- Email: [email protected]
Bactericidal activity of tracheal antimicrobial peptide against respiratory pathogens of cattle
Veterinary Immunology and Immunopathology 152 (2013) 289–294
Contents lists available at SciVerse ScienceDirect
Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm
Research paper
Bactericidal activity of tracheal antimicrobial peptide against respiratory pathogens of cattle Khaled Taha-Abdelaziz a,b , José Perez-Casal c , Courtney Schott a , Jason Hsiao a , – Slavic´ d , Jeff L. Caswell a,∗ Samuel Attah-Poku b , Durda a b c d
Department of Pathobiology, University of Guelph, Guelph, ON, Canada Pathology Department, Faculty of Veterinary Medicine, Beni-Suef University, Beni-Suef, Egypt Vaccine and Infectious Disease Organization-International Vaccine Centre, Saskatoon, SK, Canada Animal Health Laboratory, University of Guelph, Guelph, ON, Canada
a r t i c l e
i n f o
Article history: Received 28 July 2012 Received in revised form 5 December 2012 Accepted 28 December 2012 Keywords: Innate immunity Cattle Bactericidal activity Antimicrobial peptides Mannheimia haemolytica Mycoplasma bovis Single nucleotide polymorphism
a b s t r a c t Tracheal antimicrobial peptide (TAP) is a -defensin produced by mucosal epithelial cells of cattle. Although effective against several human pathogens, the activity of this bovine peptide against the bacterial pathogens that cause bovine respiratory disease have not been reported. This study compared the antibacterial effects of synthetic TAP against Mannheimia haemolytica, Histophilus somni, Pasteurella multocida, and Mycoplasma bovis. Bactericidal activity against M. bovis was not detected. In contrast, the Pasteurellaceae bacteria showed similar levels of susceptibility to that of Escherichia coli, with 0.125 g TAP inhibiting growth in a radial diffusion assay and minimum inhibitory concentrations of 1.56–6.25 g/ml in a bactericidal assay. Significant differences among isolates were not observed. Sequencing of exon 2 of the TAP gene from 23 cattle revealed a prevalent non-synonymous single nucleotide polymorphism (SNP) A137G, encoding either serine or asparagine at residue 20 of the mature peptide. The functional effect of this SNP was tested against M. haemolytica using synthetic peptides. The bactericidal effect of the asparagine-containing peptide was consistently higher than the serine-containing peptide. Bactericidal activities were similar for an acapsular mutant of M. haemolytica compared to the wild type. These findings indicate that the Pasteurellaceae bacteria that cause bovine respiratory disease are susceptible to killing by bovine TAP and appear not to have evolved resistance, whereas M. bovis appears to be resistant. A non-synonymous SNP was identified in the coding region of the TAP gene, and the corresponding peptides vary in their bactericidal activity against M. haemolytica. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Tracheal antimicrobial peptide (TAP), the firstdiscovered member of the -defensin family, is a 38 amino acid cationic peptide produced by epithelial cells lining the respiratory tract and other mucosal surfaces
∗ Corresponding author at: Department of Pathobiology, University of Guelph, Guelph, Ontario N1G 2W1, Canada. Tel.: +1 519 824 4120x54555; fax: +1 519 824 5930. E-mail address: [email protected] (J.L. Caswell). 0165-2427/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetimm.2012.12.016
(Diamond et al., 2000a,b; Bals, 2000). The antimicrobial activity of TAP is thought to result from disruption of bacterial membranes and later pore formation, which results from the electrostatic interaction of the positively charged peptide and negatively charged phospholipid of the bacterial membrane (Kagan et al., 1994; Hiemstra, 2001). Gene expression of TAP is upregulated following exposure to lipopolysaccharide and other inflammatory stimuli (Russell et al., 1996; Diamond et al., 2000a,b; Yang et al., 2011). However, we have previously shown that glucocorticoids and bovine viral diarrhea virus infection impair
290
K. Taha-Abdelaziz et al. / Veterinary Immunology and Immunopathology 152 (2013) 289–294
this inducible innate immune response (Al-Haddawi et al., 2007; Mitchell et al., 2007). These findings suggest that impaired TAP expression may be one mechanism by which stress or viral infection predisposes to pneumonia, and this may be a target for novel interventions to prevent the disease. Although TAP has bactericidal activity against several human pathogens (Lawyer et al., 1996a,b), the effect of this bovine protein on bovine respiratory pathogens is unknown. Some pathogens are known to evade killing by antimicrobial peptides, by blocking the signaling pathways that upregulate their expression (Nizet, 2006), secreting proteins that cleave or trap antimicrobial proteins, or lessening their negative surface charge to reduce their affinity for cationic peptides (Kraus and Peschel, 2006). Thus, although TAP has been shown to kill human respiratory pathogens, bacteria that are adapted to cause pneumonia in cattle may have evolved mechanisms to resist TAPmediated killing. Thus, the objective of this work was to determine if TAP kills the bacterial pathogens that cause respiratory disease in cattle. Further, we report a non-synonymous single nucleotide polymorphism (SNP) in the coding region of the TAP gene, and characterize its effect on microbicidal activity against Mannheimia haemolytica.
2. Methods 2.1. Preparation of TAP TAP was synthesized as a linear polypeptide onto a resin, cleaved from the resin, purified by high performance liquid chromatography on a reverse phase column, and eluted with water/acetonitrile solvents. Three peptides were synthesized: 23G, with serine at position 20 and glycine at position 23; 20S with serine at residue 20 and glutamine at residue 23, and 20N with asparagine at residue 20 and glutamine at residue 23 (Table 1). Using MALDI-TOF, the mass spectral analysis confirmed the three synthesized peptides to be pure, with masses as expected: 23G – 4037.8 Da; 20S – 4091.1; 20N – 4118.1 Da. The protein concentrations of the samples were subsequently confirmed (2-D Quant Kit, GE Healthcare, Piscataway, NJ). The linear molecule was oxidized in solution to give the disulfidebridged molecule, and a mass spectral analysis of the product indeed indicated a loss of 6 mass units confirming that 3 disulfide bonds have been formed during the oxidation. In preliminary experiments, the bactericidal activity of oxidized and non-oxidized peptides was found to have similar activities, so subsequent studies used the oxidized peptides.
2.2. Assays of antimicrobial activity The antimicrobial activity of synthetic TAP was measured against isolates of M. haemolytica (n = 8), Histophilus somni (n = 3), and Pasteurella multocida (n = 3) from the lung of cattle with pneumonia; in addition, 1 isolate of Escherichia coli from a calf with diarrhea was tested. The initial studies used synthetic peptide 23G. Subsequent studies compared the effect of the polymorphism described below, using peptides 20S and 20N. Bacteriostatic activity was measured using an agarbased radial diffusion assay (Lehrer et al., 1991; Lawyer et al., 1996a,b). Bacterial isolates were grown in 50 ml tryptose soy broth for 18 h at 37 ◦ C (in 5% CO2 for H. somni), then 500 l was re-inoculated in 50 ml of fresh broth and incubated for 3–4 h at 37 ◦ C to reach mid-log phase. The bacterial suspension was centrifuged at 900 × g for 10 min at 4 ◦ C, re-suspended in 10 ml of 10 mM sodium phosphate buffer (pH 7.4), and the concentration was estimated based on the optical density measured at 620 nm. 107 CFU bacteria were mixed with 30 ml of 1% agarose in 10 mM sodium phosphate buffer, 2 mg Tween20 and 30 mg tryptose soy powder. The agar was cooled in a plastic plate, then 3 mm diameter holes were punched in the agar plate, and 0.125–2.0 g TAP or medium were added to each well. Plates were incubated at 37 ◦ C for 1 h, then covered with 10 ml of melted 1% agarose with 10 mM sodium phosphate and 6 g tryptose soy powder, and incubated for 24 h at 37 ◦ C. The diameters of the zones of inhibition were measured. In order to measure bactericidal activity, bacteria were prepared as above, and 2 × 104 CFU were exposed to various concentrations of TAP (2-fold dilutions from 100 to 0.78 mg/ml, in sodium phosphate buffer, 50 l final volume, in triplicate) for 2 h at 37 ◦ C, then plated onto blood agar and incubated at 37 ◦ C for 24 h. The numbers of surviving colony forming units were counted. A similar technique was used to measure bactericidal activity against three isolates (A, B and C) of Mycoplasma bovis, obtained from feedlot cattle with caseonecrotic bronchopneumonia, with the following modifications. Bacteria were grown for 48 h at 37 ◦ C in modified Hayflick’s broth with 20% pig serum, centrifuged at 35,800 × g for 30 min at 4 ◦ C, resuspended in ¼ strength Ringer’s solution containing 18 g/L HEPES, pH 7.6, or sodium phosphate buffer containing 18 g/L HEPES, pH 7.6. The initial concentrations of bacteria were 10, 55 and 83 × 104 CFU/ml for the three isolates. Bacterial suspensions were incubated with 0, 3, 30 and 300 g/ml TAP for 2 h, then surviving bacteria were enumerated by plating a 10-fold dilution series on modified Hayflick’s agar with 20% pig serum for 48 h at 37 ◦ C in 5.5% CO2 . 2.3. Analysis of a non-synonymous SNP
Table 1 Amino acid sequences of the 3 synthesized peptides. Peptide name
Amino acid sequence
23G 20S 20N
npvs cvrnkgicvp ircpgsmkgi gtcvgravkc crkk npvs cvrnkgicvp ircpgsmkqi gtcvgravkc crkk npvs cvrnkgicvp ircpgnmkqi gtcvgravkc crkk
Tracheal samples were obtained at slaughter on 5 different days from 23 beef cattle of unknown breed, using samples from different lots of cattle to avoid genetic relatedness among donors. DNA was extracted (QIAamp DNA Minikit, Qiagen, Valencia, CA), and a 653 bp fragment of the TAP gene including part of the intron and the entire coding region of exon 2 was amplified using the primers (F)
K. Taha-Abdelaziz et al. / Veterinary Immunology and Immunopathology 152 (2013) 289–294
Fig. 1. Radial diffusion assay. TAP induces dose-dependent inhibition of growth of representative isolates of different bovine bacterial pathogens.
5 -aacagtgaaaatagacccctgtg and (R) 5 caccacacaacaacctcagtg and sequenced in the forward and reverse directions (Laboratory Services, University of Guelph). A single non-synonymous SNP was identified (NCBI dbSNP accession number 530855967) and its functional effect was investigated using 2 synthetic peptides with either serine (20S) or asparagine (20N) at residue 20; both of these peptides had glutamine at position 23 as in the published coding sequence (NCBI L13373.1). Antibacterial activity against M. haemolytica was evaluated using the radial diffusion assay as described above, and using the bactericidal activity assay. For the latter, 2.8 × 105 CFU/ml M. haemolytica bacteria were exposed to various concentrations of each peptide (2-fold dilutions from 100 to 0.78 g/ml) for 2 h at 37 ◦ C, then plated onto blood agar and incubated at 37 ◦ C for 24 h. The numbers of surviving colony forming units were counted. Assays were conducted in triplicate and repeated twice. 2.4. Analysis of an acapsular mutant Acapsular mutant (LMCap1) and wildtype (SH1217) strains of M. haemolytica, which were kindly provided by Dr. Reggie Lo, Department of Cellular and Molecular Biology, University of Guelph (McKerral and Lo, 2002). To test the hypothesis that TAP-mediated killing is dependent on the bacterial capsule (Moranta et al., 2010), the bactericidal activity of the 20S and 20N peptides were measured against LMCap1 and SH1217 as described above.
291
Fig. 2. Radial diffusion assay. TAP (2.0 g per well) inhibits growth of bovine bacterial pathogens. No significant difference was found between M. haemolytica (n = 8), P. multocida (n = 3), H. somni (n = 3), and E. coli (n = 1).
were 10.8 ± 0.4 mm for M. haemolytica, 8.0 ± 0 mm for H. somni, 9.7 ± 0.3 mm for P. multocida and 10.0 for E. coli (Fig. 2). Differences between isolates of the same species were not observed, and differences between M. haemolytica, E. coli, P. multocida and H. somni were not significant. 3.2. Bactericidal effect of synthetic TAP Incubation of bacteria with varying concentrations of TAP resulted in dose-dependent reduction in the number of surviving colony forming units. The minimum inhibitory concentrations were 3.1 ± 0 g/ml for M. haemolytica (3 isolates), 4.7 ± 1.6 g/ml for H. somni (3 isolates), 2.3 ± 0.8 g/ml for P. multocida (3 isolates), and 3.1 ± 0 g/ml for E. coli (1 isolate) (Fig. 3). Differences between bacterial species or between isolates of the same species were not significant (2-way ANOVA). In contrast, 3–300 g/ml TAP had no significant effect on survival of M. bovis, using either sodium phosphate buffer (Fig. 4) or ¼ strength Ringer’s solution as the buffer. 3.3. Analysis of a non-synonymous SNP A non-synonymous SNP of alanine or glycine was identified at position 137 of the coding sequence (A137G), in exon 2, corresponding to nucleotide 3156 in the NCBI reference sequence L13373.1 (NCBI dbSNP accession number
2.5. Statistical analysis Laboratory analyses were repeated at least once with similar findings. The results were evaluated by two-way analysis of variance GraphPad software (GraphPad Prism v4.0b, GraphPad Software, San Diego, CA). Values are listed as mean ± standard error of the mean (SEM). 3. Results 3.1. Growth inhibition: radial diffusion assay The addition of 0.125–2.0 g of TAP resulted in dosedependent inhibition of growth of all bacteria tested (Fig. 1). Using 2.0 g of TAP, the diameters of inhibition
Fig. 3. TAP abolished the growth of bovine bacterial pathogens. No significant difference in minimum inhibitory concentration was found between M. haemolytica, P. multocida, H. somni (each n = 3), and E. coli (n = 1).
292
K. Taha-Abdelaziz et al. / Veterinary Immunology and Immunopathology 152 (2013) 289–294
Fig. 4. Concentrations of tracheal antimicrobial peptide from 3 to 300 g/ml do not significantly inhibit the survival of three isolates (A, B and C) of Mycoplasma bovis.
530855967). This polymorphism encoded either serine (S) or asparagine (N) at residue 20 of the mature peptide (position 46) of the translated peptide. Of the 23 calves sequenced, 6 were homozygous for guanine (AGC, encoding serine [S]), 5 were homozygous for adenine (AAC, encoding asparagine [N]), and 12 were heterozygous (G/A = R). A second (synonymous) SNP encoding threonine or cysteine was found at position 162 of the coding sequence (T162C) in exon 2, corresponding to nucleotide 3181 in the NCBI reference sequence L13373.1 (NCBI dbSNP accession number 530855969). Both variants encoded the amino acid valine (GTT, GTC) at amino acid 28 of the mature peptide, and this synonymous SNP was not investigated further. Other SNPs were identified in the non-coding regions of the gene (NCBI dbSNP accession numbers 530855934–530855967). The functional effect of the non-synonymous SNP was evaluated by testing the bactericidal activity of the corresponding synthetic peptides against three isolates of M. haemolytica. Bactericidal activities (calculated as the percent reduction in surviving bacteria compared to medium alone, for the three isolates of M. haemolytica) for the 20S and 20N TAP peptides respectively, were 100 ± 0% and 100 ± 0% for 3.12 g/ml of TAP, 99.1 ± 0.12% and 99.8 ± 0.08% for 1.56 g/ml TAP, and 49.5 ± 3.18% and 66.0 ± 4.7% for 0.78 g/ml TAP. The bactericidal effect of the peptide 20N was consistently higher than that of the peptide 20S (Fig. 5), and this difference between peptides was significant at the 1.56 and 0.78 g/ml concentrations (P < 0.0001, 2-way ANOVA with post hoc Tukey’s test). This experiment was repeated with similar results, and the same effect was confirmed in the radial diffusion assay (data not shown).
Fig. 5. The bactericidal effect of the TAP amino acid polymorphism. The bactericidal activity against 3 isolates of M. haemolytica was significantly higher with the peptide containing asparagine at position 20 (20N) compared to the peptide containing serine at position 20 (20S). (a) 0.78 g/ml TAP; (b) 1.56 g/ml TAP.
3.4. Analysis of an acapsular mutant Finally, the bactericidal activity of the 20S and 20N peptides were measured against acapsular mutant (LMCap1) and wild-type (SH1217) strains of M. haemolytica. The greater bactericidal activity of the 20N compared to the 20S peptide was confirmed in this experiment, but there was no difference in survival of these two strains (Fig. 6). 4. Discussion The present study investigated the effect of bovine TAP against the major bacterial causes of respiratory diseases in cattle, and indicated the presence and functional
Fig. 6. The bactericidal activity of TAP is similar against the acapsular mutant (LMCap1) and wildtype (SH1217) strains of M. haemolytica. Greater bactericidal activity of the 20N (a) compared to the 20S (b) peptide is similar to that described above.
K. Taha-Abdelaziz et al. / Veterinary Immunology and Immunopathology 152 (2013) 289–294
significance of a non-synonymous SNP in the TAP gene. The antibacterial activity of synthetic TAP was tested against 8 isolates of M. haemolytica, 3 isolates of H. somni, 3 isolates of P. multocida and 1 isolate of E. coli. Results were dose-dependent and were equivalent with the two assays used—the radial diffusion assay of growth inhibition, and the assay of bactericidal activity—implying that the peptide has a bactericidal rather than bacteriostatic effect as has been previously reported (Lawyer et al., 1996a,b; Huttner and Bevins, 1999). The various isolates of the three respiratory pathogens (M. haemolytica, P. multocida and H. somni) each showed a similar level of susceptibility. The minimum inhibitory concentrations were not significantly different among M. haemolytica, H. somni, P. multocida, and E. coli. The finding of similar degrees of sensitivity of these four pathogens, and those reported in a prior study of human bacterial pathogens (Lawyer et al., 1996a,b), indicate that these isolates have not evolved effective methods to evade killing by TAP, and are susceptible to the bactericidal effects of this -defensin. In contrast to prior findings with Klebsiella pneumoniae (Moranta et al., 2010), the presence or absence of a bacterial capsule had no effect on -defensin-mediated killing in this study. With the bactericidal assay, TAP was effective in a dosedependent manner in the range of 0.78–100 g/ml (0.19 to 24 M). The MIC for E. coli in this study was similar to that found in a prior study using synthetic TAP and similar methodology (Lawyer et al., 1996a,b). Reported concentrations of human -defensin-2 in the surface liquid of cultured epithelial cells was 8–10 g/ml. Reported in vivo HBD-2 concentrations in humans include 0.3–4 g/ml in nasal secretions (Cole et al., 1999), and 10–100 ng/ml in the bronchoalveolar lavage fluid of human patients with inflammatory lung disease patients (Singh et al., 1998). In contrast, more recent papers have found considerably lower -defensin concentrations in pulmonary epithelial lining fluid: 5–20 ng/ml for HBD-1, and <0.2 or 0.1–1.0 ng/ml for HBD-2 in healthy individuals and those with chronic lower respiratory infection respectively (Yanagi et al., 2007). The in vivo concentrations of TAP have not been described, so it remains unconfirmed whether the MIC values reported here (1.56–6.25 g/ml) would be attained in calves with an acute inflammatory response. Together, these findings suggest that TAP is able to kill the bacterial pathogens that cause respiratory disease in cattle, and that development of pneumonia would require that production of TAP is suppressed by stress-induced elevations in cortisol concentration (Mitchell et al., 2007), by prior viral infection (Al-Haddawi et al., 2007), or by impairment of other lung defenses that may overwhelm the protective capacity of TAP. In contrast to above findings with M. haemolytica, H. somni and P. multocida, TAP had no significant bactericidal effect on isolates of M. bovis, using TAP concentrations of 3, 30 and 300 g/ml. Similar findings were obtained with two different media—¼ strength Ringer’s solution and sodium phosphate buffer. Although it remains possible that the in vitro experimental condition may affect the bactericidal activity of TAP, bactericidal activity was demonstrated
293
against other bacteria using similar culture conditions in this study, and against M. pneumoniae in previous work (Kuwano et al., 2006). Thus, these findings suggest that M. bovis is resistant to the bactericidal effects of bovine TAP. These conclusions are qualified by the in vitro nature of the present studies. Synthetic peptides were used, and although these were oxidized to achieve the secondary structure resulting from formation of disulfide bonds, it remains possible that the peptide synthesized in bovine airways differs in secondary or tertiary structure from that synthesized in vitro. However, it seems unlikely that the naturally synthesized peptide would have a lower antibacterial effect than what was found for the synthetic peptide in this study. Finally, we restricted our assessments to the important opportunistic bacteria that cause respiratory disease in cattle, and we did not investigate the effect on Gram positive bacteria, fungi, viruses, or pathogens that cause mastitis or enteric disease. The second component of this study investigated the presence and functional significance of a non-synonymous SNP in the TAP gene. Other SNPs were identified in the noncoding regions of the gene (data not shown), but these will be characterized and reported elsewhere. The A137G SNP in exon 2 encoded serine or asparagine at residue 20 of the mature peptide, and this polymorphism was prevalent in the 23 calves sequenced. Synthetic peptides were used to measure the functional effect of the SNP on bactericidal activity. The peptides were free of salts and shown to be pure, and subsequent testing confirmed the protein concentrations of the two preparations to be the same. For all 3 isolates of M. haemolytica tested, the bactericidal activity was higher for the peptide containing asparagine compared to the peptide containing serine. -Defensins kill bacteria through membrane disruption that results from electrostatic interactions between positively charged molecules of the peptide and negatively charged phospholipids on the bacterial membrane (Tosi, 2005; Lai and Gallo, 2009). Therefore, we speculate that the greater bactericidal activity of the asparagine-containing peptide may be attributed to the greater affinity of this peptide to negatively charged bacteria, since asparagine has a greater polarity than serine. The finding that a SNP has an impact on bactericidal activity of the resulting peptide suggests the potential for genetic selection to improve disease resistance. These findings require additional investigation to test the association of this SNP with the prevalence and type of respiratory disease at the population level.
5. Conclusion Bovine TAP shows bactericidal activity against the Pasteurellaceae bacteria that cause pneumonia in cattle, and appear not to have evolved resistance, whereas M. bovis appears to be resistant. A non-synonymous single nucleotide polymorphism in the coding region was identified, and synthetic peptides corresponding to these polymorphic sequences had differing bactericidal activity against M. haemolytica.
294
K. Taha-Abdelaziz et al. / Veterinary Immunology and Immunopathology 152 (2013) 289–294
Acknowledgements This research was supported by the Ontario Cattlemen’s Association and the Natural Sciences and Engineering Research Council (NSERC). Dr. Perez-Casal was supported by the Krembil Foundation, the Ontario Cattlemen’s Association and the Alberta Beef Producers. We thank Dr. Reggie Lo for providing the LMCap1 and SH1217 strains of M. haemolytica, and Dr. Gary Umphrey for assistance with the statistical analysis. References Al-Haddawi, M., Mitchell, G.B., Clark, M.E., Wood, R.D., Caswell, J.L., 2007. Impairment of innate immune responses of airway epithelium by infection with bovine viral diarrhea virus. Vet. Immunol. Immunopathol. 116, 153–162. Bals, R., 2000. Epithelial antimicrobial peptides in host defense against infection. Respir. Res. 1, 141–150. Cole, A.M., Dewan, P., Ganz, T., 1999. Innate antimicrobial activity of nasal secretions. Infect. Immun. 67, 3267–3275. Diamond, G., Kaiser, V., Rhodes, J., Russell, J.P., Bevins, C.L., 2000a. Transcriptional regulation of beta-defensin gene expression in tracheal epithelial cells. Infect. Immun. 68, 113–119. Diamond, G., Legarda, D., Ryan, L.K., 2000b. The innate immune response of the respiratory epithelium. Immunol. Rev. 173, 27–38. Hiemstra, P.S., 2001. Epithelial antimicrobial peptides and proteins: their role in host defence and inflammation. Paediatr. Respir. Rev. 2, 306–310. Huttner, K.M., Bevins, C.L., 1999. Antimicrobial peptides as mediators of epithelial host defense. Pediatr. Res. 45, 785–794. Kagan, B.L., Ganz, T., Lehrer, R.I., 1994. Defensins: a family of antimicrobial and cytotoxic peptides. Toxicology 87, 131–149. Kraus, D., Peschel, A., 2006. Molecular mechanisms of bacterial resistance to antimicrobial peptides. Curr. Top. Microbiol. Immunol. 306, 231–250. Kuwano, K., Tanaka, N., Shimizu, T., Kida, Y., 2006. Antimicrobial activity of inducible human beta defensin-2 against Mycoplasma pneumoniae. Curr. Microbiol. 52, 435–438.
Lai, Y., Gallo, R.L., 2009. AMPed up immunity: how antimicrobial peptides have multiple roles in immune defense. Trends Immunol. 30, 131–141. Lawyer, C., Pai, S., Watabe, M., Bakir, H., Eagleton, L., Watabe, K., 1996a. Effects of synthetic form of tracheal antimicrobial peptide on respiratory pathogens. J. Antimicrob. Chemother. 37, 599–604. Lawyer, C., Watabe, M., Pai, S., Bakir, H., Eagleton, L., Mashimo, T., Watabe, K., 1996b. A synthetic form of tracheal antimicrobial peptide has both bactericidal and antifungal activities. Drug Des. Discov. 14, 171–178. Lehrer, R.I., Rosenman, M., Harwig, S.S., Jackson, R., Eisenhauer, P., 1991. Ultrasensitive assays for endogenous antimicrobial polypeptides. J. Immunol. Methods 137, 167–173. McKerral, L.J., Lo, R.Y., 2002. Construction and characterization of an acapsular mutant of Mannheimia haemolytica A1. Infect. Immun. 70, 2622–2629. Mitchell, G.B., Al-Haddawi, M.H., Clark, M.E., Beveridge, J.D., Caswell, J.L., 2007. Effect of corticosteroids and neuropeptides on the expression of defensins in bovine tracheal epithelial cells. Infect. Immun. 75, 1325–1334. Moranta, D., Regueiro, V., March, C., Llobet, E., Margareto, J., Larrarte, E., Garmendia, J., Bengoechea, J.A., 2010. Klebsiella pneumoniae capsule polysaccharide impedes the expression of beta-defensins by airway epithelial cells. Infect. Immun. 78, 1135–1146. Nizet, V., 2006. Antimicrobial peptide resistance mechanisms of human bacterial pathogens. Curr. Issues Mol. Biol. 8, 11–26. Russell, J.P., Diamond, G., Tarver, A.P., Scanlin, T.F., Bevins, C.L., 1996. Coordinate induction of two antibiotic genes in tracheal epithelial cells exposed to the inflammatory mediators lipopolysaccharide and tumor necrosis factor alpha. Infect. Immun. 64, 1565–1568. Singh, P.K., Jia, H.P., Wiles, K., Hesselberth, J., Liu, L., Conway, B.A., Greenberg, E.P., Valore, E.V., Welsh, M.J., Ganz, T., Tack, B.F., McCray Jr., P.B., 1998. Production of beta-defensins by human airway epithelia. Proc. Natl. Acad. Sci. U.S.A. 95, 14961–14966. Tosi, M.F., 2005. Innate immune responses to infection. J. Allergy Clin. Immunol. 116, 241–249 (quiz 250). Yanagi, S., Ashitani, J., Imai, K., Kyoraku, Y., Sano, A., Matsumoto, N., Nakazato, M., 2007. Significance of human beta-defensins in the epithelial lining fluid of patients with chronic lower respiratory tract infections. Clin. Microbiol. Infect. 13, 63–69. Yang, J., Sang, Y., Meade, K.G., Ross, C., 2011. The role of oct-1 in the regulation of tracheal antimicrobial peptide (TAP) and lingual antimicrobial peptide (LAP) expression in bovine mammary epithelial cells. Immunogenetics 63, 715–725.
Contents lists available at SciVerse ScienceDirect
Veterinary Immunology and Immunopathology journal homepage: www.elsevier.com/locate/vetimm
Research paper
Bactericidal activity of tracheal antimicrobial peptide against respiratory pathogens of cattle Khaled Taha-Abdelaziz a,b , José Perez-Casal c , Courtney Schott a , Jason Hsiao a , – Slavic´ d , Jeff L. Caswell a,∗ Samuel Attah-Poku b , Durda a b c d
Department of Pathobiology, University of Guelph, Guelph, ON, Canada Pathology Department, Faculty of Veterinary Medicine, Beni-Suef University, Beni-Suef, Egypt Vaccine and Infectious Disease Organization-International Vaccine Centre, Saskatoon, SK, Canada Animal Health Laboratory, University of Guelph, Guelph, ON, Canada
a r t i c l e
i n f o
Article history: Received 28 July 2012 Received in revised form 5 December 2012 Accepted 28 December 2012 Keywords: Innate immunity Cattle Bactericidal activity Antimicrobial peptides Mannheimia haemolytica Mycoplasma bovis Single nucleotide polymorphism
a b s t r a c t Tracheal antimicrobial peptide (TAP) is a -defensin produced by mucosal epithelial cells of cattle. Although effective against several human pathogens, the activity of this bovine peptide against the bacterial pathogens that cause bovine respiratory disease have not been reported. This study compared the antibacterial effects of synthetic TAP against Mannheimia haemolytica, Histophilus somni, Pasteurella multocida, and Mycoplasma bovis. Bactericidal activity against M. bovis was not detected. In contrast, the Pasteurellaceae bacteria showed similar levels of susceptibility to that of Escherichia coli, with 0.125 g TAP inhibiting growth in a radial diffusion assay and minimum inhibitory concentrations of 1.56–6.25 g/ml in a bactericidal assay. Significant differences among isolates were not observed. Sequencing of exon 2 of the TAP gene from 23 cattle revealed a prevalent non-synonymous single nucleotide polymorphism (SNP) A137G, encoding either serine or asparagine at residue 20 of the mature peptide. The functional effect of this SNP was tested against M. haemolytica using synthetic peptides. The bactericidal effect of the asparagine-containing peptide was consistently higher than the serine-containing peptide. Bactericidal activities were similar for an acapsular mutant of M. haemolytica compared to the wild type. These findings indicate that the Pasteurellaceae bacteria that cause bovine respiratory disease are susceptible to killing by bovine TAP and appear not to have evolved resistance, whereas M. bovis appears to be resistant. A non-synonymous SNP was identified in the coding region of the TAP gene, and the corresponding peptides vary in their bactericidal activity against M. haemolytica. © 2013 Elsevier B.V. All rights reserved.
1. Introduction Tracheal antimicrobial peptide (TAP), the firstdiscovered member of the -defensin family, is a 38 amino acid cationic peptide produced by epithelial cells lining the respiratory tract and other mucosal surfaces
∗ Corresponding author at: Department of Pathobiology, University of Guelph, Guelph, Ontario N1G 2W1, Canada. Tel.: +1 519 824 4120x54555; fax: +1 519 824 5930. E-mail address: [email protected] (J.L. Caswell). 0165-2427/$ – see front matter © 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.vetimm.2012.12.016
(Diamond et al., 2000a,b; Bals, 2000). The antimicrobial activity of TAP is thought to result from disruption of bacterial membranes and later pore formation, which results from the electrostatic interaction of the positively charged peptide and negatively charged phospholipid of the bacterial membrane (Kagan et al., 1994; Hiemstra, 2001). Gene expression of TAP is upregulated following exposure to lipopolysaccharide and other inflammatory stimuli (Russell et al., 1996; Diamond et al., 2000a,b; Yang et al., 2011). However, we have previously shown that glucocorticoids and bovine viral diarrhea virus infection impair
290
K. Taha-Abdelaziz et al. / Veterinary Immunology and Immunopathology 152 (2013) 289–294
this inducible innate immune response (Al-Haddawi et al., 2007; Mitchell et al., 2007). These findings suggest that impaired TAP expression may be one mechanism by which stress or viral infection predisposes to pneumonia, and this may be a target for novel interventions to prevent the disease. Although TAP has bactericidal activity against several human pathogens (Lawyer et al., 1996a,b), the effect of this bovine protein on bovine respiratory pathogens is unknown. Some pathogens are known to evade killing by antimicrobial peptides, by blocking the signaling pathways that upregulate their expression (Nizet, 2006), secreting proteins that cleave or trap antimicrobial proteins, or lessening their negative surface charge to reduce their affinity for cationic peptides (Kraus and Peschel, 2006). Thus, although TAP has been shown to kill human respiratory pathogens, bacteria that are adapted to cause pneumonia in cattle may have evolved mechanisms to resist TAPmediated killing. Thus, the objective of this work was to determine if TAP kills the bacterial pathogens that cause respiratory disease in cattle. Further, we report a non-synonymous single nucleotide polymorphism (SNP) in the coding region of the TAP gene, and characterize its effect on microbicidal activity against Mannheimia haemolytica.
2. Methods 2.1. Preparation of TAP TAP was synthesized as a linear polypeptide onto a resin, cleaved from the resin, purified by high performance liquid chromatography on a reverse phase column, and eluted with water/acetonitrile solvents. Three peptides were synthesized: 23G, with serine at position 20 and glycine at position 23; 20S with serine at residue 20 and glutamine at residue 23, and 20N with asparagine at residue 20 and glutamine at residue 23 (Table 1). Using MALDI-TOF, the mass spectral analysis confirmed the three synthesized peptides to be pure, with masses as expected: 23G – 4037.8 Da; 20S – 4091.1; 20N – 4118.1 Da. The protein concentrations of the samples were subsequently confirmed (2-D Quant Kit, GE Healthcare, Piscataway, NJ). The linear molecule was oxidized in solution to give the disulfidebridged molecule, and a mass spectral analysis of the product indeed indicated a loss of 6 mass units confirming that 3 disulfide bonds have been formed during the oxidation. In preliminary experiments, the bactericidal activity of oxidized and non-oxidized peptides was found to have similar activities, so subsequent studies used the oxidized peptides.
2.2. Assays of antimicrobial activity The antimicrobial activity of synthetic TAP was measured against isolates of M. haemolytica (n = 8), Histophilus somni (n = 3), and Pasteurella multocida (n = 3) from the lung of cattle with pneumonia; in addition, 1 isolate of Escherichia coli from a calf with diarrhea was tested. The initial studies used synthetic peptide 23G. Subsequent studies compared the effect of the polymorphism described below, using peptides 20S and 20N. Bacteriostatic activity was measured using an agarbased radial diffusion assay (Lehrer et al., 1991; Lawyer et al., 1996a,b). Bacterial isolates were grown in 50 ml tryptose soy broth for 18 h at 37 ◦ C (in 5% CO2 for H. somni), then 500 l was re-inoculated in 50 ml of fresh broth and incubated for 3–4 h at 37 ◦ C to reach mid-log phase. The bacterial suspension was centrifuged at 900 × g for 10 min at 4 ◦ C, re-suspended in 10 ml of 10 mM sodium phosphate buffer (pH 7.4), and the concentration was estimated based on the optical density measured at 620 nm. 107 CFU bacteria were mixed with 30 ml of 1% agarose in 10 mM sodium phosphate buffer, 2 mg Tween20 and 30 mg tryptose soy powder. The agar was cooled in a plastic plate, then 3 mm diameter holes were punched in the agar plate, and 0.125–2.0 g TAP or medium were added to each well. Plates were incubated at 37 ◦ C for 1 h, then covered with 10 ml of melted 1% agarose with 10 mM sodium phosphate and 6 g tryptose soy powder, and incubated for 24 h at 37 ◦ C. The diameters of the zones of inhibition were measured. In order to measure bactericidal activity, bacteria were prepared as above, and 2 × 104 CFU were exposed to various concentrations of TAP (2-fold dilutions from 100 to 0.78 mg/ml, in sodium phosphate buffer, 50 l final volume, in triplicate) for 2 h at 37 ◦ C, then plated onto blood agar and incubated at 37 ◦ C for 24 h. The numbers of surviving colony forming units were counted. A similar technique was used to measure bactericidal activity against three isolates (A, B and C) of Mycoplasma bovis, obtained from feedlot cattle with caseonecrotic bronchopneumonia, with the following modifications. Bacteria were grown for 48 h at 37 ◦ C in modified Hayflick’s broth with 20% pig serum, centrifuged at 35,800 × g for 30 min at 4 ◦ C, resuspended in ¼ strength Ringer’s solution containing 18 g/L HEPES, pH 7.6, or sodium phosphate buffer containing 18 g/L HEPES, pH 7.6. The initial concentrations of bacteria were 10, 55 and 83 × 104 CFU/ml for the three isolates. Bacterial suspensions were incubated with 0, 3, 30 and 300 g/ml TAP for 2 h, then surviving bacteria were enumerated by plating a 10-fold dilution series on modified Hayflick’s agar with 20% pig serum for 48 h at 37 ◦ C in 5.5% CO2 . 2.3. Analysis of a non-synonymous SNP
Table 1 Amino acid sequences of the 3 synthesized peptides. Peptide name
Amino acid sequence
23G 20S 20N
npvs cvrnkgicvp ircpgsmkgi gtcvgravkc crkk npvs cvrnkgicvp ircpgsmkqi gtcvgravkc crkk npvs cvrnkgicvp ircpgnmkqi gtcvgravkc crkk
Tracheal samples were obtained at slaughter on 5 different days from 23 beef cattle of unknown breed, using samples from different lots of cattle to avoid genetic relatedness among donors. DNA was extracted (QIAamp DNA Minikit, Qiagen, Valencia, CA), and a 653 bp fragment of the TAP gene including part of the intron and the entire coding region of exon 2 was amplified using the primers (F)
K. Taha-Abdelaziz et al. / Veterinary Immunology and Immunopathology 152 (2013) 289–294
Fig. 1. Radial diffusion assay. TAP induces dose-dependent inhibition of growth of representative isolates of different bovine bacterial pathogens.
5 -aacagtgaaaatagacccctgtg and (R) 5 caccacacaacaacctcagtg and sequenced in the forward and reverse directions (Laboratory Services, University of Guelph). A single non-synonymous SNP was identified (NCBI dbSNP accession number 530855967) and its functional effect was investigated using 2 synthetic peptides with either serine (20S) or asparagine (20N) at residue 20; both of these peptides had glutamine at position 23 as in the published coding sequence (NCBI L13373.1). Antibacterial activity against M. haemolytica was evaluated using the radial diffusion assay as described above, and using the bactericidal activity assay. For the latter, 2.8 × 105 CFU/ml M. haemolytica bacteria were exposed to various concentrations of each peptide (2-fold dilutions from 100 to 0.78 g/ml) for 2 h at 37 ◦ C, then plated onto blood agar and incubated at 37 ◦ C for 24 h. The numbers of surviving colony forming units were counted. Assays were conducted in triplicate and repeated twice. 2.4. Analysis of an acapsular mutant Acapsular mutant (LMCap1) and wildtype (SH1217) strains of M. haemolytica, which were kindly provided by Dr. Reggie Lo, Department of Cellular and Molecular Biology, University of Guelph (McKerral and Lo, 2002). To test the hypothesis that TAP-mediated killing is dependent on the bacterial capsule (Moranta et al., 2010), the bactericidal activity of the 20S and 20N peptides were measured against LMCap1 and SH1217 as described above.
291
Fig. 2. Radial diffusion assay. TAP (2.0 g per well) inhibits growth of bovine bacterial pathogens. No significant difference was found between M. haemolytica (n = 8), P. multocida (n = 3), H. somni (n = 3), and E. coli (n = 1).
were 10.8 ± 0.4 mm for M. haemolytica, 8.0 ± 0 mm for H. somni, 9.7 ± 0.3 mm for P. multocida and 10.0 for E. coli (Fig. 2). Differences between isolates of the same species were not observed, and differences between M. haemolytica, E. coli, P. multocida and H. somni were not significant. 3.2. Bactericidal effect of synthetic TAP Incubation of bacteria with varying concentrations of TAP resulted in dose-dependent reduction in the number of surviving colony forming units. The minimum inhibitory concentrations were 3.1 ± 0 g/ml for M. haemolytica (3 isolates), 4.7 ± 1.6 g/ml for H. somni (3 isolates), 2.3 ± 0.8 g/ml for P. multocida (3 isolates), and 3.1 ± 0 g/ml for E. coli (1 isolate) (Fig. 3). Differences between bacterial species or between isolates of the same species were not significant (2-way ANOVA). In contrast, 3–300 g/ml TAP had no significant effect on survival of M. bovis, using either sodium phosphate buffer (Fig. 4) or ¼ strength Ringer’s solution as the buffer. 3.3. Analysis of a non-synonymous SNP A non-synonymous SNP of alanine or glycine was identified at position 137 of the coding sequence (A137G), in exon 2, corresponding to nucleotide 3156 in the NCBI reference sequence L13373.1 (NCBI dbSNP accession number
2.5. Statistical analysis Laboratory analyses were repeated at least once with similar findings. The results were evaluated by two-way analysis of variance GraphPad software (GraphPad Prism v4.0b, GraphPad Software, San Diego, CA). Values are listed as mean ± standard error of the mean (SEM). 3. Results 3.1. Growth inhibition: radial diffusion assay The addition of 0.125–2.0 g of TAP resulted in dosedependent inhibition of growth of all bacteria tested (Fig. 1). Using 2.0 g of TAP, the diameters of inhibition
Fig. 3. TAP abolished the growth of bovine bacterial pathogens. No significant difference in minimum inhibitory concentration was found between M. haemolytica, P. multocida, H. somni (each n = 3), and E. coli (n = 1).
292
K. Taha-Abdelaziz et al. / Veterinary Immunology and Immunopathology 152 (2013) 289–294
Fig. 4. Concentrations of tracheal antimicrobial peptide from 3 to 300 g/ml do not significantly inhibit the survival of three isolates (A, B and C) of Mycoplasma bovis.
530855967). This polymorphism encoded either serine (S) or asparagine (N) at residue 20 of the mature peptide (position 46) of the translated peptide. Of the 23 calves sequenced, 6 were homozygous for guanine (AGC, encoding serine [S]), 5 were homozygous for adenine (AAC, encoding asparagine [N]), and 12 were heterozygous (G/A = R). A second (synonymous) SNP encoding threonine or cysteine was found at position 162 of the coding sequence (T162C) in exon 2, corresponding to nucleotide 3181 in the NCBI reference sequence L13373.1 (NCBI dbSNP accession number 530855969). Both variants encoded the amino acid valine (GTT, GTC) at amino acid 28 of the mature peptide, and this synonymous SNP was not investigated further. Other SNPs were identified in the non-coding regions of the gene (NCBI dbSNP accession numbers 530855934–530855967). The functional effect of the non-synonymous SNP was evaluated by testing the bactericidal activity of the corresponding synthetic peptides against three isolates of M. haemolytica. Bactericidal activities (calculated as the percent reduction in surviving bacteria compared to medium alone, for the three isolates of M. haemolytica) for the 20S and 20N TAP peptides respectively, were 100 ± 0% and 100 ± 0% for 3.12 g/ml of TAP, 99.1 ± 0.12% and 99.8 ± 0.08% for 1.56 g/ml TAP, and 49.5 ± 3.18% and 66.0 ± 4.7% for 0.78 g/ml TAP. The bactericidal effect of the peptide 20N was consistently higher than that of the peptide 20S (Fig. 5), and this difference between peptides was significant at the 1.56 and 0.78 g/ml concentrations (P < 0.0001, 2-way ANOVA with post hoc Tukey’s test). This experiment was repeated with similar results, and the same effect was confirmed in the radial diffusion assay (data not shown).
Fig. 5. The bactericidal effect of the TAP amino acid polymorphism. The bactericidal activity against 3 isolates of M. haemolytica was significantly higher with the peptide containing asparagine at position 20 (20N) compared to the peptide containing serine at position 20 (20S). (a) 0.78 g/ml TAP; (b) 1.56 g/ml TAP.
3.4. Analysis of an acapsular mutant Finally, the bactericidal activity of the 20S and 20N peptides were measured against acapsular mutant (LMCap1) and wild-type (SH1217) strains of M. haemolytica. The greater bactericidal activity of the 20N compared to the 20S peptide was confirmed in this experiment, but there was no difference in survival of these two strains (Fig. 6). 4. Discussion The present study investigated the effect of bovine TAP against the major bacterial causes of respiratory diseases in cattle, and indicated the presence and functional
Fig. 6. The bactericidal activity of TAP is similar against the acapsular mutant (LMCap1) and wildtype (SH1217) strains of M. haemolytica. Greater bactericidal activity of the 20N (a) compared to the 20S (b) peptide is similar to that described above.
K. Taha-Abdelaziz et al. / Veterinary Immunology and Immunopathology 152 (2013) 289–294
significance of a non-synonymous SNP in the TAP gene. The antibacterial activity of synthetic TAP was tested against 8 isolates of M. haemolytica, 3 isolates of H. somni, 3 isolates of P. multocida and 1 isolate of E. coli. Results were dose-dependent and were equivalent with the two assays used—the radial diffusion assay of growth inhibition, and the assay of bactericidal activity—implying that the peptide has a bactericidal rather than bacteriostatic effect as has been previously reported (Lawyer et al., 1996a,b; Huttner and Bevins, 1999). The various isolates of the three respiratory pathogens (M. haemolytica, P. multocida and H. somni) each showed a similar level of susceptibility. The minimum inhibitory concentrations were not significantly different among M. haemolytica, H. somni, P. multocida, and E. coli. The finding of similar degrees of sensitivity of these four pathogens, and those reported in a prior study of human bacterial pathogens (Lawyer et al., 1996a,b), indicate that these isolates have not evolved effective methods to evade killing by TAP, and are susceptible to the bactericidal effects of this -defensin. In contrast to prior findings with Klebsiella pneumoniae (Moranta et al., 2010), the presence or absence of a bacterial capsule had no effect on -defensin-mediated killing in this study. With the bactericidal assay, TAP was effective in a dosedependent manner in the range of 0.78–100 g/ml (0.19 to 24 M). The MIC for E. coli in this study was similar to that found in a prior study using synthetic TAP and similar methodology (Lawyer et al., 1996a,b). Reported concentrations of human -defensin-2 in the surface liquid of cultured epithelial cells was 8–10 g/ml. Reported in vivo HBD-2 concentrations in humans include 0.3–4 g/ml in nasal secretions (Cole et al., 1999), and 10–100 ng/ml in the bronchoalveolar lavage fluid of human patients with inflammatory lung disease patients (Singh et al., 1998). In contrast, more recent papers have found considerably lower -defensin concentrations in pulmonary epithelial lining fluid: 5–20 ng/ml for HBD-1, and <0.2 or 0.1–1.0 ng/ml for HBD-2 in healthy individuals and those with chronic lower respiratory infection respectively (Yanagi et al., 2007). The in vivo concentrations of TAP have not been described, so it remains unconfirmed whether the MIC values reported here (1.56–6.25 g/ml) would be attained in calves with an acute inflammatory response. Together, these findings suggest that TAP is able to kill the bacterial pathogens that cause respiratory disease in cattle, and that development of pneumonia would require that production of TAP is suppressed by stress-induced elevations in cortisol concentration (Mitchell et al., 2007), by prior viral infection (Al-Haddawi et al., 2007), or by impairment of other lung defenses that may overwhelm the protective capacity of TAP. In contrast to above findings with M. haemolytica, H. somni and P. multocida, TAP had no significant bactericidal effect on isolates of M. bovis, using TAP concentrations of 3, 30 and 300 g/ml. Similar findings were obtained with two different media—¼ strength Ringer’s solution and sodium phosphate buffer. Although it remains possible that the in vitro experimental condition may affect the bactericidal activity of TAP, bactericidal activity was demonstrated
293
against other bacteria using similar culture conditions in this study, and against M. pneumoniae in previous work (Kuwano et al., 2006). Thus, these findings suggest that M. bovis is resistant to the bactericidal effects of bovine TAP. These conclusions are qualified by the in vitro nature of the present studies. Synthetic peptides were used, and although these were oxidized to achieve the secondary structure resulting from formation of disulfide bonds, it remains possible that the peptide synthesized in bovine airways differs in secondary or tertiary structure from that synthesized in vitro. However, it seems unlikely that the naturally synthesized peptide would have a lower antibacterial effect than what was found for the synthetic peptide in this study. Finally, we restricted our assessments to the important opportunistic bacteria that cause respiratory disease in cattle, and we did not investigate the effect on Gram positive bacteria, fungi, viruses, or pathogens that cause mastitis or enteric disease. The second component of this study investigated the presence and functional significance of a non-synonymous SNP in the TAP gene. Other SNPs were identified in the noncoding regions of the gene (data not shown), but these will be characterized and reported elsewhere. The A137G SNP in exon 2 encoded serine or asparagine at residue 20 of the mature peptide, and this polymorphism was prevalent in the 23 calves sequenced. Synthetic peptides were used to measure the functional effect of the SNP on bactericidal activity. The peptides were free of salts and shown to be pure, and subsequent testing confirmed the protein concentrations of the two preparations to be the same. For all 3 isolates of M. haemolytica tested, the bactericidal activity was higher for the peptide containing asparagine compared to the peptide containing serine. -Defensins kill bacteria through membrane disruption that results from electrostatic interactions between positively charged molecules of the peptide and negatively charged phospholipids on the bacterial membrane (Tosi, 2005; Lai and Gallo, 2009). Therefore, we speculate that the greater bactericidal activity of the asparagine-containing peptide may be attributed to the greater affinity of this peptide to negatively charged bacteria, since asparagine has a greater polarity than serine. The finding that a SNP has an impact on bactericidal activity of the resulting peptide suggests the potential for genetic selection to improve disease resistance. These findings require additional investigation to test the association of this SNP with the prevalence and type of respiratory disease at the population level.
5. Conclusion Bovine TAP shows bactericidal activity against the Pasteurellaceae bacteria that cause pneumonia in cattle, and appear not to have evolved resistance, whereas M. bovis appears to be resistant. A non-synonymous single nucleotide polymorphism in the coding region was identified, and synthetic peptides corresponding to these polymorphic sequences had differing bactericidal activity against M. haemolytica.
294
K. Taha-Abdelaziz et al. / Veterinary Immunology and Immunopathology 152 (2013) 289–294
Acknowledgements This research was supported by the Ontario Cattlemen’s Association and the Natural Sciences and Engineering Research Council (NSERC). Dr. Perez-Casal was supported by the Krembil Foundation, the Ontario Cattlemen’s Association and the Alberta Beef Producers. We thank Dr. Reggie Lo for providing the LMCap1 and SH1217 strains of M. haemolytica, and Dr. Gary Umphrey for assistance with the statistical analysis. References Al-Haddawi, M., Mitchell, G.B., Clark, M.E., Wood, R.D., Caswell, J.L., 2007. Impairment of innate immune responses of airway epithelium by infection with bovine viral diarrhea virus. Vet. Immunol. Immunopathol. 116, 153–162. Bals, R., 2000. Epithelial antimicrobial peptides in host defense against infection. Respir. Res. 1, 141–150. Cole, A.M., Dewan, P., Ganz, T., 1999. Innate antimicrobial activity of nasal secretions. Infect. Immun. 67, 3267–3275. Diamond, G., Kaiser, V., Rhodes, J., Russell, J.P., Bevins, C.L., 2000a. Transcriptional regulation of beta-defensin gene expression in tracheal epithelial cells. Infect. Immun. 68, 113–119. Diamond, G., Legarda, D., Ryan, L.K., 2000b. The innate immune response of the respiratory epithelium. Immunol. Rev. 173, 27–38. Hiemstra, P.S., 2001. Epithelial antimicrobial peptides and proteins: their role in host defence and inflammation. Paediatr. Respir. Rev. 2, 306–310. Huttner, K.M., Bevins, C.L., 1999. Antimicrobial peptides as mediators of epithelial host defense. Pediatr. Res. 45, 785–794. Kagan, B.L., Ganz, T., Lehrer, R.I., 1994. Defensins: a family of antimicrobial and cytotoxic peptides. Toxicology 87, 131–149. Kraus, D., Peschel, A., 2006. Molecular mechanisms of bacterial resistance to antimicrobial peptides. Curr. Top. Microbiol. Immunol. 306, 231–250. Kuwano, K., Tanaka, N., Shimizu, T., Kida, Y., 2006. Antimicrobial activity of inducible human beta defensin-2 against Mycoplasma pneumoniae. Curr. Microbiol. 52, 435–438.
Lai, Y., Gallo, R.L., 2009. AMPed up immunity: how antimicrobial peptides have multiple roles in immune defense. Trends Immunol. 30, 131–141. Lawyer, C., Pai, S., Watabe, M., Bakir, H., Eagleton, L., Watabe, K., 1996a. Effects of synthetic form of tracheal antimicrobial peptide on respiratory pathogens. J. Antimicrob. Chemother. 37, 599–604. Lawyer, C., Watabe, M., Pai, S., Bakir, H., Eagleton, L., Mashimo, T., Watabe, K., 1996b. A synthetic form of tracheal antimicrobial peptide has both bactericidal and antifungal activities. Drug Des. Discov. 14, 171–178. Lehrer, R.I., Rosenman, M., Harwig, S.S., Jackson, R., Eisenhauer, P., 1991. Ultrasensitive assays for endogenous antimicrobial polypeptides. J. Immunol. Methods 137, 167–173. McKerral, L.J., Lo, R.Y., 2002. Construction and characterization of an acapsular mutant of Mannheimia haemolytica A1. Infect. Immun. 70, 2622–2629. Mitchell, G.B., Al-Haddawi, M.H., Clark, M.E., Beveridge, J.D., Caswell, J.L., 2007. Effect of corticosteroids and neuropeptides on the expression of defensins in bovine tracheal epithelial cells. Infect. Immun. 75, 1325–1334. Moranta, D., Regueiro, V., March, C., Llobet, E., Margareto, J., Larrarte, E., Garmendia, J., Bengoechea, J.A., 2010. Klebsiella pneumoniae capsule polysaccharide impedes the expression of beta-defensins by airway epithelial cells. Infect. Immun. 78, 1135–1146. Nizet, V., 2006. Antimicrobial peptide resistance mechanisms of human bacterial pathogens. Curr. Issues Mol. Biol. 8, 11–26. Russell, J.P., Diamond, G., Tarver, A.P., Scanlin, T.F., Bevins, C.L., 1996. Coordinate induction of two antibiotic genes in tracheal epithelial cells exposed to the inflammatory mediators lipopolysaccharide and tumor necrosis factor alpha. Infect. Immun. 64, 1565–1568. Singh, P.K., Jia, H.P., Wiles, K., Hesselberth, J., Liu, L., Conway, B.A., Greenberg, E.P., Valore, E.V., Welsh, M.J., Ganz, T., Tack, B.F., McCray Jr., P.B., 1998. Production of beta-defensins by human airway epithelia. Proc. Natl. Acad. Sci. U.S.A. 95, 14961–14966. Tosi, M.F., 2005. Innate immune responses to infection. J. Allergy Clin. Immunol. 116, 241–249 (quiz 250). Yanagi, S., Ashitani, J., Imai, K., Kyoraku, Y., Sano, A., Matsumoto, N., Nakazato, M., 2007. Significance of human beta-defensins in the epithelial lining fluid of patients with chronic lower respiratory tract infections. Clin. Microbiol. Infect. 13, 63–69. Yang, J., Sang, Y., Meade, K.G., Ross, C., 2011. The role of oct-1 in the regulation of tracheal antimicrobial peptide (TAP) and lingual antimicrobial peptide (LAP) expression in bovine mammary epithelial cells. Immunogenetics 63, 715–725.