- Email: [email protected]
Augmenter of liver regeneration (ALR) restrains concanavalin A-induced hepatitis in mice
International Immunopharmacology 35 (2016) 280–286
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Augmenter of liver regeneration (ALR) restrains concanavalin A-induced hepatitis in mice Mao Mu a,b, Zhenwei Zhang b, Yi Cheng a,b, Guangze Liu b, Xiusheng Chen b, Xin Wu a, Caifang Zhuang b, Bingying Liu a, Xiangping Kong b,⁎, Song You a,⁎ a b
School of Life Science and Biopharmaceutical Sciences, Shenyang Pharmaceutical University, 103 Wenhua Road, Shenyang 110016, People's Republic of China Liver Disease Key Laboratory, Center of Infectious Diseases, 458 Hospital, 801 Dongfengdong Road, Guangzhou 510600, People's Republic of China
a r t i c l e
i n f o
Article history: Received 12 December 2015 Received in revised form 6 March 2016 Accepted 28 March 2016 Available online xxxx Keywords: Augmenter of liver regeneration Concanavalin A Hepatitis T cell activation MAPK NF-κB
a b s t r a c t Augmenter of liver regeneration (ALR), produced and released by hepatocytes, has cytoprotective and immunoregulatory effects on liver injury, and has been used in many experimental applications. However, little attention has been paid to the effects of ALR on concanavalin A (Con A)-induced hepatitis. The purpose of this paper is to explore the protective effect of ALR on Con A-induced hepatitis and elucidate potential mechanisms. We found that the ALR pretreatment evidently reduced the amount of ALT and AST in serum. In addition, proinflammatory cytokines, chemokines and iNOS were suppressed. ALR pretreatment also decreased CD4+, CD8+ T cell infiltration in liver. Besides, we observed that ALR pretreatment was capable of suppressing the activation of several signaling pathways in Con A-induced hepatitis. These findings suggest that ALR can obviously weaken Con A-induced hepatitis and ALR has some certain immune regulation function. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Liver diseases seriously threaten public health worldwide. There are a variety of factors that may lead to liver damage, such as viruses, drugs, alcohol, genetic factors or the patients' own immune system. Infections with hepatitis B or C viruses and autoimmune hepatitis are the most common causes of liver damage [1,2]. Concanavalin A (Con A)-induced hepatitis is an immune-mediated hepatic damage model. The pathophysiology of Con A-induced hepatitis is analogous to human hepatitis developed by virus or autoimmunity [3]. Pathological studies show that Con A injection elevates the activation of T cells which provokes production and secretion of a series of pro-inflammatory cytokines, such as TNF-α, IFN-γ and IL-6. These factors will enhance the recruitment and activation of immune cells infiltrating in liver, resulting in even more severe hepatic injury [4,5]. These processes vividly mimic the pathogenic mechanisms and pathological changes of patients with hepatitis. Previous findings reveal that augmenter of liver regeneration (ALR) encoded by GFER (growth factor ERV1 homolog of Saccharomyces
⁎ Corresponding authors. E-mail addresses: [email protected] (M. Mu), [email protected] (Z. Zhang), [email protected] (Y. Cheng), [email protected] (G. Liu), [email protected] (X. Chen), [email protected] (X. Wu), [email protected] (C. Zhuang), [email protected] (B. Liu), [email protected] (X. Kong), [email protected] (S. You).
http://dx.doi.org/10.1016/j.intimp.2016.03.040 1567-5769/© 2016 Elsevier B.V. All rights reserved.
cerevisiae) [6,7] plays many roles, such as sulfhydryl oxidase [8], cytochrome c reductase [9], hepatocyte survival factor [10] and inducer of cytosolic protein Fe/S maturation [11]. ALR also has a significant effect on the development of liver regeneration and liver cancer [12–14]. Besides, some experts reported that successful expression of ALR in liver could lighten liver fibrosis [15]. In terms of immune regulation, it is revealed that ALR cannot only enhance the effect of hepatocyte homotransplantations [16] but also have some influence on the activation of kupffer cells and NK cells [17–19]. However, little is known about its roles in immunological liver injury. Based on the previous studies, the following experiments were conducted to investigate the immune regulation effects of ALR and explicate its potential mechanisms in Con A-induced hepatitis. 2. Materials and methods 2.1. Mice and reagents Male BALB/c mice, from 6 to 8 weeks of age, were obtained from Laboratory Animal Center of Southern Medical University (China) and Medical Laboratory Animal Center of Guangdong (China). All the mice were housed in the animal facilities of 458 Hospital with free access to food and water. They were kept in an air-conditioned room at 23 ± 2 °C with a 12/12-h light and dark cycle. Before use, all the animals were allowed to acclimate for at least 1 week prior. Concanavalin A (CAS Number: 11028-71-0) was purchased from Sigma-Aldrich
M. Mu et al. / International Immunopharmacology 35 (2016) 280–286
Corporation. The human ALR-minicircle (mc-hALR) was conserved by Liver Disease Key Laboratory of No. 458 Hospital of People's Liberation Army (Guangdong, China). In brief, the full length of human ALR cDNA was subcloned into a ZY781 expression vector (a kind gift from Dr. Zhiying Chen, Stanford University) with a human cytomegalovirus immediate-early (CMV) promoter. Then, Escherichia coli strain ZYCY10P3S2T (a kind gift from Dr. Zhiying Chen, Stanford University) was transformed with the ZY781-CMV-hALR parental plasmids. A previously reported protocol [20] for minicircle production was used, and the minicircle was purified using an E.N.Z.A. Endo-free Plasmid Maxi Kit (Omega Biotek, USA).
281
extracts separated discontinuously were electrophoresis onto 10% polyacrylamide gels (Life Technologies, Carlsbad, CA, USA) and then transferred to nitrocellulose membranes (Life Technologies). Following blocking using milk, the blots were then incubated with various antibodies against ALR (Proteintech, USA), IκBα, phospho-IκBα, NF-κB p65, phospho-NF-κB p65, JNK, phospho-JNK, p38 MAPK and phosphop38 MAPK (Cell Signaling Technology, USA) overnight at 4 °C. The primary antibodies were washed by TBST and then the membranes were incubated with the secondary antibodies. After that, the secondary antibodies were washed by TBST, followed by applying Immobilon Western Chemiluminescent HRP Substrate (Millipore). The membranes were exposed in a dark room in order to get the blot results.
2.2. Animal treatment The male BALB/c mice were randomly divided into three groups: Control group, Con A group, and ALR group. Con A was intravenously injected into the mice so that the acute autoimmune hepatitis model was established successfully in Con A and ALR groups. Before the Con A administration, ALR gene was expressed by hydrodynamics-based transfection in ALR group. Briefly, mc-hALR (20 μg) was diluted in 2 mL of saline, and injected via the tail vein into the circulation within 8 to 10 s [21,22]. According to the parallel control principal, mice in the other two groups were injected with saline of the same volume with the same method. Two days after the hydrodynamics-based transfection, Con A was injected via tail vein at 15 mg/kg body mass in ALR and Con A groups. All procedures were performed in accordance with the Ethics Review Committee for Animal Experimentation of Institute of Clinical Pharmacology, 458 Hospital.
2.7. RNA preparation and analysis The expressions of iNOS, NF-κB, CXCL-10, CCL-3, TNF-α, IL-6 and IFN-γ mRNA were analyzed by quantitative real-time polymerase chain reaction (qPCR) technique. Liver samples were obtained 12 h after Con A administration. With Trizol reagent total RNA was isolated from the homogenate of the liver tissue. cDNA was synthesized from the same quantity of total RNA using GoScript™ Reverse Transcription System (Promega). Quantitative PCR was performed using FastStart Universal SYBR Green Master (Rox) (Roche) with ABI7500 Detection System (Life Technology). The cycles for qPCR were as follows: 95 °C for 30 s, 45 cycles of 95 °C for 10 s, 60 °C for 30 s. The primer sequence is described in Table 1. Results were analyzed by ddCt method.
2.3. Measurement of serum aminotransferase and cytokine secretion
2.8. Statistical analysis
The mice serum was collected from the retro-orbital sinus 8 h after Con A administration. Activities of the alanine aminotransferase (ALT) and the aspartate aminotransferase (AST) in serum were measured with BS-480 Chemistry Analyzer (Mindray, China). Besides, Enzymelinked immunosorbent assay kits (MultiSciences, China) were applied to detect IFN-γ, IL-6 and TNF-α in serum.
Data expressed are the mean values ± standard deviation. Statistical analysis was carried out by Prism 6.0 (Graph Pad Software). One-way analysis of variance (ANOVA) was used to compare all comparisons among groups. For multi-group analysis, intergroup difference was compared by Dunn's test. P b 0.05 was considered to indicate significantly different.
2.4. Isolation of hepatic mononuclear cells 3. Results Hepatic mononuclear cells (MNCs) were prepared essentially as previous reported [23]. In brief, liver tissues were cut up and infiltrated in 0.25% collagenase type II solution. Then they were shaken for 15 min in a 37 °C constant-temperature bath. Next, the liver specimen was crushed through a stainless mesh and the cell suspensions were poured slowly into the upper layer of 33% heparin percoll solution. The samples were centrifuged at 500g for 15 min and then discarded the supernatant. In order to remove the red blood cells, the cell precipitation was re-suspend in red blood cell lysis solution and then washed with PBS for 2 times. 2.5. Flow cytometry 12 h after the establishment of Con A-induced hepatitis model, MNCs suspensions of the liver were obtained. In order to identify lymphocytes, mononuclear cells were stained by PE-labeled anti-CD4 Ab (BD Biosciences, USA) and FITC-labeled CD8a Ab (BD Biosciences, USA). The counts of infiltrating CD4+ and CD8+ T cells in the liver were analyzed by BD FACS Calibur (BD Biosciences, USA). 2.6. Western-blotting analysis Livers were carefully prepared with lysis buffer (Thermo, USA) to yield a homogenate. After centrifugation (12,000g for 15 min) at 4 °C, the protein concentration of the supernatants was detected by BCA Protein Quantitation Kit (Biocolors, China). Equal amounts of protein
3.1. mc-hALR ameliorated Con A-induced liver damage With the hydrodynamics-based transfection of mc-ALR, the protein levels of ALR in liver were significantly increased in ALR group comparing to the control group and Con A group (Fig. 1A). After the acute liver injury induced by Con A, the level of serum ALT and AST were much higher in the Con A group relative to the control group. However, the serum transaminase in the ALR group was obviously blocked compared to the Con A group (Fig. 1B). Additionally, in the survival experiment (Con A, 30 mg/kg), the ALR group had a 40% survival rate, whereas the entire control group succumbed to the lethal dose (Fig. 1C). Taken together, these results suggest that ALR ameliorates Con A-induced liver damage. Table 1 Quantitative real-time PCR primer sequences. Gene
Forward (5′-3′)
Reverse (5′-3′)
TNF-α IL-6 IFN-γ iNOS NF-κB CXCL-10 CCL-3 GAPDH
CACGTCGTAGCAAACCACCAAGTGGA TCCTCTCTGCAAGAGACTTCC GCTGCTGATGGGAGGAGATG GGAGCGAGTTGTGGATTGTC GGTGGAGGCATGTTCGGTAG CTGTAAGCTATGTGGAGGTGCG ACCTGGAACTGAATGCCTGAG TCCACTCACGGCAAATTCAAC
TGGGAGTAGACAAGGTACAACCC TTGTGAAGTAGGGAAGGCCG GGGAAGCACCAGGTGTCAAG GGGTCGTAATGTCCAGGAAGTA ACTCTTGGCACAATCTTTAGGG GCTAGGGAGGACAAGGAGGG AGTGAAGAGTCCCTCGATGTG GTAGACTCCACGACATACTCAGC
282
M. Mu et al. / International Immunopharmacology 35 (2016) 280–286
Fig. 1. The effect of ALR pretreatment on hepatic injury in mice. (A) ALR was determined using Western blot analysis at 48 h after hydrodynamics-based transfection. The GAPDH was used as an internal control. (B) Blood samples were obtained from the retro-orbital sinus at 8 h after Con A injection, and ALT/AST levels were measured. (C) Survival was monitored after the injection of a lethal dose of Con A (30 mg/kg). Data are expressed as mean ± SEM (n = 5–6). *P b 0.05 vs. Control group, #P b 0.05 vs. Con A group.
3.2. ALR inhibited the release of pro-inflammatory cytokines Accumulating evidences demonstrates that Con A-induced liver injury is mediated by pro-inflammatory cytokines, such as IFN-γ, IL-6, and TNF-α [24]. In this study, IFN-γ, IL-6, and TNF-α in serum and liver tissue were measured by ELISA and qPCR. After Con-A administration intravenously, these pro-inflammatory cytokines were significantly increased in serum. Treatment with ALR significantly reduced the levels of TNF-α and IL-6, but failed to affect IFN-γ (Fig. 2A). Subsequently, the mRNA level in liver followed the same trend with the protein levels in
liver (Fig. 2B). These findings suggest that ALR reduces the release of TNF-α and IL-6. 3.3. Effects of ALR on CD4+, CD8+ T cells infiltrating in the liver There is striking evidence indicating that T cells play a critical role in Con A-induced liver injury [3,25]. In our study, the percentage of CD4+ and CD8+ cells in the liver were calculated by flow cytometry. As expected, the percentage of CD4+, CD8+ and T cells were increased strongly after Con A injection (Fig. 3). Nevertheless, the percentage of
Fig. 2. The effects of ALR pretreatment on the levels of TNF-α, IL-6 and IFN-γ in Con A-induced liver injury. (A) 8 h after Con A administration, the protein concentrations of TNF-α, IL-6 and IFN-γ in serum were detected by ELISA kits. (B) 12 h after Con A injection, the levels of mRNA expression in the liver were examined by quantitative real-time PCR. Data are expressed as mean ± SEM (n = 6). **P b 0.01 vs. Control group, ##P b 0.01 vs. Con A group, #P b 0.05 vs. Con A group.
M. Mu et al. / International Immunopharmacology 35 (2016) 280–286
283
Fig. 3. The effects of ALR pretreatment on T lymphocytes infiltrated in the liver. Hepatic mononuclear cells were isolated from each group at 12 h after injection of Con A, and analyzed by flow cytometry. (A) Representative images of CD4+ T cells and CD8+ T cells from the three groups are shown. (B) The percentage of CD4+ and CD8+ T cells in liver were increased significantly following Con A administration without ALR pretreatment comparing to the ALR group. Data are expressed as mean ± SEM (n = 6). **P b 0.01 vs. Control group, ## P b 0.01 vs. Con A group.
infiltrating CD4+ and CD8+ cells went down significantly in ALR group. These data indicate that ALR can dramatically lessen CD4+ and CD8+ T cells recruiting into the liver. 3.4. ALR inhibited chemokines expression in the liver The up-regulation of chemokines, such as CXCL-10 and CCL-3, has been reported to play a critical role in Con A-induced liver injury. Thus, CXCL-10 and CCL-3 in the liver were detected. As expected (Fig. 4), the mRNA of them was enhanced greatly with Con A administration, but changed little in ALR group. These results show that ALR can decrease the expression of chemokines in Con A-induced liver injury. 3.5. Influence of ALR on NF-κB pathway in Con A-induced hepatitis Since the transcription factor NF-κB is correlated with inflammatory response, we addressed the question that if the mechanism of ALR attenuating the liver injury is due to its influence on NF-κB activation. To investigate the effects of ALR on NF-κB activation we measured the levels of phosphorylation of IκBα and p65 in the liver by Western blot
analysis. Compared with Con A group IκBα and p65 phosphorylation were inhibited markedly by ALR pretreatment (Fig. 5A). Furthermore, the intrahepatic mRNA expression of NF-κB was detected. The overexpression of NF-κB gene was blocked significantly in ALR group (Fig. 5B). These results show that ALR inhibits Con A-induced hepatitis through the NF-κB pathway.
3.6. Influence of ALR on JNK and p38 MAPK activation It is reported that JNK and p38 MAPK pathway have been linked to the expression of Chemokines. p38 MAPK plays a key role in the generation of many inflammatory factors [26]. The interaction among JNK, p38 MAPK and NF-kB has been reported before. [27] In order to investigate the effects of ALR on JNK and p38 MAPK pathway, the JNK, phospho-JNK, p38 MAPK and phospho-p38 MAPK were detected in our study. Con A treatment increased the phosphorylation of JNK and p38 obviously. However, the ALR pretreatment showed a strong inhibition of the phosphorylation of them (Fig. 6A). These results reveal that JNK and p38 MAPK are inhibited by ALR.
Fig. 4. The effects of ALR pretreatment on chemokines. 12 h after Con A injection, the mRNA of CXCL-10 and CCL-3 in the liver were examined by quantitative real-time PCR. Data are expressed as mean ± SEM (n = 6). **P b 0.01 vs. Control group, ##P b 0.01 vs. Con A group, #P b 0.05 vs. Con A group.
284
M. Mu et al. / International Immunopharmacology 35 (2016) 280–286
Fig. 5. The effects of ALR pretreatment on NF-κB. Liver tissues were harvested 12 h after Con A administration. (A) Hepatic NF-κB protein levels were analyzed by Western blot with antibodies against IκBα, phospho-IκBα, NF-κB p65, and phospho-NF-κB p65. The GAPDH was used as an internal control. (B) The levels of NF-κB mRNA were determined by quantitative real-time PCR. Data are expressed as mean ± SEM (n = 6). **P b 0.01 vs. Control group, #P b 0.05 vs. Con A group.
3.7. Effects of ALR on iNOS Previous studies have shown that iNOS played a vital role in immune regulation. In our research, the expression level of iNOS mRNA was detected. We found Con A could drastically elevate the expression of iNOS, but ALR greatly inhibited it (Fig. 6B). Based on these results, we conclude that ALR regulates the expression of iNOS while exerting protective effects against Con A-induced hepatitis injury. 4. Discussion ALR is a kind of liver regeneration enhancer. Previous studies have focused on ALR's role in promoting liver regeneration and enhancing mitochondrial gene expression. However, little attention has been devoted to its regulation function in immune-mediated hepatitis. In this paper, the treatment effects of ALR on Con A-induced hepatitis were investigated. The mice were induced liver injury by Con A and showed high serum levels of ALT and AST, but the transaminase in serum was strongly decreased by ALR treatment. Additionally, ALR treatment showed an overwhelming superiority of survival time and survival rate over Con A-induced group. These results demonstrate that the increase of ALR expression in liver undoubtedly attenuates hepatic injury in the mice with Con A induced hepatitis. It is also reported that ALR stimulates kupffer cells to produce TNF-α, IL6 and iNOS so that the
liver regeneration is enhanced [18]. These effects involving antiinflammation and immune regulation led us to explore the potential beneficial mechanisms of ALR. Growing evidence has shown that immunoregulatory cytokines play a pivotal role in the pathogenesis of Con A-induced hepatitis. The upregulation of TNF-α directly leads to hepatocellular apoptosis and necrosis [28,29]. Studies also have shown that antibodies against TNF-α could attenuate Con A-induced liver injury in mice [30]. Similar finding is confirmed in TNF−/− mice [28]. In addition, IL-6 has been confirmed to be one of the main factors which was responsible for liver injury [31]. iNOS is mainly remained in macrophages and hepatocytes and it can be induced by TNF-α [32,33]. Different iNOS concentrations might implement opposite immune regulating function [34]. In this study, we found that treatment with ALR not only strongly reduced the levels of these pro-inflammatory cytokines in serum but also obviously down regulated the mRNA expression of these pro-inflammatory cytokines in liver, demonstrating that ALR pretreatment suppressed hepatic proinflammatory cytokines. It is generally believed that during the development of Con Ainduced hepatitis, kinds of lymphocytes, such as T lymphocyte, natural killer T cell and macrophages, have been recruited to the liver with large release of pro-inflammatory cytokines. These infiltrating lymphocytes in intrahepatic will affect the severity of liver injury to a certain extent [25,35–37]. Among these lymphocytes, CD4+ and CD8+ T cell play
Fig. 6. The effects of ALR pretreatment on JNK, p38 MAPK and iNOS. Liver tissues were harvested 12 h after Con A administration. (A) Hepatic JNK and p38 MAPK protein levels were analyzed by Western blot with antibodies against JNK, phospho-JNK, p38-MAPK, and phospho-p38-MAPK. The GAPDH was used as an internal control. (B) The levels of iNOS mRNA were determined by quantitative real-time PCR. Data are expressed as mean ± SEM (n = 6). **P b 0.01 vs. Control group, #P b 0.05 vs. Con A group.
M. Mu et al. / International Immunopharmacology 35 (2016) 280–286
the dominant roles. Previous researches reveal that while CD4+ T cell is removed by anti-CD4 monoclonal antibodies, the mice with Con A injection won't develop hepatitis [3,24]. Besides, FK506 (a T cell specific immunosuppressive drug) administration also fails the mice with Con A injection to develop hepatitis [38]. In our research, we found that CD4+ and CD8+ T cell were greatly enhanced due to Con A injection. But with ALR pretreatment, CD4+ and CD8+ T cell were strongly diminished. These lines of evidence indicate that ALR can protect hepatitis from being severely injured by Con A injection, and CD4+ and CD8+ T cell infiltration will be suppressed in the liver during this process. Up-regulated expression of chemokines such as CXCL-10 and CCL-3 has been reported to play a critical role in the development of Con A induced hepatitis [39]. T lymphocytic infiltration is intimately linked with the chemokine up-regulation [40,41]. Along with the increase of T lymphocytes, there is a boost in the expression of IFN-γ and TNF-α. These pro-inflammatory cytokines stimulate the production of chemokines further. Therefore, an amplification feedback loop which induces liver injury will be formed [42]. In our study, the expression of CXCL-10 and CCL-3 mRNA was down regulated with ALR pretreatment in the liver induced by Con A, resulting in reduced T lymphocytic infiltration. To shed more light on the protective effects of ALR against Con Ainduced hepatitis, we therefore explore how ALR impacts on intrahepatic NF-κB level in the model. Nuclear factor kappa B (NF-κB) works as a nuclear transcription factor which regulates the expression of a large number of genes. These transcription factors are critical in viral replication, tumorigenesis, inflammation, and various autoimmune diseases [43,44]. There is now substantial evidence indicating that the blockade of NF-κB activation not only attenuates Con Ainduced liver injury but also decreases the secretion of inflammatory molecules [45,46]. Some experts point out that ALR shows its effects by regulating NF-κB signaling pathway [47]. Similarly, in our study, the expression of NF-κB, the phosphorylation IκBα and p65 were upregulated after Con A injection, but all the up-regulation was inhibited severely with ALR pretreatment. Thus, there is no denying the fact that NF-κB signaling pathway plays a certain role in the development of Con A-induced hepatitis and the protective effects against Con Ainduced liver injury of ALR seem to be related to the inhibition of NFκB signaling pathway. The role of JNK in liver inflammation has been studied in Con A model before. The binding of TNF-α to its receptors results in JNK activation, which further induces NF-κB activation. p38 MAPK can regulate inflammatory cytokines expression by modulating NF-κB [48]. As the modulators of multiple genes, JNK and p38 MAPK play important roles both on innate and adaptive immunity. The phosphorylation of JNK and p38 MAPK activates T cell, resulting in abundant release of cytokines, such as TNF-α and IL-6. In this report, ALR shows a strong inhibition of the phosphorylation of JNK and p38 MAPK, which leads to down regulation of T cells activation. Therefore, the inflammatory cytokine expression is inhibited and the liver damage is attenuated consequently. In partial hepatectomy rats, ALR activates the NF-κB signaling pathway and enhances the expression of TNF-α, IL6 and iNOS [18]. It is reported that in acute liver failure rats ALR suppresses the infiltration of both kupffer cells and T lymphocytes. ALR also shows the ability to down-regulate the increase of pro-inflammatory cytokines induced by the acute hepatic failure [16]. In our experiments, the expression of chemokines and NF-κB signaling pathway were obviously restrained by ALR, which inhibited the infiltration and activation of T cell. Consequently, these studies indicate that ALR demonstrates multiple regulatory effects which lead to various results in different animal models and different pathological states. 5. Conclusion In conclusion, our study proves that ALR can attenuate Con Ainduced hepatitis injury by inhibiting the infiltration of both CD4+ and CD8+ T cells. The release of pro-inflammatory cytokines in liver
285
has been restrained due to the suppression of NF-κB signaling pathway. From the current results, it seems reasonable to conclude that ALR has protective effects on T cell mediated immunological liver injury, and these findings raised the promising potential of developing ALR as a therapeutic agent for T cell mediated liver diseases. And the realization of this function seems to be attributed to the NF-κB pathway inhibition of T cell by ALR.
Acknowledgments This work was funded by the National Major Science and Technology for Infectious Diseases of China (2012ZX10004503).
References [1] M. Minemura, Liver involvement in systemic infection, WJH 6 (2014) 632–642, http://dx.doi.org/10.4254/wjh.v6.i9.632. [2] M. Carbone, J.M. Neuberger, Autoimmune liver disease, autoimmunity and liver transplantation, J. Hepatol. 60 (2014) 210–223, http://dx.doi.org/10.1016/j.jhep. 2013.09.020. [3] G. Tiegs, J. Hentschel, A. Wendel, A T cell-dependent experimental liver injury in mice inducible by concanavalin A, J. Clin. Investig. 90 (1992) 196–203, http://dx. doi.org/10.1172/JCI115836. [4] H.-X. Wang, M. Liu, S.-Y. Weng, J.-J. Li, C. Xie, H.-L. He, et al., Immune mechanisms of Concanavalin A model of autoimmune hepatitis, World J. Gastroenterol. 18 (2012) 119–125, http://dx.doi.org/10.3748/wjg.v18.i2.119. [5] X. Shao, Y. Qian, C. Xu, B. Hong, W. Xu, L. Shen, et al., The protective effect of intrasplenic transplantation of Ad-IL-18BP/IL-4 gene-modified fetal hepatocytes on ConA-induced hepatitis in mice, PLoS One 8 (2013) e58836, http://dx.doi.org/ 10.1371/journal.pone.0058836. [6] A. Francavilla, M. Hagiya, K.A. Porter, L. Polimeno, I. Ihara, T.E. Starzl, Augmenter of liver regeneration: its place in the universe of hepatic growth factors, Hepatology 20 (1994) 747–757. [7] C.R. Gandhi, Augmenter of liver regeneration, Fibrogenesis Tissue Repair 5 (2012) 10, http://dx.doi.org/10.1186/1755-1536-5-10. [8] A. Tury, G. Mairet-Coello, T. Lisowsky, B. Griffond, D. Fellmann, Expression of the sulfhydryl oxidase ALR (augmenter of liver regeneration) in adult rat brain, Brain Res. 1048 (2005) 87–97, http://dx.doi.org/10.1016/j.brainres.2005.04.050. [9] S.R. Farrell, C. Thorpe, Augmenter of liver regeneration: a flavin-dependent sulfhydryl oxidase with cytochrome c reductase activity†, Biochemistry 44 (2005) 1532–1541, http://dx.doi.org/10.1021/bi0479555. [10] C. Thirunavukkarasu, L.F. Wang, S.A.K. Harvey, S.C. Watkins, J.R. Chaillet, J. Prelich, et al., Augmenter of liver regeneration: an important intracellular survival factor for hepatocytes, J. Hepatol. 48 (2008) 578–588, http://dx.doi.org/10.1016/j.jhep. 2007.12.010. [11] H. Lange, T. Lisowsky, J. Gerber, U. Mühlenhoff, G. Kispal, R. Lill, An essential function of the mitochondrial sulfhydryl oxidase Erv1p/ALR in the maturation of cytosolic Fe/ S proteins, EMBO Rep. 2 (2001) 715–720, http://dx.doi.org/10.1093/embo-reports/ kve161. [12] Y. Li, M. Farooq, D. Sheng, C. Chandramouli, T. Lan, N.K. Mahajan, et al., Augmenter of liver regeneration (alr) promotes liver outgrowth during zebrafish hepatogenesis, PLoS One 7 (2012), e30835http://dx.doi.org/10.1371/journal.pone.0030835. [13] Liver-specific deletion of augmenter of liver regeneration accelerates development of steatohepatitis and hepatocellular carcinoma in mice, 148 (2015) 379–391.e4, http://dx.doi.org/10.1053/j.gastro.2014.10.008. [14] R. Dayoub, H. Wagner, F. Bataille, O. Stöltzing, T. Spruss, C. Buechler, et al., Liver regeneration associated protein (ALR) exhibits antimetastatic potential in hepatocellular carcinoma, Mol. Med. 17 (2011) 221–228, http://dx.doi.org/10.2119/molmed. 2010.00117. [15] M. Song, X. Yi, W. Chen, Y. Yuan, X. Zhang, J. Li, et al., Biochemical and biophysical research communications, Biochem. Biophys. Res. Commun. 415 (2011) 152–156, http://dx.doi.org/10.1016/j.bbrc.2011.10.039. [16] N. Wang, Z. Wang, H. Sun, X. Shi, Y. Zhang, Q. Liu, Augmenter of liver regeneration improves therapeutic effect of hepatocyte homotransplantation in acute liver failure rats, Int. Immunopharmacol. 15 (2013) 325–332, http://dx.doi.org/10.1016/j.intimp. 2013.01.002. [17] A. Francavilla, N.L. Vujanovic, L. Polimeno, A. Azzarone, A. Iacobellis, A. Deleo, et al., The in vivo effect of hepatotrophic factors augmenter of liver regeneration, hepatocyte growth factor, and insulin-like growth factor-II on liver natural killer cell functions, Hepatology 25 (1997) 411–415, http://dx.doi.org/10.1002/hep.510250225. [18] C.R. Gandhi, N. Murase, T.E. Starzl, Cholera toxin-sensitive GTP-binding proteincoupled activation of augmenter of liver regeneration (ALR) receptor and its function in rat kupffer cells, J. Cell. Physiol. 222 (2010) 365–373, http://dx.doi.org/10. 1002/jcp.21957. [19] K. Yang, C. Du, Y. Cheng, Y. Li, J. Gong, Z. Liu, Augmenter of liver regeneration promotes hepatic regeneration depending on the integrity of Kupffer cell in rat smallfor-size liver transplantation, J. Surg. Res. 183 (2013) 922–928, http://dx.doi.org/ 10.1016/j.jss.2013.02.033. [20] M.A. Kay, C.-Y. He, Z.-Y. Chen, A robust system for production of minicircle DNA vectors, Nat. Biotechnol. 28 (2010) 1287–1289, http://dx.doi.org/10.1038/nbt.1708.
286
M. Mu et al. / International Immunopharmacology 35 (2016) 280–286
[21] J. Yang, S. Chen, L. Huang, G.K. Michalopoulos, Sustained expression of naked plasmid DNA encoding hepatocyte growth factor in mice promotes liver and overall body growth, Hepatology (2001)http://dx.doi.org/10.1053/jhep.2001.23438. [22] F. Liu, Y. Song, D. Liu, Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA, Gene Ther. 6 (1999) 1258–1266, http://dx.doi.org/10. 1038/sj.gt.3300947. [23] H. Dobashi, S. Seki, Y. Habu, T. Ohkawa, S. Takeshita, H. Hiraide, et al., Activation of mouse liver natural killer cells and NK1.1(+) T cells by bacterial superantigenprimed Kupffer cells, Hepatology 30 (1999) 430–436, http://dx.doi.org/10.1002/ hep.510300209. [24] K. Lv, Y. Zhang, M. Zhang, M. Zhong, Q. Suo, Galectin-9 ameliorates Con A-induced hepatitis by inducing CD4 + CD25low/int effector T-Cell apoptosis and increasing regulatory T cell number, PLoS One 7 (2012), e48379http://dx.doi.org/10.1371/ journal.pone.0048379. [25] C. Liu, L. Zhang, S. Gao, Z. qu, Q. Wang, F. Zhu, et al., NCPP treatment alleviates ConAinduced hepatitis via reducing CD4 + T activation and NO production, Immunopharmacol. Immunotoxicol. 34 (2012) 962–967, http://dx.doi.org/10. 3109/08923973.2012.680065. [26] E.F. Wagner, Á.R. Nebreda, Signal Integration by JNK and p38 MAPK Pathways in Cancer Development, 2009 1–13, http://dx.doi.org/10.1038/nrc2694. [27] A. Wullaert, K. Heyninck, R. Beyaert, Mechanisms of crosstalk between TNF-induced NF-κB and JNK activation in hepatocytes, Biochem. Pharmacol. 72 (2006) 1090–1101, http://dx.doi.org/10.1016/j.bcp.2006.07.003. [28] Y. Tagawa, K. Sekikawa, Y. Iwakura, Suppression of concanavalin A-induced hepatitis in IFN-gamma(−/−) mice, but not in TNF-alpha(−/−) mice: role for IFNgamma in activating apoptosis of hepatocytes, J. Immunol. 159 (1997) 1418–1428. [29] A. Kano, T. Haruyama, T. Akaike, Y. Watanabe, IRF-1 is an essential mediator in IFNγ-induced cell cycle arrest and apoptosis of primary cultured hepatocytes, Biochem. Biophys. Res. Commun. 257 (1999) 672–677, http://dx.doi.org/10.1006/bbrc.1999. 0276. [30] S. Kusters, F. Gantner, G. Kunstle, G. Tiegs, Interferon gamma plays a critical role in T cell-dependent liver injury in mice initiated by concanavalin A, Gastroenterology 111 (1996) 462–471, http://dx.doi.org/10.1053/gast.1996.v111.pm8690213. [31] J. Liang, B. Zhang, R.-W. Shen, J.-B. Liu, M.-H. Gao, Y. Li, et al., Preventive effect of halofuginone on concanavalin A-induced liver fibrosis, PLoS One 8 (2013) e82232, http://dx.doi.org/10.1371/journal.pone.0082232. [32] D.A. Geller, A.K. Nussler, M. Di Silvio, C.J. Lowenstein, R.A. Shapiro, S.C. Wang, et al., Cytokines, endotoxin, and glucocorticoids regulate the expression of inducible nitric oxide synthase in hepatocytes, Proc. Natl. Acad. Sci. 90 (1993) 522–526, http://dx. doi.org/10.1073/pnas.90.2.522. [33] H. Kleinert, P.M. Schwarz, U. Förstermann, Regulation of the expression of inducible nitric oxide synthase, Biol. Chem. (2003)http://dx.doi.org/10.1515/BC.2003.152. [34] O.M. Kenny, C.M. McCarthy, N.P. Brunton, M.B. Hossain, D.K. Rai, S.G. Collins, et al., Anti-inflammatory properties of potato glycoalkaloids in stimulated Jurkat and Raw 264.7 mouse macrophages, Life Sci. 92 (2013) 775–782, http://dx.doi.org/10. 1016/j.lfs.2013.02.006. [35] M. Margalit, S.A. Ghazala, R. Alper, E. Elinav, A. Klein, V. Doviner, et al., Glucocerebroside treatment ameliorates ConA hepatitis by inhibition of NKT
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
[46] [47]
[48]
lymphocytes, Am. J. Physiol. Gastrointest. Liver Physiol. 289 (2005) G917–G925, http://dx.doi.org/10.1152/ajpgi.00105.2005. L. Xu, J. Qi, P. Zhao, X. Liang, Y. Ju, P. Liu, et al., T cell immunoglobulin- and mucindomain-containing molecule-4 attenuates concanavalin A-induced hepatitis by regulating macrophage, J. Leukoc. Biol. 88 (2010) 329–336, http://dx.doi.org/10.1189/ jlb.1209797. V. Volarevic, M. Milovanovic, B. Ljujic, N. Pejnovic, N. Arsenijevic, U. Nilsson, et al., Galectin‐3 deficiency prevents concanavalin A–induced hepatitis in mice, Hepatology 55 (2012) 1954–1964, http://dx.doi.org/10.1002/hep.25542. H. Mizuhara, E. O'Neill, N. Seki, T. Ogawa, C. Kusunoki, K. Otsuka, et al., T cell activation-associated hepatic injury: mediation by tumor necrosis factors and protection by interleukin 6, J. Exp. Med. 179 (1994) 1529–1537, http://dx.doi.org/10. 1084/jem.179.5.1529. A.A. Maghazachi, Role of chemokines in the biology of natural killer cells, The Chemokine System in Experimental and Clinical Hematology, Springer Berlin Heidelberg, Berlin, Heidelberg 2010, pp. 37–58, http://dx.doi.org/10.1007/82_2010_20. C.-T. Tu, B. Han, H.-C. Liu, S.-C. Zhang, Curcumin protects mice against concanavalin A-induced hepatitis by inhibiting intrahepatic intercellular adhesion molecule-1 (ICAM-1) and CXCL10 expression, Mol. Cell. Biochem. 358 (2011) 53–60, http:// dx.doi.org/10.1007/s11010-011-0920-4. L. Cao, Y. Zou, J. Zhu, X. Fan, J. Li, Ginsenoside Rg1 attenuates concanavalin A-induced hepatitis in mice through inhibition of cytokine secretion and lymphocyte infiltration, Mol. Cell. Biochem. 380 (2013) 203–210, http://dx.doi.org/10.1007/s11010013-1674-y. A. Antonelli, S.M. Ferrari, D. Giuggioli, E. Ferrannini, C. Ferri, P. Fallahi, Chemokine (C–X–C motif) ligand (CXCL)10 in autoimmune diseases, Autoimmun. Rev. 13 (2014) 272–280. A.S. Baldwin Jr., THE NF-κB AND IκB PROTEINS: new discoveries and insights, Annu. Rev. Immunol. 14 (1996) 649–681, http://dx.doi.org/10.1146/annurev.immunol.14. 1.649. G. Bonizzi, M. Karin, The two NF-κB activation pathways and their role in innate and adaptive immunity, Trends Immunol. 25 (2004) 280–288, http://dx.doi.org/10. 1016/j.it.2004.03.008. D. Feng, Y. Mei, Y. Wang, B. Zhang, C. Wang, L. Xu, Tetrandrine protects mice from concanavalin A-induced hepatitis through inhibiting NF-κB activation, Immunol. Lett. 121 (2008) 127–133, http://dx.doi.org/10.1016/j.imlet.2008.10.001. N.D. Perkins, Integrating cell-signalling pathways with NF-κB and IKK function, Nat. Rev. Mol. Cell Biol. 8 (2007) 49–62, http://dx.doi.org/10.1038/nrm2083. Y. Li, L. Zhang, Q. Liu, G.-T. Chen, H. Sun, Exogenous augmenter of liver regeneration (ALR) attenuates inflammatory response in renal hypoxia re-oxygenation injury, Ren. Fail. 36 (2014) 432–436, http://dx.doi.org/10.3109/0886022X.2013.867811. J.H. Lee, J.H. Won, J.M. Choi, H.H. Cha, Y.J. Jang, S. Park, et al., Protective effect of ellagic acid on concanavalin A-induced hepatitis via toll-like receptor and mitogen-activated protein kinase/nuclear factor κB signaling pathways, J. Agric. Food Chem. 62 (2014) 10110–10117, http://dx.doi.org/10.1021/jf503188c.
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Augmenter of liver regeneration (ALR) restrains concanavalin A-induced hepatitis in mice Mao Mu a,b, Zhenwei Zhang b, Yi Cheng a,b, Guangze Liu b, Xiusheng Chen b, Xin Wu a, Caifang Zhuang b, Bingying Liu a, Xiangping Kong b,⁎, Song You a,⁎ a b
School of Life Science and Biopharmaceutical Sciences, Shenyang Pharmaceutical University, 103 Wenhua Road, Shenyang 110016, People's Republic of China Liver Disease Key Laboratory, Center of Infectious Diseases, 458 Hospital, 801 Dongfengdong Road, Guangzhou 510600, People's Republic of China
a r t i c l e
i n f o
Article history: Received 12 December 2015 Received in revised form 6 March 2016 Accepted 28 March 2016 Available online xxxx Keywords: Augmenter of liver regeneration Concanavalin A Hepatitis T cell activation MAPK NF-κB
a b s t r a c t Augmenter of liver regeneration (ALR), produced and released by hepatocytes, has cytoprotective and immunoregulatory effects on liver injury, and has been used in many experimental applications. However, little attention has been paid to the effects of ALR on concanavalin A (Con A)-induced hepatitis. The purpose of this paper is to explore the protective effect of ALR on Con A-induced hepatitis and elucidate potential mechanisms. We found that the ALR pretreatment evidently reduced the amount of ALT and AST in serum. In addition, proinflammatory cytokines, chemokines and iNOS were suppressed. ALR pretreatment also decreased CD4+, CD8+ T cell infiltration in liver. Besides, we observed that ALR pretreatment was capable of suppressing the activation of several signaling pathways in Con A-induced hepatitis. These findings suggest that ALR can obviously weaken Con A-induced hepatitis and ALR has some certain immune regulation function. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Liver diseases seriously threaten public health worldwide. There are a variety of factors that may lead to liver damage, such as viruses, drugs, alcohol, genetic factors or the patients' own immune system. Infections with hepatitis B or C viruses and autoimmune hepatitis are the most common causes of liver damage [1,2]. Concanavalin A (Con A)-induced hepatitis is an immune-mediated hepatic damage model. The pathophysiology of Con A-induced hepatitis is analogous to human hepatitis developed by virus or autoimmunity [3]. Pathological studies show that Con A injection elevates the activation of T cells which provokes production and secretion of a series of pro-inflammatory cytokines, such as TNF-α, IFN-γ and IL-6. These factors will enhance the recruitment and activation of immune cells infiltrating in liver, resulting in even more severe hepatic injury [4,5]. These processes vividly mimic the pathogenic mechanisms and pathological changes of patients with hepatitis. Previous findings reveal that augmenter of liver regeneration (ALR) encoded by GFER (growth factor ERV1 homolog of Saccharomyces
⁎ Corresponding authors. E-mail addresses: [email protected] (M. Mu), [email protected] (Z. Zhang), [email protected] (Y. Cheng), [email protected] (G. Liu), [email protected] (X. Chen), [email protected] (X. Wu), [email protected] (C. Zhuang), [email protected] (B. Liu), [email protected] (X. Kong), [email protected] (S. You).
http://dx.doi.org/10.1016/j.intimp.2016.03.040 1567-5769/© 2016 Elsevier B.V. All rights reserved.
cerevisiae) [6,7] plays many roles, such as sulfhydryl oxidase [8], cytochrome c reductase [9], hepatocyte survival factor [10] and inducer of cytosolic protein Fe/S maturation [11]. ALR also has a significant effect on the development of liver regeneration and liver cancer [12–14]. Besides, some experts reported that successful expression of ALR in liver could lighten liver fibrosis [15]. In terms of immune regulation, it is revealed that ALR cannot only enhance the effect of hepatocyte homotransplantations [16] but also have some influence on the activation of kupffer cells and NK cells [17–19]. However, little is known about its roles in immunological liver injury. Based on the previous studies, the following experiments were conducted to investigate the immune regulation effects of ALR and explicate its potential mechanisms in Con A-induced hepatitis. 2. Materials and methods 2.1. Mice and reagents Male BALB/c mice, from 6 to 8 weeks of age, were obtained from Laboratory Animal Center of Southern Medical University (China) and Medical Laboratory Animal Center of Guangdong (China). All the mice were housed in the animal facilities of 458 Hospital with free access to food and water. They were kept in an air-conditioned room at 23 ± 2 °C with a 12/12-h light and dark cycle. Before use, all the animals were allowed to acclimate for at least 1 week prior. Concanavalin A (CAS Number: 11028-71-0) was purchased from Sigma-Aldrich
M. Mu et al. / International Immunopharmacology 35 (2016) 280–286
Corporation. The human ALR-minicircle (mc-hALR) was conserved by Liver Disease Key Laboratory of No. 458 Hospital of People's Liberation Army (Guangdong, China). In brief, the full length of human ALR cDNA was subcloned into a ZY781 expression vector (a kind gift from Dr. Zhiying Chen, Stanford University) with a human cytomegalovirus immediate-early (CMV) promoter. Then, Escherichia coli strain ZYCY10P3S2T (a kind gift from Dr. Zhiying Chen, Stanford University) was transformed with the ZY781-CMV-hALR parental plasmids. A previously reported protocol [20] for minicircle production was used, and the minicircle was purified using an E.N.Z.A. Endo-free Plasmid Maxi Kit (Omega Biotek, USA).
281
extracts separated discontinuously were electrophoresis onto 10% polyacrylamide gels (Life Technologies, Carlsbad, CA, USA) and then transferred to nitrocellulose membranes (Life Technologies). Following blocking using milk, the blots were then incubated with various antibodies against ALR (Proteintech, USA), IκBα, phospho-IκBα, NF-κB p65, phospho-NF-κB p65, JNK, phospho-JNK, p38 MAPK and phosphop38 MAPK (Cell Signaling Technology, USA) overnight at 4 °C. The primary antibodies were washed by TBST and then the membranes were incubated with the secondary antibodies. After that, the secondary antibodies were washed by TBST, followed by applying Immobilon Western Chemiluminescent HRP Substrate (Millipore). The membranes were exposed in a dark room in order to get the blot results.
2.2. Animal treatment The male BALB/c mice were randomly divided into three groups: Control group, Con A group, and ALR group. Con A was intravenously injected into the mice so that the acute autoimmune hepatitis model was established successfully in Con A and ALR groups. Before the Con A administration, ALR gene was expressed by hydrodynamics-based transfection in ALR group. Briefly, mc-hALR (20 μg) was diluted in 2 mL of saline, and injected via the tail vein into the circulation within 8 to 10 s [21,22]. According to the parallel control principal, mice in the other two groups were injected with saline of the same volume with the same method. Two days after the hydrodynamics-based transfection, Con A was injected via tail vein at 15 mg/kg body mass in ALR and Con A groups. All procedures were performed in accordance with the Ethics Review Committee for Animal Experimentation of Institute of Clinical Pharmacology, 458 Hospital.
2.7. RNA preparation and analysis The expressions of iNOS, NF-κB, CXCL-10, CCL-3, TNF-α, IL-6 and IFN-γ mRNA were analyzed by quantitative real-time polymerase chain reaction (qPCR) technique. Liver samples were obtained 12 h after Con A administration. With Trizol reagent total RNA was isolated from the homogenate of the liver tissue. cDNA was synthesized from the same quantity of total RNA using GoScript™ Reverse Transcription System (Promega). Quantitative PCR was performed using FastStart Universal SYBR Green Master (Rox) (Roche) with ABI7500 Detection System (Life Technology). The cycles for qPCR were as follows: 95 °C for 30 s, 45 cycles of 95 °C for 10 s, 60 °C for 30 s. The primer sequence is described in Table 1. Results were analyzed by ddCt method.
2.3. Measurement of serum aminotransferase and cytokine secretion
2.8. Statistical analysis
The mice serum was collected from the retro-orbital sinus 8 h after Con A administration. Activities of the alanine aminotransferase (ALT) and the aspartate aminotransferase (AST) in serum were measured with BS-480 Chemistry Analyzer (Mindray, China). Besides, Enzymelinked immunosorbent assay kits (MultiSciences, China) were applied to detect IFN-γ, IL-6 and TNF-α in serum.
Data expressed are the mean values ± standard deviation. Statistical analysis was carried out by Prism 6.0 (Graph Pad Software). One-way analysis of variance (ANOVA) was used to compare all comparisons among groups. For multi-group analysis, intergroup difference was compared by Dunn's test. P b 0.05 was considered to indicate significantly different.
2.4. Isolation of hepatic mononuclear cells 3. Results Hepatic mononuclear cells (MNCs) were prepared essentially as previous reported [23]. In brief, liver tissues were cut up and infiltrated in 0.25% collagenase type II solution. Then they were shaken for 15 min in a 37 °C constant-temperature bath. Next, the liver specimen was crushed through a stainless mesh and the cell suspensions were poured slowly into the upper layer of 33% heparin percoll solution. The samples were centrifuged at 500g for 15 min and then discarded the supernatant. In order to remove the red blood cells, the cell precipitation was re-suspend in red blood cell lysis solution and then washed with PBS for 2 times. 2.5. Flow cytometry 12 h after the establishment of Con A-induced hepatitis model, MNCs suspensions of the liver were obtained. In order to identify lymphocytes, mononuclear cells were stained by PE-labeled anti-CD4 Ab (BD Biosciences, USA) and FITC-labeled CD8a Ab (BD Biosciences, USA). The counts of infiltrating CD4+ and CD8+ T cells in the liver were analyzed by BD FACS Calibur (BD Biosciences, USA). 2.6. Western-blotting analysis Livers were carefully prepared with lysis buffer (Thermo, USA) to yield a homogenate. After centrifugation (12,000g for 15 min) at 4 °C, the protein concentration of the supernatants was detected by BCA Protein Quantitation Kit (Biocolors, China). Equal amounts of protein
3.1. mc-hALR ameliorated Con A-induced liver damage With the hydrodynamics-based transfection of mc-ALR, the protein levels of ALR in liver were significantly increased in ALR group comparing to the control group and Con A group (Fig. 1A). After the acute liver injury induced by Con A, the level of serum ALT and AST were much higher in the Con A group relative to the control group. However, the serum transaminase in the ALR group was obviously blocked compared to the Con A group (Fig. 1B). Additionally, in the survival experiment (Con A, 30 mg/kg), the ALR group had a 40% survival rate, whereas the entire control group succumbed to the lethal dose (Fig. 1C). Taken together, these results suggest that ALR ameliorates Con A-induced liver damage. Table 1 Quantitative real-time PCR primer sequences. Gene
Forward (5′-3′)
Reverse (5′-3′)
TNF-α IL-6 IFN-γ iNOS NF-κB CXCL-10 CCL-3 GAPDH
CACGTCGTAGCAAACCACCAAGTGGA TCCTCTCTGCAAGAGACTTCC GCTGCTGATGGGAGGAGATG GGAGCGAGTTGTGGATTGTC GGTGGAGGCATGTTCGGTAG CTGTAAGCTATGTGGAGGTGCG ACCTGGAACTGAATGCCTGAG TCCACTCACGGCAAATTCAAC
TGGGAGTAGACAAGGTACAACCC TTGTGAAGTAGGGAAGGCCG GGGAAGCACCAGGTGTCAAG GGGTCGTAATGTCCAGGAAGTA ACTCTTGGCACAATCTTTAGGG GCTAGGGAGGACAAGGAGGG AGTGAAGAGTCCCTCGATGTG GTAGACTCCACGACATACTCAGC
282
M. Mu et al. / International Immunopharmacology 35 (2016) 280–286
Fig. 1. The effect of ALR pretreatment on hepatic injury in mice. (A) ALR was determined using Western blot analysis at 48 h after hydrodynamics-based transfection. The GAPDH was used as an internal control. (B) Blood samples were obtained from the retro-orbital sinus at 8 h after Con A injection, and ALT/AST levels were measured. (C) Survival was monitored after the injection of a lethal dose of Con A (30 mg/kg). Data are expressed as mean ± SEM (n = 5–6). *P b 0.05 vs. Control group, #P b 0.05 vs. Con A group.
3.2. ALR inhibited the release of pro-inflammatory cytokines Accumulating evidences demonstrates that Con A-induced liver injury is mediated by pro-inflammatory cytokines, such as IFN-γ, IL-6, and TNF-α [24]. In this study, IFN-γ, IL-6, and TNF-α in serum and liver tissue were measured by ELISA and qPCR. After Con-A administration intravenously, these pro-inflammatory cytokines were significantly increased in serum. Treatment with ALR significantly reduced the levels of TNF-α and IL-6, but failed to affect IFN-γ (Fig. 2A). Subsequently, the mRNA level in liver followed the same trend with the protein levels in
liver (Fig. 2B). These findings suggest that ALR reduces the release of TNF-α and IL-6. 3.3. Effects of ALR on CD4+, CD8+ T cells infiltrating in the liver There is striking evidence indicating that T cells play a critical role in Con A-induced liver injury [3,25]. In our study, the percentage of CD4+ and CD8+ cells in the liver were calculated by flow cytometry. As expected, the percentage of CD4+, CD8+ and T cells were increased strongly after Con A injection (Fig. 3). Nevertheless, the percentage of
Fig. 2. The effects of ALR pretreatment on the levels of TNF-α, IL-6 and IFN-γ in Con A-induced liver injury. (A) 8 h after Con A administration, the protein concentrations of TNF-α, IL-6 and IFN-γ in serum were detected by ELISA kits. (B) 12 h after Con A injection, the levels of mRNA expression in the liver were examined by quantitative real-time PCR. Data are expressed as mean ± SEM (n = 6). **P b 0.01 vs. Control group, ##P b 0.01 vs. Con A group, #P b 0.05 vs. Con A group.
M. Mu et al. / International Immunopharmacology 35 (2016) 280–286
283
Fig. 3. The effects of ALR pretreatment on T lymphocytes infiltrated in the liver. Hepatic mononuclear cells were isolated from each group at 12 h after injection of Con A, and analyzed by flow cytometry. (A) Representative images of CD4+ T cells and CD8+ T cells from the three groups are shown. (B) The percentage of CD4+ and CD8+ T cells in liver were increased significantly following Con A administration without ALR pretreatment comparing to the ALR group. Data are expressed as mean ± SEM (n = 6). **P b 0.01 vs. Control group, ## P b 0.01 vs. Con A group.
infiltrating CD4+ and CD8+ cells went down significantly in ALR group. These data indicate that ALR can dramatically lessen CD4+ and CD8+ T cells recruiting into the liver. 3.4. ALR inhibited chemokines expression in the liver The up-regulation of chemokines, such as CXCL-10 and CCL-3, has been reported to play a critical role in Con A-induced liver injury. Thus, CXCL-10 and CCL-3 in the liver were detected. As expected (Fig. 4), the mRNA of them was enhanced greatly with Con A administration, but changed little in ALR group. These results show that ALR can decrease the expression of chemokines in Con A-induced liver injury. 3.5. Influence of ALR on NF-κB pathway in Con A-induced hepatitis Since the transcription factor NF-κB is correlated with inflammatory response, we addressed the question that if the mechanism of ALR attenuating the liver injury is due to its influence on NF-κB activation. To investigate the effects of ALR on NF-κB activation we measured the levels of phosphorylation of IκBα and p65 in the liver by Western blot
analysis. Compared with Con A group IκBα and p65 phosphorylation were inhibited markedly by ALR pretreatment (Fig. 5A). Furthermore, the intrahepatic mRNA expression of NF-κB was detected. The overexpression of NF-κB gene was blocked significantly in ALR group (Fig. 5B). These results show that ALR inhibits Con A-induced hepatitis through the NF-κB pathway.
3.6. Influence of ALR on JNK and p38 MAPK activation It is reported that JNK and p38 MAPK pathway have been linked to the expression of Chemokines. p38 MAPK plays a key role in the generation of many inflammatory factors [26]. The interaction among JNK, p38 MAPK and NF-kB has been reported before. [27] In order to investigate the effects of ALR on JNK and p38 MAPK pathway, the JNK, phospho-JNK, p38 MAPK and phospho-p38 MAPK were detected in our study. Con A treatment increased the phosphorylation of JNK and p38 obviously. However, the ALR pretreatment showed a strong inhibition of the phosphorylation of them (Fig. 6A). These results reveal that JNK and p38 MAPK are inhibited by ALR.
Fig. 4. The effects of ALR pretreatment on chemokines. 12 h after Con A injection, the mRNA of CXCL-10 and CCL-3 in the liver were examined by quantitative real-time PCR. Data are expressed as mean ± SEM (n = 6). **P b 0.01 vs. Control group, ##P b 0.01 vs. Con A group, #P b 0.05 vs. Con A group.
284
M. Mu et al. / International Immunopharmacology 35 (2016) 280–286
Fig. 5. The effects of ALR pretreatment on NF-κB. Liver tissues were harvested 12 h after Con A administration. (A) Hepatic NF-κB protein levels were analyzed by Western blot with antibodies against IκBα, phospho-IκBα, NF-κB p65, and phospho-NF-κB p65. The GAPDH was used as an internal control. (B) The levels of NF-κB mRNA were determined by quantitative real-time PCR. Data are expressed as mean ± SEM (n = 6). **P b 0.01 vs. Control group, #P b 0.05 vs. Con A group.
3.7. Effects of ALR on iNOS Previous studies have shown that iNOS played a vital role in immune regulation. In our research, the expression level of iNOS mRNA was detected. We found Con A could drastically elevate the expression of iNOS, but ALR greatly inhibited it (Fig. 6B). Based on these results, we conclude that ALR regulates the expression of iNOS while exerting protective effects against Con A-induced hepatitis injury. 4. Discussion ALR is a kind of liver regeneration enhancer. Previous studies have focused on ALR's role in promoting liver regeneration and enhancing mitochondrial gene expression. However, little attention has been devoted to its regulation function in immune-mediated hepatitis. In this paper, the treatment effects of ALR on Con A-induced hepatitis were investigated. The mice were induced liver injury by Con A and showed high serum levels of ALT and AST, but the transaminase in serum was strongly decreased by ALR treatment. Additionally, ALR treatment showed an overwhelming superiority of survival time and survival rate over Con A-induced group. These results demonstrate that the increase of ALR expression in liver undoubtedly attenuates hepatic injury in the mice with Con A induced hepatitis. It is also reported that ALR stimulates kupffer cells to produce TNF-α, IL6 and iNOS so that the
liver regeneration is enhanced [18]. These effects involving antiinflammation and immune regulation led us to explore the potential beneficial mechanisms of ALR. Growing evidence has shown that immunoregulatory cytokines play a pivotal role in the pathogenesis of Con A-induced hepatitis. The upregulation of TNF-α directly leads to hepatocellular apoptosis and necrosis [28,29]. Studies also have shown that antibodies against TNF-α could attenuate Con A-induced liver injury in mice [30]. Similar finding is confirmed in TNF−/− mice [28]. In addition, IL-6 has been confirmed to be one of the main factors which was responsible for liver injury [31]. iNOS is mainly remained in macrophages and hepatocytes and it can be induced by TNF-α [32,33]. Different iNOS concentrations might implement opposite immune regulating function [34]. In this study, we found that treatment with ALR not only strongly reduced the levels of these pro-inflammatory cytokines in serum but also obviously down regulated the mRNA expression of these pro-inflammatory cytokines in liver, demonstrating that ALR pretreatment suppressed hepatic proinflammatory cytokines. It is generally believed that during the development of Con Ainduced hepatitis, kinds of lymphocytes, such as T lymphocyte, natural killer T cell and macrophages, have been recruited to the liver with large release of pro-inflammatory cytokines. These infiltrating lymphocytes in intrahepatic will affect the severity of liver injury to a certain extent [25,35–37]. Among these lymphocytes, CD4+ and CD8+ T cell play
Fig. 6. The effects of ALR pretreatment on JNK, p38 MAPK and iNOS. Liver tissues were harvested 12 h after Con A administration. (A) Hepatic JNK and p38 MAPK protein levels were analyzed by Western blot with antibodies against JNK, phospho-JNK, p38-MAPK, and phospho-p38-MAPK. The GAPDH was used as an internal control. (B) The levels of iNOS mRNA were determined by quantitative real-time PCR. Data are expressed as mean ± SEM (n = 6). **P b 0.01 vs. Control group, #P b 0.05 vs. Con A group.
M. Mu et al. / International Immunopharmacology 35 (2016) 280–286
the dominant roles. Previous researches reveal that while CD4+ T cell is removed by anti-CD4 monoclonal antibodies, the mice with Con A injection won't develop hepatitis [3,24]. Besides, FK506 (a T cell specific immunosuppressive drug) administration also fails the mice with Con A injection to develop hepatitis [38]. In our research, we found that CD4+ and CD8+ T cell were greatly enhanced due to Con A injection. But with ALR pretreatment, CD4+ and CD8+ T cell were strongly diminished. These lines of evidence indicate that ALR can protect hepatitis from being severely injured by Con A injection, and CD4+ and CD8+ T cell infiltration will be suppressed in the liver during this process. Up-regulated expression of chemokines such as CXCL-10 and CCL-3 has been reported to play a critical role in the development of Con A induced hepatitis [39]. T lymphocytic infiltration is intimately linked with the chemokine up-regulation [40,41]. Along with the increase of T lymphocytes, there is a boost in the expression of IFN-γ and TNF-α. These pro-inflammatory cytokines stimulate the production of chemokines further. Therefore, an amplification feedback loop which induces liver injury will be formed [42]. In our study, the expression of CXCL-10 and CCL-3 mRNA was down regulated with ALR pretreatment in the liver induced by Con A, resulting in reduced T lymphocytic infiltration. To shed more light on the protective effects of ALR against Con Ainduced hepatitis, we therefore explore how ALR impacts on intrahepatic NF-κB level in the model. Nuclear factor kappa B (NF-κB) works as a nuclear transcription factor which regulates the expression of a large number of genes. These transcription factors are critical in viral replication, tumorigenesis, inflammation, and various autoimmune diseases [43,44]. There is now substantial evidence indicating that the blockade of NF-κB activation not only attenuates Con Ainduced liver injury but also decreases the secretion of inflammatory molecules [45,46]. Some experts point out that ALR shows its effects by regulating NF-κB signaling pathway [47]. Similarly, in our study, the expression of NF-κB, the phosphorylation IκBα and p65 were upregulated after Con A injection, but all the up-regulation was inhibited severely with ALR pretreatment. Thus, there is no denying the fact that NF-κB signaling pathway plays a certain role in the development of Con A-induced hepatitis and the protective effects against Con Ainduced liver injury of ALR seem to be related to the inhibition of NFκB signaling pathway. The role of JNK in liver inflammation has been studied in Con A model before. The binding of TNF-α to its receptors results in JNK activation, which further induces NF-κB activation. p38 MAPK can regulate inflammatory cytokines expression by modulating NF-κB [48]. As the modulators of multiple genes, JNK and p38 MAPK play important roles both on innate and adaptive immunity. The phosphorylation of JNK and p38 MAPK activates T cell, resulting in abundant release of cytokines, such as TNF-α and IL-6. In this report, ALR shows a strong inhibition of the phosphorylation of JNK and p38 MAPK, which leads to down regulation of T cells activation. Therefore, the inflammatory cytokine expression is inhibited and the liver damage is attenuated consequently. In partial hepatectomy rats, ALR activates the NF-κB signaling pathway and enhances the expression of TNF-α, IL6 and iNOS [18]. It is reported that in acute liver failure rats ALR suppresses the infiltration of both kupffer cells and T lymphocytes. ALR also shows the ability to down-regulate the increase of pro-inflammatory cytokines induced by the acute hepatic failure [16]. In our experiments, the expression of chemokines and NF-κB signaling pathway were obviously restrained by ALR, which inhibited the infiltration and activation of T cell. Consequently, these studies indicate that ALR demonstrates multiple regulatory effects which lead to various results in different animal models and different pathological states. 5. Conclusion In conclusion, our study proves that ALR can attenuate Con Ainduced hepatitis injury by inhibiting the infiltration of both CD4+ and CD8+ T cells. The release of pro-inflammatory cytokines in liver
285
has been restrained due to the suppression of NF-κB signaling pathway. From the current results, it seems reasonable to conclude that ALR has protective effects on T cell mediated immunological liver injury, and these findings raised the promising potential of developing ALR as a therapeutic agent for T cell mediated liver diseases. And the realization of this function seems to be attributed to the NF-κB pathway inhibition of T cell by ALR.
Acknowledgments This work was funded by the National Major Science and Technology for Infectious Diseases of China (2012ZX10004503).
References [1] M. Minemura, Liver involvement in systemic infection, WJH 6 (2014) 632–642, http://dx.doi.org/10.4254/wjh.v6.i9.632. [2] M. Carbone, J.M. Neuberger, Autoimmune liver disease, autoimmunity and liver transplantation, J. Hepatol. 60 (2014) 210–223, http://dx.doi.org/10.1016/j.jhep. 2013.09.020. [3] G. Tiegs, J. Hentschel, A. Wendel, A T cell-dependent experimental liver injury in mice inducible by concanavalin A, J. Clin. Investig. 90 (1992) 196–203, http://dx. doi.org/10.1172/JCI115836. [4] H.-X. Wang, M. Liu, S.-Y. Weng, J.-J. Li, C. Xie, H.-L. He, et al., Immune mechanisms of Concanavalin A model of autoimmune hepatitis, World J. Gastroenterol. 18 (2012) 119–125, http://dx.doi.org/10.3748/wjg.v18.i2.119. [5] X. Shao, Y. Qian, C. Xu, B. Hong, W. Xu, L. Shen, et al., The protective effect of intrasplenic transplantation of Ad-IL-18BP/IL-4 gene-modified fetal hepatocytes on ConA-induced hepatitis in mice, PLoS One 8 (2013) e58836, http://dx.doi.org/ 10.1371/journal.pone.0058836. [6] A. Francavilla, M. Hagiya, K.A. Porter, L. Polimeno, I. Ihara, T.E. Starzl, Augmenter of liver regeneration: its place in the universe of hepatic growth factors, Hepatology 20 (1994) 747–757. [7] C.R. Gandhi, Augmenter of liver regeneration, Fibrogenesis Tissue Repair 5 (2012) 10, http://dx.doi.org/10.1186/1755-1536-5-10. [8] A. Tury, G. Mairet-Coello, T. Lisowsky, B. Griffond, D. Fellmann, Expression of the sulfhydryl oxidase ALR (augmenter of liver regeneration) in adult rat brain, Brain Res. 1048 (2005) 87–97, http://dx.doi.org/10.1016/j.brainres.2005.04.050. [9] S.R. Farrell, C. Thorpe, Augmenter of liver regeneration: a flavin-dependent sulfhydryl oxidase with cytochrome c reductase activity†, Biochemistry 44 (2005) 1532–1541, http://dx.doi.org/10.1021/bi0479555. [10] C. Thirunavukkarasu, L.F. Wang, S.A.K. Harvey, S.C. Watkins, J.R. Chaillet, J. Prelich, et al., Augmenter of liver regeneration: an important intracellular survival factor for hepatocytes, J. Hepatol. 48 (2008) 578–588, http://dx.doi.org/10.1016/j.jhep. 2007.12.010. [11] H. Lange, T. Lisowsky, J. Gerber, U. Mühlenhoff, G. Kispal, R. Lill, An essential function of the mitochondrial sulfhydryl oxidase Erv1p/ALR in the maturation of cytosolic Fe/ S proteins, EMBO Rep. 2 (2001) 715–720, http://dx.doi.org/10.1093/embo-reports/ kve161. [12] Y. Li, M. Farooq, D. Sheng, C. Chandramouli, T. Lan, N.K. Mahajan, et al., Augmenter of liver regeneration (alr) promotes liver outgrowth during zebrafish hepatogenesis, PLoS One 7 (2012), e30835http://dx.doi.org/10.1371/journal.pone.0030835. [13] Liver-specific deletion of augmenter of liver regeneration accelerates development of steatohepatitis and hepatocellular carcinoma in mice, 148 (2015) 379–391.e4, http://dx.doi.org/10.1053/j.gastro.2014.10.008. [14] R. Dayoub, H. Wagner, F. Bataille, O. Stöltzing, T. Spruss, C. Buechler, et al., Liver regeneration associated protein (ALR) exhibits antimetastatic potential in hepatocellular carcinoma, Mol. Med. 17 (2011) 221–228, http://dx.doi.org/10.2119/molmed. 2010.00117. [15] M. Song, X. Yi, W. Chen, Y. Yuan, X. Zhang, J. Li, et al., Biochemical and biophysical research communications, Biochem. Biophys. Res. Commun. 415 (2011) 152–156, http://dx.doi.org/10.1016/j.bbrc.2011.10.039. [16] N. Wang, Z. Wang, H. Sun, X. Shi, Y. Zhang, Q. Liu, Augmenter of liver regeneration improves therapeutic effect of hepatocyte homotransplantation in acute liver failure rats, Int. Immunopharmacol. 15 (2013) 325–332, http://dx.doi.org/10.1016/j.intimp. 2013.01.002. [17] A. Francavilla, N.L. Vujanovic, L. Polimeno, A. Azzarone, A. Iacobellis, A. Deleo, et al., The in vivo effect of hepatotrophic factors augmenter of liver regeneration, hepatocyte growth factor, and insulin-like growth factor-II on liver natural killer cell functions, Hepatology 25 (1997) 411–415, http://dx.doi.org/10.1002/hep.510250225. [18] C.R. Gandhi, N. Murase, T.E. Starzl, Cholera toxin-sensitive GTP-binding proteincoupled activation of augmenter of liver regeneration (ALR) receptor and its function in rat kupffer cells, J. Cell. Physiol. 222 (2010) 365–373, http://dx.doi.org/10. 1002/jcp.21957. [19] K. Yang, C. Du, Y. Cheng, Y. Li, J. Gong, Z. Liu, Augmenter of liver regeneration promotes hepatic regeneration depending on the integrity of Kupffer cell in rat smallfor-size liver transplantation, J. Surg. Res. 183 (2013) 922–928, http://dx.doi.org/ 10.1016/j.jss.2013.02.033. [20] M.A. Kay, C.-Y. He, Z.-Y. Chen, A robust system for production of minicircle DNA vectors, Nat. Biotechnol. 28 (2010) 1287–1289, http://dx.doi.org/10.1038/nbt.1708.
286
M. Mu et al. / International Immunopharmacology 35 (2016) 280–286
[21] J. Yang, S. Chen, L. Huang, G.K. Michalopoulos, Sustained expression of naked plasmid DNA encoding hepatocyte growth factor in mice promotes liver and overall body growth, Hepatology (2001)http://dx.doi.org/10.1053/jhep.2001.23438. [22] F. Liu, Y. Song, D. Liu, Hydrodynamics-based transfection in animals by systemic administration of plasmid DNA, Gene Ther. 6 (1999) 1258–1266, http://dx.doi.org/10. 1038/sj.gt.3300947. [23] H. Dobashi, S. Seki, Y. Habu, T. Ohkawa, S. Takeshita, H. Hiraide, et al., Activation of mouse liver natural killer cells and NK1.1(+) T cells by bacterial superantigenprimed Kupffer cells, Hepatology 30 (1999) 430–436, http://dx.doi.org/10.1002/ hep.510300209. [24] K. Lv, Y. Zhang, M. Zhang, M. Zhong, Q. Suo, Galectin-9 ameliorates Con A-induced hepatitis by inducing CD4 + CD25low/int effector T-Cell apoptosis and increasing regulatory T cell number, PLoS One 7 (2012), e48379http://dx.doi.org/10.1371/ journal.pone.0048379. [25] C. Liu, L. Zhang, S. Gao, Z. qu, Q. Wang, F. Zhu, et al., NCPP treatment alleviates ConAinduced hepatitis via reducing CD4 + T activation and NO production, Immunopharmacol. Immunotoxicol. 34 (2012) 962–967, http://dx.doi.org/10. 3109/08923973.2012.680065. [26] E.F. Wagner, Á.R. Nebreda, Signal Integration by JNK and p38 MAPK Pathways in Cancer Development, 2009 1–13, http://dx.doi.org/10.1038/nrc2694. [27] A. Wullaert, K. Heyninck, R. Beyaert, Mechanisms of crosstalk between TNF-induced NF-κB and JNK activation in hepatocytes, Biochem. Pharmacol. 72 (2006) 1090–1101, http://dx.doi.org/10.1016/j.bcp.2006.07.003. [28] Y. Tagawa, K. Sekikawa, Y. Iwakura, Suppression of concanavalin A-induced hepatitis in IFN-gamma(−/−) mice, but not in TNF-alpha(−/−) mice: role for IFNgamma in activating apoptosis of hepatocytes, J. Immunol. 159 (1997) 1418–1428. [29] A. Kano, T. Haruyama, T. Akaike, Y. Watanabe, IRF-1 is an essential mediator in IFNγ-induced cell cycle arrest and apoptosis of primary cultured hepatocytes, Biochem. Biophys. Res. Commun. 257 (1999) 672–677, http://dx.doi.org/10.1006/bbrc.1999. 0276. [30] S. Kusters, F. Gantner, G. Kunstle, G. Tiegs, Interferon gamma plays a critical role in T cell-dependent liver injury in mice initiated by concanavalin A, Gastroenterology 111 (1996) 462–471, http://dx.doi.org/10.1053/gast.1996.v111.pm8690213. [31] J. Liang, B. Zhang, R.-W. Shen, J.-B. Liu, M.-H. Gao, Y. Li, et al., Preventive effect of halofuginone on concanavalin A-induced liver fibrosis, PLoS One 8 (2013) e82232, http://dx.doi.org/10.1371/journal.pone.0082232. [32] D.A. Geller, A.K. Nussler, M. Di Silvio, C.J. Lowenstein, R.A. Shapiro, S.C. Wang, et al., Cytokines, endotoxin, and glucocorticoids regulate the expression of inducible nitric oxide synthase in hepatocytes, Proc. Natl. Acad. Sci. 90 (1993) 522–526, http://dx. doi.org/10.1073/pnas.90.2.522. [33] H. Kleinert, P.M. Schwarz, U. Förstermann, Regulation of the expression of inducible nitric oxide synthase, Biol. Chem. (2003)http://dx.doi.org/10.1515/BC.2003.152. [34] O.M. Kenny, C.M. McCarthy, N.P. Brunton, M.B. Hossain, D.K. Rai, S.G. Collins, et al., Anti-inflammatory properties of potato glycoalkaloids in stimulated Jurkat and Raw 264.7 mouse macrophages, Life Sci. 92 (2013) 775–782, http://dx.doi.org/10. 1016/j.lfs.2013.02.006. [35] M. Margalit, S.A. Ghazala, R. Alper, E. Elinav, A. Klein, V. Doviner, et al., Glucocerebroside treatment ameliorates ConA hepatitis by inhibition of NKT
[36]
[37]
[38]
[39]
[40]
[41]
[42]
[43]
[44]
[45]
[46] [47]
[48]
lymphocytes, Am. J. Physiol. Gastrointest. Liver Physiol. 289 (2005) G917–G925, http://dx.doi.org/10.1152/ajpgi.00105.2005. L. Xu, J. Qi, P. Zhao, X. Liang, Y. Ju, P. Liu, et al., T cell immunoglobulin- and mucindomain-containing molecule-4 attenuates concanavalin A-induced hepatitis by regulating macrophage, J. Leukoc. Biol. 88 (2010) 329–336, http://dx.doi.org/10.1189/ jlb.1209797. V. Volarevic, M. Milovanovic, B. Ljujic, N. Pejnovic, N. Arsenijevic, U. Nilsson, et al., Galectin‐3 deficiency prevents concanavalin A–induced hepatitis in mice, Hepatology 55 (2012) 1954–1964, http://dx.doi.org/10.1002/hep.25542. H. Mizuhara, E. O'Neill, N. Seki, T. Ogawa, C. Kusunoki, K. Otsuka, et al., T cell activation-associated hepatic injury: mediation by tumor necrosis factors and protection by interleukin 6, J. Exp. Med. 179 (1994) 1529–1537, http://dx.doi.org/10. 1084/jem.179.5.1529. A.A. Maghazachi, Role of chemokines in the biology of natural killer cells, The Chemokine System in Experimental and Clinical Hematology, Springer Berlin Heidelberg, Berlin, Heidelberg 2010, pp. 37–58, http://dx.doi.org/10.1007/82_2010_20. C.-T. Tu, B. Han, H.-C. Liu, S.-C. Zhang, Curcumin protects mice against concanavalin A-induced hepatitis by inhibiting intrahepatic intercellular adhesion molecule-1 (ICAM-1) and CXCL10 expression, Mol. Cell. Biochem. 358 (2011) 53–60, http:// dx.doi.org/10.1007/s11010-011-0920-4. L. Cao, Y. Zou, J. Zhu, X. Fan, J. Li, Ginsenoside Rg1 attenuates concanavalin A-induced hepatitis in mice through inhibition of cytokine secretion and lymphocyte infiltration, Mol. Cell. Biochem. 380 (2013) 203–210, http://dx.doi.org/10.1007/s11010013-1674-y. A. Antonelli, S.M. Ferrari, D. Giuggioli, E. Ferrannini, C. Ferri, P. Fallahi, Chemokine (C–X–C motif) ligand (CXCL)10 in autoimmune diseases, Autoimmun. Rev. 13 (2014) 272–280. A.S. Baldwin Jr., THE NF-κB AND IκB PROTEINS: new discoveries and insights, Annu. Rev. Immunol. 14 (1996) 649–681, http://dx.doi.org/10.1146/annurev.immunol.14. 1.649. G. Bonizzi, M. Karin, The two NF-κB activation pathways and their role in innate and adaptive immunity, Trends Immunol. 25 (2004) 280–288, http://dx.doi.org/10. 1016/j.it.2004.03.008. D. Feng, Y. Mei, Y. Wang, B. Zhang, C. Wang, L. Xu, Tetrandrine protects mice from concanavalin A-induced hepatitis through inhibiting NF-κB activation, Immunol. Lett. 121 (2008) 127–133, http://dx.doi.org/10.1016/j.imlet.2008.10.001. N.D. Perkins, Integrating cell-signalling pathways with NF-κB and IKK function, Nat. Rev. Mol. Cell Biol. 8 (2007) 49–62, http://dx.doi.org/10.1038/nrm2083. Y. Li, L. Zhang, Q. Liu, G.-T. Chen, H. Sun, Exogenous augmenter of liver regeneration (ALR) attenuates inflammatory response in renal hypoxia re-oxygenation injury, Ren. Fail. 36 (2014) 432–436, http://dx.doi.org/10.3109/0886022X.2013.867811. J.H. Lee, J.H. Won, J.M. Choi, H.H. Cha, Y.J. Jang, S. Park, et al., Protective effect of ellagic acid on concanavalin A-induced hepatitis via toll-like receptor and mitogen-activated protein kinase/nuclear factor κB signaling pathways, J. Agric. Food Chem. 62 (2014) 10110–10117, http://dx.doi.org/10.1021/jf503188c.