the FP principle.19,20 The mean FP values of the negative and the positive data sets of each fluorophore were significantly different at a 99% level of confidence. These intervals did not overlap and therefore demonstrated a clear separation between the negative and positive populations. The net change of FP values in all positive reactions was >25 mP, which was at least seven times the standard deviation of the negative controls (>99% significance). The FP values of the samples were compared with the FP values of the negative control. If the net change of FP values of sample was >25 mP, the sample was scored as positive for the probe corresponding genotype. The results showed that three type-specific probes could be used to detect their target DNAs in the same solution (Table 4). 3.3. Sensitivity Serial dilutions from 100 pg to 100 ag of 15 pHPVs in a background of 2.5 ␮g/ml of K562-derived human DNA were tested by the asymmetric GP5+/GP6+ PCR and FP assay. The analytical sensitivity for detection was: 1 fg for HPV16, 18, 31, 33, 35, 39, 45, 51, 52, 56, and 58; 10 fg for HPV6, 11, 34, and 42 per assay. This corresponded to an equivalent of approximately 20–200 copies of the cloned viral genome per assay. HPV 16 and HPV 18 DNA extracted respectively from SiHa and HeLa cell lines into a background of 2.5 ␮g/ml of K562-derived human DNA to final concentrations of 100,000 copies, 20,000 copies, 4000 copies, 200 copies, 20 copies, and 2 copies per assay were tested, and the sensitivity was the same. Similar sensitivity was reached when the probes were used individually or in a cocktail.

3.1. HPV detection by gel electrophoresis 3.4. Specificity Samples were amplified by the GP5+/GP6+ PCR and PCR products were analyzed by 2% agarose gel electrophoresis. The samples from which 140–150 bp fragments were amplified were identified

The specificities of the probes were investigated by hybridization and FP assay of the asymmetric GP5+/6+ PCR products

Table 4 HPV genotypes identified by FP and sequence assay. Genotypes

HPV6+ HPV11+ HPV16+ HPV18+ HPV31+ HPV33+ HPV34+ HPV35+ HPV39+ HPV42+ HPV45+ HPV51+ HPV52+ HPV56+ HPV58+ Double* infection Triple* infection

FP

Sequence

Cervicovaginal scrapes (%)

Tissue biopsy (%)

Total

Cervicovaginal scrapes (%)

Tissue biopsy (%)

Total

24(17.4) 42(30.4) 35(25.4) 15(10.9) 3(2.2) 3(2.2) 2(1.5) 0 1(0.7) 1(0.7) 0(0) 1(0.7) 2(1.5) 1(0.7) 21(15.2) 7(5.1) 3(2.2)

26(16.3) 48(30) 54(33.8) 20(12.5) 4(2.5) 4(2.5) 2(1.3) 1(0.63) 3(1.9) 2(1.3) 1(0.6) 2(1.3) 2(1.3) 1(0.6) 24(15) 24(15) 5(3.1)

50 90 89 35 7 7 4 1 4 3 1 3 4 2 45 31 8

23(16.7) 40(29) 34(24.7) 14(10.1) 2(1.5) 2(1.5) 1(0.7) 0 1(0.7) 1(0.7) 0 0 1 (0.7) 1(0.7) 20(14.5) 2(1.5) 0

21(13.1) 42(26.3) 48(30) 20(12.5) 3(1.9) 3(1.9) 2(1.3) 1(0.6) 2(1.3) 1(0.6) 1(0.6) 2(1.3) 2(1.3) 1(0.6) 20(12.5) 9(5.6) 0

44 82 82 34 5 5 3 1 3 2 1 2 3 2 40 11 0

Differences between FP and sequence assay were tested for statistical significance using 2 -test. Results were stratified by HPV genotype positive. * Difference was regarded as significant when p < 0.05.

Z. Ju et al. / Journal of Clinical Virology 44 (2009) 106–110

109

Table 5 Comparison of and agreement for detection of HPV by FP and sequence assay for each category. Genotypes

HPV6 HPV11 HPV16 HPV18 HPV31 HPV33 HPV34 HPV35 HPV39 HPV42 HPV45 HPV51 HPV52 HPV56 HPV58

Cytology negative (305)

ASCUS (138)

LSIL (88)

HSIL (33)

FP+

Sequence+

Agreement (%)

FP+

Sequence+

Agreement (%)

FP+

Sequence+

Agreement (%)

FP+

Sequence+

Agreement (%)

8 39 34 16 1 1 0 0 0 0 0 0 1 0 10

7 39 34 16 1 1 0 0 0 0 0 0 1 0 10

99.5 100 100 100 100 100 100 100 100 100 100 100 100 100 100

17 32 19 3 1 1 1 0 1 0 0 1 0 0 11

16 30 19 3 0 1 0 0 1 0 0 0 0 0 9

99.2 98.5 100 100 99 100 99 100 100 100 100 99 100 100 98.5

15 13 23 12 4 3 2 1 2 2 1 1 2 1 17

13 11 20 12 3 2 2 1 1 1 1 1 1 1 16

97.7 97.7 96.5 100 98.8 98.8 100 100 98.8 98.8 100 100 98.8 100 98.8

10 6 13 4 1 2 1 0 1 1 0 1 1 1 7

8 2 9 3 1 1 1 0 1 1 0 1 1 1 5

93.9 87.9 87.9 96.9 100 96.9 100 100 100 100 100 100 100 100 93.9

Differences between FP and sequence assay were tested for statistical significance using McNemar’s test. Results were stratified by cytologic interpretations and HPV genotypes.

generated from pHPVs. Under the condition of the analysis, all the probes exhibited strong specificity for their corresponding HPV genotypes and no cross-hybridization were observed when the amount of pHPVs used accounted for no more than 1 ng (20,000,000 copies of the viral genome).

the method. The FP assay is superior to Roche Linear Array HPV tests and the Third Wave Invader HPV assay since it gives genotypespecific information.25

3.5. Stability and reproducibility

This work was supported by National High-tech R&D Program (2008AA02Z444). We thank Professor Sun Jianzhong for manuscript editing, Dr. Cheng Hong for providing cervical tissue specimens.

Fifteen pHPVs and 100 samples were assayed repeatedly 10 times by the asymmetric GP5+/6+ PCR and hybridization with FP assay. The genotypes of every pHPVs and samples were the same. 3.6. Comparison of FP assay with sequence assay Fifteen HPV genotypes of samples based on the asymmetric GP5+/6+ PCR with FP assay and sequence assay were compared by 2 -test using spss10.0 software. Concordance (p > 0.05) was demonstrated when a monotypic infection was evaluated (Table 4). Concordance between FP versus sequence results obtained on cervical cytology and biopsy specimens is reported in Table 5. 4. Discussion In most hybridization methods, the free probes must be separated from the hybridized probes, such as with the Luminex bead-based method.21 This separation process is tedious; subject to error; and is an obstacle to automation of the hybridization assay. The FP assay is capable of monitoring the hybridization rapidly without separation. A combination of DNA hybridization and FP assay should be easily adaptable to automated analysis.22 The hybridization can be measured by FP assay when the sequence of sample DNA had three or less mismatches within a 24-mer probe.23 A longer probe would be essential to maximize the specificity of hybridization. In our research, 30-mer probes, which contained more than seven mismatches with corresponding regions of the other HPV types, hybridized only with the PCR products of the target gene when they coexisted in the same solution. The sensitivity of the FP assay was comparable with that of most HPV genotyping methods.24 Variation in sensitivity among the genotypes might be due to the mismatched bases in the primer-binding regions.3 The FP assay detected more samples with multiple infections than the sequence assay. But the discordance between the results of the FP assay and the sequence assay did not result in discordant cases with HPV infection. Consistency between sequence and FP assay supported scientific confidence of

Acknowledgements

References 1. Boulch DM, Franceschi S, Plummer M. International correlation between human papillomavirus prevalence and cervical cancer incidence. Cancer Epidemiol Biomarkers Prev 2008;17:717–20. 2. Jacobs MV, Snijders PJ, van den Brule AJ, Helmerhorst TJ, Meijer CJ, Walboomers JM. A general primer GP5+/GP6+ mediated PCR-enzyme immunoassay method for rapid detection of 14 high-risk and 6 low-risk human papillomavirus genotypes in cervical scrapings. J Clin Microbiol 1997;35:791–5. 3. Qu W, Jiang G, Cruz Y, Chang CJ, Ho GYF, Klein RS, et al. PCR detection of human papillomavirus: comparison between MY09:MY11 and GP5:GP6 primer systems. J Clin Microbiol 1997;35:1304–10. 4. Kleter B, van Doorn LJ, Schrauwen L, Molijn A, Sastrowijoto S, ter Schegget J, et al. Development and clinical evaluation of a highly sensitive PCR-reverse hybridization line probe assay for detection and identification of anogenital human papillomavirus. J Clin Microbiol 1999;37:2508–17. 5. van den Brule AJ, Pol R, Fransen-Daalmeijer N, Schouls LM, Meijer CJ, Snijders PJ. GP5+/6+ PCR followed by reverse line blot analysis enables rapid and highthroughput identification of human papillomavirus genotypes. J Clin Microbiol 2002;40:779–87. 6. Tabrizi SN, Stevens M, Chen S, Rudland E, Kornegay JR, Garland SM. Evaluation of a modified reverse line blot assay for detection and typing of human papillomavirus. Am J Clin Pathol 2005;123:896–9. 7. Lundblad JR, Laurance M, Goodman RH. Fluorescence polarization analysis of protein–DNA and protein–protein interactions. Mol Endocrinol 1996;10:607–12. 8. Tsuruoka M, Murano S, Okada M, Ohiso I, Fujii T. The extremely rapid oligonucleotide hybridization and high throughput detection of microbial gene sequences using fluorescence polarization. Biosensors Bioelectron 2001;16:695–9. 9. Ohiso I, Tsuruoka M, Iida T, Honda T, Karube I. A florescence polarization assay using oligonucleotide probes for the rapid detection of verotoxin-producing Escherichia coli. J Biotechnol 2000;81:15–25. 10. Zhang J, Chen ZC, Gao YE, Jiang Y, Xia L, Guo YH, et al. A novel fluorescence polarization based assay for 14 human papillomavirus genotypes in clinical samples. J Virol Methods 2006;134:223–9. 11. Zhang J, Yan XJ, Sun JZ, Chen ZC, Gao YE, Bai YJ, et al. A high throughout assay for human papillomavirus genotypes with fluorescence polarization. Chin Med J 2003;116:1137–40. 12. Globin Bell DA, Tayloy JA, Paulson DF, Robertson CN, Mohler JL, Lucier GW. Genetic risk and carcinogen exposure: a common inherited defect of the carcinogen-metabolism gene glutathione S-transferase M1 (GSTM1) that increase susceptibility to bladder cancer. J Natl Cancer Inst 1993;85:1159–64. 13. Jacobs MV, de Roda Husman AM, van den Brule AJ, Snijders PJ, Meijer CJ, Walboomers JM. Group-specific differentiation between high- and low-risk human

110

14.

15.

16.

17.

18. 19.

Z. Ju et al. / Journal of Clinical Virology 44 (2009) 106–110 papillomavirus genotypes by general primer-mediated PCR and two cocktails of oligonucleotide probes. J Clin Microbiol 1995;33:901–5. Josefsson A, Livak K, Gyllensten U. Detection and quantitation of human papillomavirus by using the fluorescent 5 exonuclease assay. J Clin Microbiol 1999;37:490–6. Takács T, Jeney C, Kovács L, Mózes J, Benczik M, Sebe A. Molecular beacon-based real-time PCR method for detection of 15 high-risk and 5 low-risk HPV types. J Virol Methods 2008;149:153–62. de Roda Husman AM, Walboomers JM, van den Brule AJ, Meijer CJ, Snijders PJ. The use of general primers GP5 and GP6 elongated at their 3 ends with adjacent highly conserved sequences improves human papillomavirus detection by polymerase chain reaction. J Gen Virol 1995;76:1057–62. Tsuruoka M, Yano K, Ikebukuro K, Nakayamab H, Masudab Y, Karube I. Optimization of the rate of DNA hybridization and rapid detection of methicillin resistant Staphylococcus aureus DNA using fluorescence polarization. J Biotechnol 1996;48:201–8. Chen X, Levine L, Kwok PY. Fluorescence polarization in homogeneous nucleic acid analysis. Genome Res 1999;9:492–8. Murakami A, Nakaura M, Nakatsuji Y, Nagahara S, Qui T-C, Makino K. Fluorescent-labeled oligonucleotide probes: detection of hybrid formation in solution by fluorescence polarization spectroscopy. Nucleic Acids Res 1991;19:4097–102.

20. Hsu TM, Chen X, Duan S, Miller RD, Kwok PY. Universal SNP genotyping assay with fluorescence polarization detection. Biotechniques 2001;31: 560–8. 21. Schmitt M, Bravo IG, Snijders PJ, Gissmann L, Pawlita M, Waterboer T. Beadbased multiplex genotyping of human papillomaviruses. J Clin Microbiol 2006;44:504–12. 22. Kido C, Murano S, Tsuruoka M. Rapid and simple detection of PCR product DNA: a comparison between Southern hybridization and fluorescence polarization analysis. Gene 2000;259:123–7. 23. Herning T, Tamiya E, Karube I, Kobayashi S. Specific liquid DNA hybridization kinetics measured by fluorescence polarization. Anal Chim Acta 1991;244:207–13. 24. Jordens JZ, Lanham S, Pickett MA, Amarasekara S, Abeywickrema I, Watt PJ. Amplification with molecular beacon primers and reverse line blotting for the detection and typing of human papillomaviruses. J Virol Methods 2000;89:29–37. 25. Schutzbank TE, Jarvis C, Kahmann N, Lopez K, Weimer M, Yount A. Detection of high-risk papillomavirus DNA with commercial Invader-technology-based analyte specific reagents following automated extraction of DNA from cervical brushings in ThinPrep media. J Clin Microbiol 2007;45:4067–9.