Multiplex nested PCR (MNP) assay for the detection of 15 high risk genotypes of human papillomavirus

Journal of Clinical Virology 33 (2005) 116–122

Multiplex nested PCR (MNP) assay for the detection of 15 high risk genotypes of human papillomavirus Brian Brestovaca,∗ , Gerald B. Harnetta , David W. Smitha , Felicity Frostb , Geoffrey R. Shellamc a

Division of Microbiology and Infectious Diseases, The Western Australian Centre for Pathology and Medical Research, PathCentre, Locked Bag 2009, Nedlands, WA 6009, Australia b Division of Pathology, The Western Australian Centre for Pathology and Medical Research, PathCentre, Locked Bag 2009, Nedlands, WA 6009, Australia c University of Western Australia, School of Biomedical and Chemical Sciences, Microbiology, PathCentre, Locked Bag 2009, Nedlands, WA 6009, Australia Received 30 September 2004; received in revised form 18 October 2004; accepted 21 October 2004

Abstract Background: Human papillomavirus (HPV) is now recognized as the causative agent in cervical cancer. The HPV genotypes that infect the genital region have been classified into high and low risk types according to their oncogenic potential. There is still uncertainty regarding rare HPV genotypes, however the types considered high risk in this study are: HPV-16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68 and 70. Objectives: We have set out to develop a multiplex nested PCR (MNP) assay with primers directed at the early region of the HPV genome to detect 15 high risk HPV (HRHPV) genotypes. Since it is known that the late region of HPV is lost on integration into the host cell genome, the primers are directed at the early region of the HPV genome so as to ensure the detection of integrated virus, in the absence of the episomal form of the virus. Study design: Primers were designed to detect specifically the high risk HPV in the MNP assay. The MNP assay was compared to a generic mucosal HPV nested PCR and another nested HRHPV PCR assay. DNA sequencing was carried out on the samples tested and matched with the PCR results. Results: The MNP assay demonstrated that it was able to detect all 15 HRHPV types and was positive for more CIN1, CIN2 and CIN3 cases than the other nested HRHPV PCR. Further to this, the PCR product sizes differ for most of the HRHPV types detected in this system, so it is possible to type most of these HRHPV by the molecular size of the PCR products. Conclusion: The MNP assay detects 15 currently recognized HRHPV and could be very useful, in conjunction with the Pap smear, as a screening assay or to help manage Pap smears of uncertain cytology. © 2004 Elsevier B.V. All rights reserved. Keywords: Papillomavirus; CIN; Squamous cell carcinoma; PCR

1. Introduction Cancer of the uterine cervix emerges from a series of lesions with increasing dysplasia caused by persistent HPV Abbreviations: MNP, multiplex nested PCR; HPV, human papillomavirus; HRHPV, high risk human papillomavirus; CIN, cervical intraepithelial neoplasia ∗ Corresponding author. Tel.: +61 8 9346 3260; fax: +61 8 9346 3960. E-mail address: [email protected] (B. Brestovac). 1386-6532/$ – see front matter © 2004 Elsevier B.V. All rights reserved. doi:10.1016/j.jcv.2004.10.011

infections. For the past 50 years or so the Papanicolaou (Pap) screen has been used to detect pre-neoplastic cytological changes, cervical intraepithelial neoplasia (CIN) grades 1–3, in the cervix. Although this test has proved very useful in reducing the cervical cancer rates in areas where a screening program is in place, the cancer rate has plateaued in most countries (Cox, 1996; Kaufman and Adam, 1999; Manos et al., 1999). Human papillomavirus (HPV) is now widely accepted as the causative agent for almost all cervical cancers in

B. Brestovac et al. / Journal of Clinical Virology 33 (2005) 116–122

women (Bosch and deSamjose, 2002; Bosch and Munoz, 2002; Bosch et al., 1995, 2002; Cox, 1996; Feoli-Fonseca et al., 2001; Munger, 2002; Villa et al., 2002; Walboomers et al., 1999; ZurHausen, 1996). HPV infection is required but is not sufficient for the development of cervical cancer. Furthermore HPV infections are very common in women and cancer is a rare outcome of these infections. Of the known mucosal (anal/genital) genotypes of HPV, approximately 15 are recognized as being able to cause progression to cancer and are termed “high risk” human papillomavirus (HRHPV). In recent years the introduction of tests for the detection of HPV DNA has started to assist in the assessment of equivocal Pap smears, for defining women at risk of developing cervical cancer. However, only certain genotypes of HPV cause progression to cancer and a test detecting these genotypes would be very useful. The genotypes currently recognized as HRHPV in this study are: HPV-16, 18, 31, 33, 35, 39, 45, 51, 52, 56, 58, 59, 66, 68 and 70 with HPV-16 and 18 accounting for approximately 70% of cervical cancers worldwide (deVilliers, 1994; Munoz et al., 2003; Nindl et al., 1999). It must be noted that the phylogenic classification of HPV70 places it as a HRHPV, but the limited epidemiological data is not sufficient to support this (Munoz et al., 2003) and the oncogenic status of HPV-26, 53, 73 and 82 is unclear (Munoz et al., 2003). Due to the oncogenic potential of the HRHPV viruses, the detection of these HRHPV types has been proposed as a useful addition to the diagnosis of cervical dysplasia. However, transient infection of the uterine cervix with HPV, including HRHPV, is very common, with an estimated 17% of women in Western Australia being infected with HRHPV. Thus a negative finding for HRHPV, may be of most use in any screening program proposed. A negative result for all known HRHPV types in conjunction with a normal Pap smear may indicate that a longer period of time may be appropriate, before re-testing (Cuzick, 2002). In cases where there are low-grade changes or atypical squamous cells of unknown significance (ASCUS), in the cytology, HRHPV detection could provide useful additional information for the management of these patients (Manos et al., 1999).

2. Materials and methods 2.1. Specimens Routine cervical samples collected in a liquid based cytology medium (ThinPrep® ) (Pearson, 2002) were obtained from the Pap screening program at the Western Australian Centre for Pathology and Medical Research (PathCentre). Consent was obtained from these women. ThinPrep samples from previously diagnosed cases of cervical intraepithelial neoplasia (CIN) grades 1–3 were also tested. In addition, biopsies from paraffin sections (15 ␮m thick) and one ThinPrep specimen from cases with invasive squamous cell carcinoma (SCC) of the cervix were also tested. All the above

117

specimens were supplied by the Western Australian Centre for Pathology and Medical Research (PathCentre), Pathology department. Plasmids for HPV genotypes 6, 11, 13, 16, 18, 33, 39, 45, 51, 52, 53, 55A, 55B, 58, 59, 66, 68, 70A and 70B were also tested. These were obtained from: Prof. Dr. E.M deVilliers (Deutsches Krebsforschungszentrum, Heidelberg, Germany), for HPV-13, 53, 45, 51, 6, 11, 16 and 18 plasmids. Prof. Gerard Orth (Institut Pasteur, Paris, France), for HPV-33, 39, 55, 66, 68 and 70 plasmids. Dr. Toshihiko Matsukura (National Institute of Infectious Diseases, Tokyo, Japan), for HPV-58 and 59 plasmids and Prof. Wayne D. Lancaster (Centre for Molecular Medicine & Genetics, Detroit, USA), for the HPV-52 plasmid. All plasmids contained whole HPV genomes. 2.2. Preparation of samples All ThinPrep samples were processed using the QiaAmp Viral RNA kit (QIAGEN GmbH, Max-Volmer Straße 4, 40724 Hilden, Germany), which is suitable for both RNA and DNA extraction (personal communication from manufacturer). The method for extraction of the nucleic acid was done in accordance to the manufacturers’ protocol. Paraffin sections of the biopsies used were first de-waxed with three washes of xylene, then xylene was removed by three washes with 100% ethanol, after which they were placed in 0.5 mL of Proteinase K overnight at 60 ◦ C. DNA was then extracted using the QiaAmp Viral RNA kit (QiaGen Corporation) as above. 2.3. PCR assays Three separate nested PCR assays were done on the samples. Firstly a nested PCR for the detection of all mucosal HPV types was done. This generic mucosal nested PCR (GMP), directed at the HPV L1 region was performed using the MY09/MY11 outer primers, producing an amplicon of 450 bp (Manos et al., 1989), followed by GP5+/GP6+ inner primers, producing an amplicon of 150 bp (deRoda Husman et al., 1995). Both PCR reaction mixes had MgCl2 concentrations of 2.0 mM. The first round PCR had an annealing temperature of 50 ◦ C for 45 cycles. The second round PCR annealing temperature was 45 ◦ C for 45 cycles. The second nested PCR assay (Pizzighella et al., 1995) was reported to detect only seven of the known HRHPV (HPV-16, 18, 31, 33, 35, 45 and 58). The target area of this PCR was the E1/E7 region. The outer first round primers 3s and 1as produced an amplicon of 670 bp, while the second round inner primers 2s and 2as produced an amplicon of 161 bp. Both PCR mixes used 2.0 mM of MgCl2 and had an annealing temperature of 55 ◦ C. This was called the restricted high risk PCR (RHRP). The third PCR was the multiplex nested PCR (MNP) consisting of two nested PCR assays (Groups 1 and 2). The Group 1 PCR was designed to detect HPV-18, 39, 45, 59, 68 and 70, while the Group 2 PCR was designed to detect HPV-16, 31,

118

B. Brestovac et al. / Journal of Clinical Virology 33 (2005) 116–122

33, 35, 51, 52, 56, 58 and 66. The primers and product sizes are listed in Table 1. MgCl2 concentration was 2.5 mM for all reactions. The first round PCR for both groups used an annealing temperature of 45 ◦ C and the second round for both groups was 55 ◦ C. All PCR reactions were in 20 ␮L volumes and used Applied Biosystems Taq Gold DNA polymerase at 0.5 u/tube for a hot start PCR. Cycling conditions were the same except for the annealing temperature (given above) and was as follows: − 94 ◦ C, 10 min, 1 cycle/94 ◦ C, 30 s, annealing temp 30 s, 72 ◦ C, 45 s, 45 cycles/72 ◦ C, 7 min followed by 4 ◦ C indefinite. All reactions had as final concentration: Applied Biosystems Buffer II 1×, dNTP pool 0.2 mM, and primers at 0.2 ␮M. 2.4. DNA sequencing The MY09/MY11 PCR products from the samples were used for DNA sequencing, except where the product was weak in which case the second round GP5+/GP6+ product was used. The Applied Biosystems Big Dye terminator reaction was used according to Manufacturers’ protocol. Sequencing products were interrogated by an Applied Biosystems 310 Sequence Analyzer. Resulting sequences were analyzed by a BLASTn search using Genbank (National Centre for Biotechnology Information, (http://www.ncbi.nlm.nih.gov/; Feoli-Fonseca et al., 1998, 2001; Rady et al., 1993). All samples were tested for PCR inhibitors by an internal PCR for p53 (Storey et al., 1998), those samples that did not amplify this internal house keeping PCR, were excluded from analysis. Water controls were placed between every five samples to detect laboratory contamination.

3. Results We tested the sensitivity of each PCR assay using a serial dilution of HeLa cells (containing approximately 50 copies per cell of HPV-18). Each of the methods detected down to 50 copies of HPV-18 per 100 ␮L of extracted sample (1 HeLa cell) (data not shown). Since only the Group 1 MNP contained primers for HPV-18, the comparison was only between the GMP, RHRP and Group 1 MNP and not the Group 2 MNP. The sensitivity of the HPV genotypes covered by the Group 2 MNP has not been determined. The plasmids containing target for the various HPV genotypes were tested using the MNP (Fig. 1). As expected, the Group 1 MNP amplified HPV-18, 39, 45, 59, 68 and 70 plasmids and the Group 2 MNP amplified HPV-16, 33, 51, 52 and 66 plasmids. All of the plasmid amplified targets produced bands of the expected size. Only the HPV-58 plasmid failed to produce detectable product. Plasmids containing HPV-6, 11, 13, 53 and 55, as expected, did not amplify with the MNP assay. Primers and product sizes are listed on Table 1. HPV-16, 31 and 35 all produced amplicons of 300 bp, while HPV-33, 52 and 58 all produced amlpicons of 273 bp and HPV-56 and 66 produced amplicons of 151 bp. Therefore, HPV genotypes within these clusters could not be distinguished from each other based on amplicon size. All other HPV genotypes produce amplicons of differing size. From the 282 routine Pap smear group of Western Australian women, 76 (27%) of samples were found to be positive for HPV DNA by the generic PCR method. The number positive for HRHPV in this group was 35 (12.5%) using the RHRP, and 48 (17%) using MNP. When ThinPrep

Table 1 Primers used in the multiplex nested PCR for HRHPV Name

Primer sequence 5 –3

Product size (bp)

Group 1 Forward 1st Reverse 1st Forward 2nd Reverse 2nd

18e1-5 18E1-8 18E1-7 18E1-6

TTTGTRWACAGGCAGAGC TACCARTAYARTGCTGCWACA GCDHGAGACAGCACAGG ATTARTGTTTTAAABCCTTCKG

1st round = 817 HPV18 = 598, HPV45 = 556 HPV39 = 565, HPV68 = 481 HPV70 = 579, HPV59 = 560

Group 2 Forward 1st Reverse 1st Forward 2nd Forward 2nd Reverse 2nd Forward 1st Reverse 1st Forward 2nd Reverse 2nd Forward 1st Reverse 1st Forward 2nd Reverse 2nd

16e1-2 16e1-5 16e1-9 16e1-10 16e1-7 56e7-3 56e1-1 56e7-4 56e7-2 51e6-1 51e7-3 51e6-5 51e7-1

ATGTGYAGACATTATAAAMRRG TTTTCYTTGTCCTCKTCCT ATGTTAGATGATGCTACA TGGACATATATAGATGATTA ATYTGSACCACGTCCTTGA ATGAGCAATTGGACAGCTCA GTCTATAAATCCATCTAMATC AGCAAGCTAGACAAGCT CACGTTACTGTTAACGCAC ATTATGTGAAGCTTTGAACGTT TTCGCACAACACGGGCAA TTGCTGGCAACGTACACGA TTGCAAGTCAATTTCAGTCT

1st round = 672 HPV33, 52, 58 = 273 HPV16, 31, 35 = 300 1st round = 400 HPV56, 66 = 151 1st round = 721 HPV51 = 121

For the Group column, primer direction is indicated followed by the PCR, 1st (first round of the nested), 2nd (second round of the nested). Product size column indicates the first round product size and then the final HPV type product size in the second round PCR.

B. Brestovac et al. / Journal of Clinical Virology 33 (2005) 116–122

119

Fig. 1. For Group 1, lanes 1 and 9 are HPV-18 (HeLa cell) control, 2 and 10 are water controls, and lanes 3–8 are HPV-18, HPV-70, HPV-39, HPV-59, HPV-45 and HPV-68, respectively. For Group 2, lanes 11 and 22 are water controls, and lanes 12–21 are HPV-16, HPV-66, HPV-16, HPV-33, HPV-58, HPV-52, HPV-66, HPV-51, HPV-16, HPV-66, respectively. Lane M is the molecular weight standard.

samples from cases of CIN1, CIN2 and CIN3 were tested, the MNP method detected a HRHPV genotype in 91.7% compared with only 57.0% for the RHRP method (Table 2). However, when paraffin biopsy material was used (SCC group), the MNP method only detected HRHPV in 76% of samples compared to 85% for the RHRP method. Of the cytologicaly abnormal samples (CIN/cancer) six failed to amplify with the generic mucosal PCR, and only one failed the internal PCR inhibitor test and was excluded from the analysis. Table 3 shows the detection rate for each of the PCR assays for the various HRHPV genotypes form all samples in that were able to be genotyped by DNA sequencing. From the ThinPrep samples, all 27 HPV-16 containing samples were detected by both RHRP and MNP methods, where as for HPV-18 the MNP method missed one and the RHRP deTable 2 Detection of HRHPV by RHRP and MNP methods for routine Pap screen samples and those with cytological changes or cancer

Routine Pap from WA (n = 282) CIN1 (n = 36) CIN2 (n = 26) CIN3 (n = 22) SCC (n = 33)

tected all 7. However, for the remaining HRHPV genotypes the MNP was able to detect all, while the RHRP method failed to detect 26. For the squamous cell carcinoma (SCC) group, the RHRP method missed two samples containing HPV-16 and the MNP method missed three HPV-16 and two HPV-18 samples. Two samples did not amplify for any of the HPV PCR methods, but were positive for the internal control PCR. For the pre-cancerous samples (CIN1, CIN2 and CIN3), the MNP method missed one HPV-18 that was detected by RHRP. As expected the RHRP method did not detect HPV51, HPV-56, HPV-68 or HPV-70, but did unexpectedly detect one HPV-39, one HPV-52 and two HPV-66 samples. It also failed to detect any of the four HPV-33 samples, one HPV-35 sample, one HPV-45 and three HPV-58 samples, which are genotypes reported to be detected by this method (Pizzighella et al., 1995). The MNP method detected 94% of the samples containing HRHPV, while the RHRP method detected 75% (Table 3).

Number (%) positive by restricted high risk PCR

Number (%) positive by multiplex nested PCR

4. Discussion

35 (12.5%)

48 (17%)

18 (50%) 17 (65%) 12 (55%) 28 (85%)

33 (92%) 24 (92%) 20 (91%) 25 (76%)

The design of a method to specifically detect known HRHPV genotypes was undertaken because these HPV types are relevant in the progression to cervical cancer. Used in conjunction with Pap smear cytology, such a test would be useful for screening purposes and in the management of atypical squamous cells of unknown significance (ASCUS) smears. Other methods reported either do not cover as full a range of HRHPV or detect non-HRHPV genotypes as well as HRHPV

Routine Pap screen and pre-cancerous (CIN) samples were tested from liquid medium (ThinPrep) collected specimens. SCC samples were tested from archived paraffin embedded cervical biopsies.

120

B. Brestovac et al. / Journal of Clinical Virology 33 (2005) 116–122

Table 3 Detection rates for HRHPV genotypes by RHRP and MNP HRHPV genotype

16 18 31 33 35 39 45 51 52 56 58 59 66 68 70 Total Total per method

Number of ThinPrep samples positive by any PCR method

Number of paraffin biopsy samples positive by any PCR method

Number of ThinPrep positive by RHRP

Number of paraffin biopsies positive by RHRP

Number of ThinPrep positive by MNP

Number of paraffin biopsies positive by MNP

27 7 8 4 4 2 1 1 5 1 4 4 6 1 2

22 5 1

27 7 8 0 1 1 0 0 1 0 1 1 2 0 0

20 5 1

27 6 8 4 3 2 1 1 5 1 4 4 6 1 2

19 3 1

77

29

49

27

75

24

106

1

76

genotypes (Chow et al., 2000; Harnish et al., 1999; Husnjak et al., 2000; Nindl et al., 1999; Nelson et al., 2000; Pizzighella et al., 1995; Poljak et al., 2002; Strauss et al., 2000; Sotlar et al., 2004). The MNP method was compared with two other nested PCR assays, firstly a generic mucosal nested PCR (GMP) assay which detects all mucosal HPV genotypes (Bauer et al., 1992; deRoda Husman et al., 1995; Evander et al., 1992; Manos et al., 1989), and secondly a HRHPV nested PCR (RHRP) assay designed by Pizzighella et al. (1995) that was reported to detect seven of the HRHPV genotypes (HPV-16, 18, 31, 33, 35, 45 and 58). The results were matched with the genotype of the HPV detected, as determined by DNA sequencing. The ThinPrep samples tested were from a group of Western Australian women that attended a routine Pap screen program as well as archival CIN1, CIN2 and CIN3 samples. In addition, archival paraffin sections from squamous cell carcinoma (SCC) cases were tested. The MNP method detected more positive HRHPV for all ThinPrep samples in the routine screening, CIN1, CIN2 and CIN3 groups, than the RHRP method (Table 2). Most of this increased detection is explicable due to the RHRP method detecting only seven HRHPV genotypes, while the MNP method is designed to detect fifteen HRHPV genotypes. However, a number of samples containing HPV types that should have been detected by the RHRP method were missed. Most notable were four HPV-33 and four HPV-58 samples. It may be speculated that the RHRP method may be less efficient at amplifying these particular genotypes than for other HRHPV. One each of HPV-16, HPV-35 and HPV-45 positive samples were also missed by the RHRP method. Overall, 26 ThinPrep samples containing HRHPV were missed by the RHRP method, were

1

1

99

detected by the MNP method. Two ThinPrep samples containing HRHPV that were detected by the RHRP method were missed by the MNP method. Of those missed by the MNP method, one contained HPV-18 and the other contained HPV-35. Both produced very weak amplicons (as visualized on agerose gel) by both the generic mucosal nested PCR and RHRP methods. It may be suggested that these two samples are very near the lower limits of detection for all assays. This is taking into consideration that for HPV-18 at least, the sensitivities of all three assays were determined to be the same (50 copies of HPV-18). In the routine screening group of Western Australian women, most of the discrepancies between methods were due to HPV genotypes that the RHRP method was not expected to detect, i.e. four each of HPV-52 and 66, two of HPV-70 and one each of HPV-39, 56 and 68. However, there were several very weak positive samples with the GMP method that were not able to be DNA sequenced. Only one sample in this Western Australian group was detected by the RHRP method and failed to amplify by the MNP method. This sample contained HPV-35 by DNA sequencing, however, as mentioned, the amplified products for the GMP and for the RHRP methods were very weak on visual inspection. All 15 HRHPV types that the MNP method was designed to detect were represented in this study. The MNP method has thus demonstrated reactivity with all 15 HRHPV that it was designed to detect. Due to the grouping and molecular size differences of the amplified products in the MNP method, several mixed infections were detected. Interestingly, four CIN1 samples had both HPV-18 (Group 1) and HPV-16 (Group 2) products in the MNP method. In all, 15 samples had demonstrable dual

B. Brestovac et al. / Journal of Clinical Virology 33 (2005) 116–122

infections by the MNP method. These were from the routine screening group (five samples), CIN1 group (seven samples) and CIN2 group (three samples). No CIN3 or SCC samples had detectable dual infection by the MNP method. Because the GMP and RHRP methods do not produce PCR amplicons of differing sizes for the different HPV genotypes, duel infections cannot be detected. However, the MNP method may miss some dual infections, for example, if HPV-16 and HPV31 were present, only a product of 300 bp would be demonstrated. Also, in a mixed infection where one HPV genotype may be present in greater quantities than the other, competition for the PCR reagents may result in only the greater HPV being amplified. Nevertheless, it was demonstrated that the MNP method could detect some dual infections. The results from the paraffin sections of SSC samples indicated the reverse trend compared to the ThinPrep samples, in that for the paraffin sections the RHRP method detected more positives than the MNP method (Table 2). It is important to note that the processing of the tissue for embedding can cause damage to the DNA (Baay et al., 1996) and so MNP method may be less robust for amplifying DNA extracted from paraffin sections, particularly since the PCR products for the MNP method are quite large. This may explain the missed HPV-16 and 18 samples from the paraffin biopsy material by the MNP method. Plasmid DNA representing HPV genotypes 6, 11, 13, 16, 18, 33, 39, 51, 52, 53, 55, 58, 59, 66, 68 and 70 were tested using the MNP method. All HRHPV types amplified as expected with the exception of HPV-58, which did not amplify (Fig. 1). In contrast with the other plasmids, the HPV-58 amplified very weakly with the GMP method. Given that samples identified as containing HPV-58 were amplified with the expected Group 2 MNP, with products of expected size, and the weak amplification of this plasmid with the GMP method, it is suggested that the DNA in this plasmid may have been partially degraded. As expected all non-HRHPV were not amplified by the MNP method.

5. Conclusion We have developed a Multiplex nested PCR (MNP) assay that can specifically detect 15 HRHPV genotypes. Using the variation in amplicon size, a limited low resolution typing can be achieved. This assay is rapid and for HPV-18 it is equal in sensitivity to two other nested PCR methods. Also, due to the variation in amplicon size, the detection of some multiple HRHPV infections is possible by this method. For ThinPrep samples the method has been shown to be sensitive, robust, and is able to detect more HRHPV-containing samples than the RHRP method. However, the MNP method may be less robust when testing paraffin embedded section material, probably due to the size of the amplicons in conjunction with damage to the DNA from the embedding process. This Multiplex Nested PCR assay is suitable for testing ThinPrep samples for 15 HRHPV genotypes.

121

References Baay MFD, Quint WGV, Koudstaal J, Hollema H, Duk JM, Burger MPM, et al. Comprehensive study of several general and type-specific primer pairs for detection of human papillomavirus DNA by PCR in paraffinembedded cervical carcinomas. J Clin Microbiol 1996;34:745–7. Bauer HM, Greer CE, Manos MM. Determination of genital human papillomavirus infection by consensus PCR amplification. In: Herrington CS, McGee JO, editors. Diagnostic molecular pathology: a practical approach, vol. II. Cell and tissue genotyping. Oxford: IRL Press at Oxford University Press; 1992. p. 131–52. Bosch FX, Manos MM, Munoz N, Sherman M, Jansen AM, Peto J, et al. Prevalence of human papillomavirus in cervical cancer: a worldwide perspective. J Natl Cancer Inst 1995;87:796–802. Bosch FX, deSamjose S. Human papillomavirus in cervical cancer. Curr Oncol Rep 2002;4(2):175–83. Bosch FX, Munoz N. The viral etiology of cervical cancer. Virus Res 2002;89:183–90. Bosch FX, Lorincz A, Munoz N, Meijer CJLM, Shah KV. The causal relation between human papillomavirus and cervical cancer. J Clin Pathol 2002;55:244–65. Chow VTK, Loh E, Yeo WM, Tan SY, Chan R. Identification of multiple genital HPV types and sequence variants by consensus and nested Type-specific PCR coupled with cycle sequencing. Pathology 2000;32:204–8. Cox JT. Clinical role of HPV testing. Obstet Gynecol Clin North Am 1996;23:811–51. Cuzick J. Role of HPV testing in clinical practice. Virus Res 2002;89:263–9. deRoda Husman AM, Walboomers JM, van den Brule AJ, Meijer CJ, Snijders PJ. The use of general primers GP5 and GP6 elongated at their 3 ends with adjacent highly conserved sequences improves human papillomavirus detection by PCR. J Gen Virol 1995;76:1057–62. deVilliers EM. Human pathogenic papillomavirus types: an update. Curr Top Microbiol Immunol 1994;186:1–12. Evander M, Edlund K, Boden E, Gustafsson A, Jonsson M, Karlsson R, et al. Comparison of a one-step and a two-step polymerase chain reaction with degenerate general primers in a population-based study of human papillomavirus infection in young Swedish women. J Clin Microbiol 1992;30:987–92. Feoli-Fonseca JC, Olingny LL, Filion M, Brochu P, Simard P, Russo PA, et al. A two-tier polymerase chain reaction direct sequencing method for detecting and typing human papillomaviruses in pathological specimens. Diagn Mol Pathol 1998;7(6):317–23. Feoli-Fonseca JC, Oligny LL, Brochu P, Simard P, Falconi S, Yotov WV. Human papillomavirus (HPV) study of 691 pathological specimens from Quebec by PCR-direct sequencing approach. J Med Virol 2001;63:284–92. Harnish DG, Belland LM, Scheid EE, Rohan TE. Evaluation of human papillomavirus-consensus primers for HPV detection by the polymerase chain reaction. Mol Cell Probes 1999;3:9–21. Husnjak K, Grce M, Magdic L, Pavelic K. Comparison of five different polymerase chain reaction methods for the detection of human papillomavirus in cervical cell specimens. J Virol Methods 2000;88: 125–34. Kaufman RH, Adam E. Is human papillomavirus testing of value in clinical practice? Am J Obstet Gynecol 1999;180:1049–53. Manos MM, Ting Y, Wright DK, Lewis AJ, Broker TR, Wolinski SM. Use of polymerase chain reaction amplification for the detection of genital human papillomaviruses. Cancer Cells 7/Cold Springs Harbor Laboratory 1989:209–14. Manos MM, Kinney WK, Hurley LB, Sherman ME, Shieh-Ngai J, Kurman RJ, et al. Identifying women with cervical neoplasia: using human papillomavirus DNA testing for equivocal Papanicolaou results. JAMA 1999;281:1605–10. Munger K. The role of human papillomaviruses in human cancer. Front Biosci 2002;7:641–9.

122

B. Brestovac et al. / Journal of Clinical Virology 33 (2005) 116–122

Munoz N, Bosch FX, deSanjose S, Herrero R, Castellague X, Shah KV, et al. Epidemiologic classification of human papillomavirus types associated with cervical cancer. N Engl J Med 2003;348:518–27. Nelson JH, Hawkins GA, Edlund K, Evander M, Kjellberg L, Wadell G, et al. A novel and rapid PCR-based method for genotyping human papillomaviruses in clinical samples. J Clin Micro 2000;38:688–95. Nindl I, Lotz B, Kuhne-heid R, Endisch U, Schneider A. Distribution of 14 high-risk HPV types in cervical intraepithelial neoplasia detected by a non-radioactive general primer PCR mediated enzyme immunoassay. J Clin Pathol 1999;52:17–22. Pearson S. Liquid-based cytology: is the jury in? Biomed Sci 2002:597–9. Pizzighella S, Pisoni G, Bevilacqua F, Vaona A, Palu G. Simultaneous polymerase chain reaction detection and restriction typing for the diagnosis of human genital papillomavirus infection. J Virol Methods 1995;55:245–56. Poljak M, Marin IJ, Seme K, Vince A. Hybrid capture II HPV test detects at least 15 human papillomvirus genotypes not included in its current high-risk probe cocktail. J Clin Virol 2002;25:589–97. Rady PL, Chin R, Arany I, Hughes TK, Tyring SK. Direct sequencing of consensus primer generated PCR fragments of human papillomaviruses. J Virol Methods 1993;43:335–50.

Sotlar K, Diemer D, Dethleffs A, Hack Y, Stubner A, Vollmer N, et al. Detection and typing of human papillomavirus by E6 nested multiplex PCR. J Clin Microbiol 2004;42:3176–84. Storey A, Thomas M, Kalita A, Harwood C, Cardiol D, Mantovani F, et al. Role of a p53 polymorphism in the development of human papillomavirus-associated cancer. Nature 1998;393:229– 34. Strauss S, Desselberger U, Gray JJ. Detection of genital and cutaneous human papillomavirus types: differences in the sensitivity of generic PCRs, and consequences for clinical virological diagnosis. Br J Biomed Sci 2000;57:221–5. Villa LL, Bernard H, Kast M, Hildersheim A, Ametoy G, Franko EL. Past present and future of HPV research: highlights from the 19th International Papillomavirus Conference—HPV. Virus Res 2002;89:163– 73. Walboomers JMM, Jacobs MV, Manos MM, Bosch FX, Kummer JA, Shah KV, et al. Human papillomavirus is a necessary cause of invasive cervical cancer worldwide. J Pathol 1999;189: 12–9. ZurHausen H. Papillomavirus infection—a major cause of human cancers. Biochim Biophys Acta 1996:F55–78.