Bacteriocinogenic potential and safety evaluation of non-starter Enterococcus faecium strains isolated from home made white brine cheese

Food Microbiology 38 (2014) 228e239

Contents lists available at ScienceDirect

Food Microbiology journal homepage: www.elsevier.com/locate/fm

Bacteriocinogenic potential and safety evaluation of non-starter Enterococcus faecium strains isolated from home made white brine cheese Lorenzo Favaro a, *, Marina Basaglia a, Sergio Casella a, Isabelle Hue b, Xavier Dousset b, Bernadette Dora Gombossy de Melo Franco c, Svetoslav Dimitrov Todorov c a

Department of Agronomy Food Natural resources Animals and Environment (DAFNAE), University of Padova, Agripolis, Viale dell’Università 16, 35020 Legnaro, PD, Italy UMR INRA Secalim 1014 ONIRIS, rue Géraudière BP 82225, 44322 Nantes Cedex3, France c Department of Food Science and Experimental Nutrition, Faculty of Pharmaceutical Sciences, University of Sao Paulo, Av. Prof. Lineu Prestes 580, Bl. 14, 05508-000 São Paulo, SP, Brasil b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 8 May 2013 Received in revised form 22 August 2013 Accepted 29 September 2013 Available online 9 October 2013

Four LAB strains, isolated from Bulgarian home made white brine cheese, were selected for their effective inhibition against Listeria monocytogenes. According to their biochemical and physiological characteristics, the strains were classified as members of Enterococcus genus, and then identified as Enterococcus faecium by 16S rDNA sequencing. Their bacteriocin production and inhibitory spectrum were evaluated together with the occurrence of several bacteriocin genes (entA, entB, entP, entL50B). Their virulence potential and safety was assessed both using PCR targeted to the genes gelE, hyl, asa1, esp, cylA, efaA, ace, vanA, vanB, hdc1, hdc2, tdc and odc and by phenotypical tests for antibiotic resistance, gelatinase, lipase, DNAse and a- and b-haemolysis. The E. faecium strains harboured at least one enterocin gene while the occurrence of virulence, antibiotic resistance and biogenic amines genes was limited. Considering their strong antimicrobial activity against L. monocytogenes strains, the four E. faecium strains exhibited promising potential as bio-preservatives cultures for fermented food productions. Ó 2013 Elsevier Ltd. All rights reserved.

Keywords: Enterococcus faecium Bacteriocin Anti-Listeria monocytogenes activity Safety Virulence White brine cheese

1. Introduction In the last few decades consumers increased their demand for natural and chemical additive-free products urging the food industry to look for novel and alternative strategies for food biopreservation (Javed et al., 2011; Balciunas et al., 2013). One of the proposed routes was the use of bacteriocins produced by lactic acid bacteria (LAB), defined as ribosomally synthesized antimicrobial peptides that exhibit antagonism mainly against Gram-positive bacteria (Cotter et al., 2005; Gillor et al., 2008). Their bactericidal mechanisms vary and may include pore formation, degradation of cellular DNA, disruption through specific cleavage of 16S rDNA and inhibition of peptidoglycan synthesis (Heu et al., 2001). At the present time, only nisin and pediocin PA-1 (as pure or semipurified preparations) are commercially authorized worldwide depending on local law regulation.

* Corresponding author. Tel.: þ39 049 8272926; fax: þ39 049 8272929. E-mail address: [email protected] (L. Favaro). 0740-0020/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fm.2013.09.008

Due to their tolerance to salts and acids, Enterococcus spp. strains are highly adapted to several food systems. They are often found in high numbers and are believed to contribute to cheese ripening and to the development of aroma, especially in cheese products made in the Mediterranean area (Foulquié-Moreno et al., 2006), due to proteolysis and lipolysis, and production of diacetyl (Giraffa, 2002). Enterococcus spp. species have been reported to produce bacteriocins belonging to different classes. Most of these bacteriocins are produced by Enterococcus faecium and Enterococcus faecalis (reviewed in Giraffa, 1995; Moreno et al., 2003). Some enterococci have been also investigated with regard to their potential as probiotics (Giraffa, 1995; Foulquié-Moreno et al., 2006; Sparo et al., 2008; Todorov and Dicks, 2008). However, such a role is still controversial considering both their increased association with nosocomial infections and their harbouring multiple antibiotic-resistant genes, transmissible by conjugation to pathogenic microorganisms (Dicks et al., 2011; Montalban-Lopez et al., 2011). In addition, several putative virulence factors have been described in enterococci, such as aggregation substance protein, gelatinase, cytolysin, enterococcal surface proteins,

L. Favaro et al. / Food Microbiology 38 (2014) 228e239

hyaluronidase, accessory colonisation factors and endocarditis antigens (Barbosa et al., 2010; Vankerckhoven et al., 2004). On the other hand, few studies have recently demonstrated safe application of enterococci in foods (Giraffa, 2002). In this study, non-starter bacteriocin-producing strains isolated from home made goat white brine cheese produced in Belogratchik (Bulgaria) were evaluated for their bacteriocinogenic potential as well as for their beneficial and technological properties. The strains have been identified to be E. faecium, the bacteriocins partially characterised and its mode of action studied. Moreover, their safety traits have been determined. To our knowledge, this is the first report on the production of bacteriocins by E. faecium isolated from goat white brine cheese from Bulgaria. The final objective of this work was to characterize the produced bacteriocins, with the future aim of using the strains as potential biopreservatives cultures in cheese/milk fermentations. 2. Materials and methods 2.1. 1. Isolation and identification of LAB Bacteriocinogenic LAB were isolated from home made goat white brine cheese produced in Belogratchik, Bulgaria. 50 g of cheese were homogenized with 450 mL of saline solution [0.85% (w/v) NaCl] in a Stomacher (Laboratory Blender Stomacher 400, Seward, England). Serial decimal dilutions were prepared in physiological saline solution and aliquots plated on MRS agar (2%, w/v) plates (Difco, BD, Franklin Lakes, NJ, USA) and incubated for 48 h at 37  C. LAB were enumerated and plates presenting 15e20 colonies were covered with 10 mL of BHI (Oxoid, Basingstoke, UK) containing 1% (w/v) agar and 106 CFU/mL of Listeria monocytogenes Scott A. After incubating the plates for 24 h at 37  C, single colonies displaying an inhibition zone were selected, grown on MRS for purification and examined for colony morphology, production of catalase, acidification and microscopic characteristics (Gram staining and cell shape and size). Catalase negative and Gram-positive isolates that produced acid were then tested for their ability to grow in skim milk at 10  C and 45  C, in MRS broth (Difco) at pH 4.4 and 9.6, and in the presence of NaCl 6.5% (w/v). These bacteria were screened for bacteriocin production by agar-spot-test method (Todorov and Dicks, 2005)

229

against members of the genera Enterococcus, Lactobacillus, Lactococcus, Listeria and Pediococcus (Table 1). Activity was expressed as arbitrary units (AU) per mL, with one AU defined as the highest dilution showing a clear zone of inhibition (Todorov and Dicks, 2005). L. monocytogenes ATCC 7644, L. monocytogenes Scott A, Listeria innocua ATCC 33090 and Listeria ivanovii subsp. ivanovii ATCC 19119 were used as a sensitive test strain. The bacteriocin-producing isolates were pre-identified using API50CHL and API20Strep system (BioMerieux, Marcy-l’Etoile, France). The DNA of the microorganisms was extracted with the ZR Fungal/Bacterial DNA Kit (Zymo Research, Irvine, CA, USA) and further evaluated by use of the random amplification of polymorphic DNA (RAPD) PCR technique with primers OPL-02 (50 -TGG GCG TCA A-30 ), OPL-04 (50 -GAC TGC ACA C-30 ), OPL-14 (50 -GTG ACA GGC T-30 ) and OPL-20 (50 -TGG TGG ACC A-30 ) (Todorov et al., 2010). The amplified products were separated by electrophoresis in 1.4% (w/v) agarose gels in TAE buffer at 100 V for 2 h. Gels were stained in TAE buffer containing 0.5 mg/mL ethidium bromide (Sigmae Aldrich Diagnostics, St. Louis, MO, USA). Based on results of RAPD-PCR and size of the inhibition zone, isolates ST209GB, ST278GB, ST315GB and ST711GB were selected for future studies. The microorganisms were identified by the use of PCR genus-specific primers Ent1 and Ent2 (Todorov et al., 2010) and further confirmed by amplification of 16S rDNA with primers F8 and R1512 (Felske et al., 1997). Amplification products were checked by agarose gel electrophoresis, purified (QIAquick PCR Purification Kit e Qiagen, Hilden, Germany) and then subjected to sequencing. Species identification was performed after BlastN alignment (http://blast.ncbi.nlm.nih.gov/Blast.cgi) of the obtained sequences with those present in the GenBank public database. A minimum sequence similarity level of 99% was considered for species identification.

2.2. Characterization of the bacteriocins 2.2.1. Isolation of bacteriocins Strains ST209GB, ST278GB, ST315GB and ST711GB were cultured in MRS broth for 24 h at 37  C. The cells were harvested (8000  g for 10 min at 4  C), the cell-free supernatant was adjusted to pH 6.5 with 1 M NaOH, heat-treated (80  C for 10 min) and the amount of

Table 1 Spectrum of antibacterial activity of bacteriocins ST209GB, ST278GB, ST315GB and ST711GB produced by Enterococcus faecium strains. Test microorganisms

Medium

Incubation temperature ( C)

ST209GB

ST278GB

ST315GB

ST711GB

Enterococcus faecalis Enterococcus faecium Enterococcus mundtii Enterococcus spp. Lactobacillus acidophilus Lactobacillus curvatus Lactobacillus delbrueckii Lactobacillus fermentum Lactobacillus paracasei Lactobacillus plantarum Lactobacillus sakei Lactococcus lactis Leuconostoc mesenteroides subsp. mesenteroides Listeria innocua Listeria monocytogenes Listeria ivanovii subsp. ivanovii Pediococcus spp. Salmonella spp. Clostridium spp. Escherichia coli

MRS MRS MRS MRS MRS MRS MRS MRS MRS MRS MRS MRS MRS

30 30 30 30 30 30 30 30 30 30 30 30 30

6/6a 4/9 1/1 16/21 0/2 0/3 0/2 0/3 6/8 0/7 0/5 0/3 0/4

6/6 4/9 1/1 19/21 0/2 0/3 0/2 0/3 6/8 0/7 0/5 1/3 0/4

6/6 3/9 1/1 18/21 0/2 0/3 0/2 0/3 5/8 0/7 0/5 2/3 0/4

6/6 3/9 1/1 19/21 0/2 0/3 0/2 0/3 5/8 0/7 0/5 0/3 0/4

BHI BHI BHI MRS BHI BHI BHI

37 37 37 30 37 37 37

2/3 24/26 2/2 0/4 0/7 0/4 0/6

2/3 23/26 2/2 0/4 0/7 0/4 0/6

2/3 26/26 2/2 0/4 0/7 0/4 0/6

3/3 22/26 2/2 0/4 0/7 0/4 0/6

a

Number of strains inhibited out of the total number of tested strains.

230

L. Favaro et al. / Food Microbiology 38 (2014) 228e239

antimicrobial activity determined L. monocytogenes ATCC 7644.

by

testing

against

2.2.2. Effects of enzymes, pH, detergents and temperature on bacteriocins stability One mL of a cell-free supernatant obtained from 24 h culture of each E. faecium strain, prepared as described before, was added to 1 mg/mL a-amylase, catalase, proteinase K, pronase, trypsin, pepsin and papin (all from Sigma Diagnostics, St. Louis, MO, USA), respectively. Samples were incubated at 37  C for 30 min and then heated at 95e97  C for 5 min. In a separate experiment the pH of 10 mL of cell-free supernatants was adjusted to 2.0, 4.0, 6.0, 8.0, 10.0 or 12.0 with 1 M HCl or 1 M NaOH and incubated at 37  C for 1 h. Another batch of cell-free supernatants was treated with 10 mg/mL Triton X-100 (Sigma), Triton X-114 (Sigma), Tween 20 (Merck, Darmstadt, Germany), Tween 80 (Merck), NaCl (Sigma), SDS (Sigma), urea (Merck) or EDTA (Merck), respectively, and incubated for 30 min at 37  C. The effect of temperature on bacteriocins ST209GB, ST278GB, ST315GB and ST711GB was determined by incubating cell-free supernatants at 30, 37, 45, 60, 80 and 100  C for 30 min and 2 h, respectively, and at 121  C for 20 min. The pH of all samples was adjusted to 6.0 and bacteriocins ST209GB, ST278GB, ST315GB and ST711GB activity determined with L. monocytogenes ATCC 7644 as sensitive strain, as described above. 2.2.3. Production of bacteriocins Two mL of a 24 h culture of each E. faecium strain were inoculated into 200 mL MRS broth and incubated at 37  C. Optical density at 600 nm (OD600) and pH values were monitored hourly for 24 h. Bacteriocins ST209GB, ST278GB, ST315GB and ST711GB activity was measured every three hours, as described above. 2.2.4. Mode of bacteriocins activity Two hundred mL BHI broth was inoculated with 1% (v/v) L. monocytogenes ATCC 7644, L. innocua ATCC 33090 and L. ivanovii subsp. ivanovii ATCC 19119 (respectively) and incubated for 3 h at 37  C. Twenty mL filter-sterilized cell-free supernatant of strains ST209GB, ST278GB, ST315GB and ST711GB (respectively) were added to the culture and OD600 was recorded every hour for next 12 h. Controls represented growth of L. monocytogenes ATCC 7644, L. innocua ATCC 33090 and L. ivanovii subsp. ivanovii ATCC 19119 without addition of cell-free supernatant of strains ST209GB, ST278GB, ST315GB and ST711GB. 2.2.5. Adsorption of bacteriocins to producer cells Adsorption of bacteriocins ST209GB, ST278GB, ST315GB and ST711GB to producer cells was studied according to Yang et al. (1992) and bacteriocin activity was tested as described above. 2.2.6. Screening for presence of bacteriocin genes Total DNA from E. faecium ST209GB, ST278GB, ST315GB and ST711GB was submitted to PCR reactions to detect genes responsible for codification of the following bacteriocins: enterocin A,

enterocin P, enterocin B and enterocin L50B (Table 2). The PCR reaction conditions were previously described (Du Toit et al., 2000; Aymerich et al., 1996; Cintas et al., 1998). The amplified products were separated by electrophoresis on agarose gels in 0.5 TAE buffer. Agarose gels were stained in TAE buffer containing 0.5 mg/ mL ethidium bromide. 2.3. Safety evaluation 2.3.1. Antimicrobial susceptibility Antimicrobial susceptibility test discs (Oxoid, Basingstoke, UK) were employed to assess susceptibility of selected enterococci strains to antimicrobials, classified as inhibitors of cell envelope synthesis (penicillin G, ampicillin and vancomycin), protein synthesis inhibitors (gentamicin, streptomycin, tetracycline, chloramphenicol, and erythromycin), and inhibitors of nucleic acid synthesis (co-trimoxazole, rifampicin and metronidazole). MRS agar plates containing 106e107 CFU/mL of E. faecium ST209GB, ST278GB, ST315GB and ST711GB, respectively, were prepared after cultivation in MRS broth at 37  C for 24 h. The discs impregnated with antimicrobials were applied to the plates, and subsequently incubated at 37  C for 24 h. Inhibition zones around the discs were measured (mm), and the strain were considered resistant to the antimicrobial agent if the inhibition zone was equal or smaller than 19 mm for penicillin G, 14 mm for vancomycin, rifampicin, metronidazole and tetracycline, 13 mm for chloramphenicol, and erythromycin, 12 mm for ampicillin e gentamicin, 11 mm for streptomycin, and 10 mm for co-trimoxazole. The test was performed in triplicates. In addition a MIC (minimum inhibition concentration) was determined by using MICE Test strips (Oxoid, Basingstoke, UK). The antibiotic strips impregnated with gradient of antimicrobials were applied to the MRS agar plates containing 106e107 CFU/mL, and subsequently incubated at 37  C for 24 h. Inhibition zones around the strips were recorded. The test was performed in triplicates. 2.3.2. Characterization of virulence potential E. faecium ST209GB, ST278GB, ST315GB and ST711GB were tested for virulence genes gelE (gelatinase), hyl (hyaluronidase), asa1 (aggregation substance), esp (enterococcal surface protein), cylA (cytolisin), efaA (endocarditis antigen), ace (adhesion of collagen), vanA and vanB (both related to vancomycin resistance), and genes for amino acid decarboxylases: hdc1 and hdc2 (both related to histidine decarboxylase), tdc (tyrosine decarboxylase), and odc (ornithine decarboxylase), using PCR protocols of MartinPlatero et al. (2009), de las Rivas et al. (2005) and Vankerckhoven et al. (2004). Primers are listed in Table 4. The amplified products were separated by electrophoresis on 0.8e2% (w/v) agarose gels in 0.5 TAE buffer. Gels were stained in TAE buffer containing 0.5 mg/ mL ethidium bromide. In addition to genetic screening, physiological tests for gelatinase and DNase production and haemolytic activity have been performed. Gelatinase activity was assessed according to Su et al. (1991). Gelatinase-positive colonies are surrounded by a turbid

Table 2 Positive results (þ) for genes for enterocins A, P, B and L50B, using the respective primers, in the E. faecium ST209GB, ST278GB, ST315GB and ST711GB strains. Bacteriocin genes

E. faecium ST209GB

E. faecium ST278GB

E. faecium ST315GB

E. faecium ST711GB

Primers (50 e 30 )

Reference

Enterocin Enterocin Enterocin Enterocin

þ þ þ 

þ  þ 

þ þ þ 

þ þ  þ

F: GAGATTTATCTCCATAATCT R: GTACCACTCATAGTGGAA F: ATGAGAAAAAAATTATTTAGTTT R: TTAATGTCCCATACCTGCCAAACC F: GAAAATGATCACAGAATGCCTA R: GTTGCATTTAGAGTATACATTTG F: ATGGGAGCAATCGCAAAATTA R: TAGCCATTTTTCAATTTGATC

Aymerich et al., 1996 Gutiérrez et al., 2005 Du Toit et al., 2000 Cintas et al., 1998

A P B L50B

L. Favaro et al. / Food Microbiology 38 (2014) 228e239

231

Table 3 Antibiotic resistance profiles of the bacteriocin-producing E. faecium ST209GB, ST278GB, ST315GB and ST711GB strains. (S) ¼ sensitivity; (R) ¼ resistance; (NS) ¼ not specified by cited documents. E. faecium ST209GB

E. faecium ST278GB

E. faecium ST315GB

2.0 1.0

1.0 1.0

0.06 0.06

0.06 1.0

1.0 8.0 R 2.0 0.06 1.0 1.0 1.0 16.0 4.0 0.5 0.25 R

1.0 R R 4.0 0.06 2.0 2.0 0.5 8.0 4.0 0.5 0.25 R

0.12 16.0 R 8.0 16.0 0.25 16.0 1.0 1.0 2.0 0.25 0.03 1.0

0.5 0.5 1.0 2.0 16.0 2.0 4.0 1.0 4.0 2.0 0.25 0.06 2.0

Antibiotics

MIC breakpoint Enterococcus spp., recommendation of EUCAST (2011) and EFSA (2008) EUCAST

EFSA

MIC (mg/mL)

Amoxicillin Amoxicillin/clavulanic acid Ampicillin Cefotaxime Ceftriaxone Ciprofloxacin Erythromycin Imipenem Levofloxacin Linezolid Meropenem Oxacillin Penicillin Tetracycline Vancomycin

S  4 mg/mL, R  8 mg/mL S  4 mg/mL, R  8 mg/mL

NS NS

S  4 mg/mL, R  8 mg/mL NS NS NS NS S  4 mg/mL, R  8 mg/mL NS NS NS NS NS NS S  4 mg/mL, R > 4 mg/mL

4 mg/mL NS NS NS 4 mg/mL NS NS NS NS NS NS R > 2 mg/mL R > 4 mg/mL

halo after 2 days of incubation at 37  C. DNase activity was tested using the DNase agar medium (Oxoid, Italy). A clear halo around the colonies was indicative of a positive result. Production of hemolysin was determined by streaking the four E. faecium strains ST209GB, ST278GB, ST315GB and ST711GB on sheep blood agar plates (Oxoid, Italy). The presence or absence of clearing zones around the colonies was interpreted as b-hemolysis (positive hemolytic activity) or g-hemolysis (negative hemolytic activity), respectively. When observed, greenish zones around the colonies were interpreted as a-hemolysis and taken as negative for the assessment of hemolytic activity (Barbosa et al., 2010).

E. faecium ST711GB

2.3.3. Hydrophobicity In order to evaluate cell surface hydrophobicity, overnight stationary-phase cultures of E. faecium ST209GB, ST278GB, ST315GB and ST711GB were centrifugated (7000  g for 5 min at 4  C), washed twice with phosphate buffer (50 mM, pH 6.5), and resuspended in the same buffer until A560 values (A0) around 1. Nhexadecane was then added to the cell suspension (1:5) and the mixture was vortexed for 120 s. After a period of 1 h at 37  C, the A560 value (A) of the aqueous layer was measured. Cell surface hydrophobicity was calculated according to the equation: % H ¼ [(A0  A)/A0]  100, where A0 and A are the absorbance values

Table 4 Positive results (þ) for virulence genes, using the respective primers, in the E. faecium ST209GB, ST278GB, ST315GB and ST711GB strains.

Virulence genes gelE hyl asa1 esp cylA efaA ace Antibiotic resistance vanA vanB Biogenic amines hdc1 hdc2 tdc odc

E. faecium ST209GB

E. faecium ST278GB

E. faecium ST315GB

E. faecium ST711GB

Primers (50 e 30 )

Reference

  þ         þ þ

  þ         þ 

        þ   þ þ

        þ   þ þ

F: TATGACAATGCTTTTTGGGAT R: AGATGCACCCGAAATAATATA F: ACAGAAGAGCTGCAGGAAATG R: GACTGACGTCCAAGTTTCCAA F: GCACGCTATTACGAACTATGA R: TAAGAAAGAACATCACCACGA F: AGATTTCATCTTTGATTCTTG R: AATTGATTCTTTAGCATCTGG F: ACTCGGGGATTGATAGGC R: GCTGCTAAAGCTGCGCTT F: GCCAATTGGGACAGACCCTC R: CGCCTTCTGTTCCTTCTTTGGC F: GAATTGAGCAAAAGTTCAATCG R: GTCTGTCTTTTCACTTGTTTC F: TCTGCAATAGAGATAGCCGC R: GGAGTAGCTATCCCAGCATT F: GCTCCGCAGCCTGCATGGACA R: ACGATGCCGCCATCCTCCTGC F: AGATGGTATTGTTTCTTATG R: AGACCATACACCATAACCTT F: AAYTCNTTYGAYTTYGARAARGARG R: ATNGGNGANCCDATCATYTTRTGNCC F: GAYATNATNGGNATNGGNYTNGAYCARG R: CCRTARTCNGGNATAGCRAARTCNGTRTG F: GTNTTYAAYGCNGAYAARCANTAYTTYGT R: ATNGARTTNAGTTCRCAYTTYTCNGG

Vankerckhoven et al., 2004 Vankerckhoven et al., 2004 Vankerckhoven et al., 2004 Vankerckhoven et al., 2004 Vankerckhoven et al., 2004 Martin-Platero et al., 2009 Martin-Platero et al., 2009 Martin-Platero et al., 2009 Martin-Platero et al., 2009 de las Rivas et al., 2005 de las Rivas et al., 2005 de las Rivas et al., 2005 de las Rivas et al., 2005

gelE (gelatinase), hyl (hyaluronidase), asa1 (aggregation substance), esp (enterococcal surface protein), cylA (cytolisin), efaA (endocarditis antigen), ace (adhesion of collagen), vanA and vanB (vancomycin resistance), hdc1 and hdc2 (histidine decarboxylase), tdc (tyrosine decarboxylase), and odc (ornithine decarboxylase).

232

L. Favaro et al. / Food Microbiology 38 (2014) 228e239

before and after extraction with the organic solvent, respectively. The assay was performed in duplicates. 2.4. Beneficial and technological properties 2.4.1. Viability in milk acidified with lactic acid The four E. faecium strains were pre-grown in MRS broth for 16 h at 37  C. One mL of the each cultures were centrifuged (6000  g for 15 min at 4  C) and washed twice with buffered phosphate saline (PBS) solution, pH 7.4. Cells were re-suspended to 10 mL of reconstituted skim milk (Difco, 10%, w/v) and incubated at 37  C. Changes in milk pH were recorded after 6, 24 and 48 h of incubation. Cell suspensions of each E. faecium strain were transferred to skim milk (10%, w/v) previously acidified with lactic acid to pH 4.0 and 5.0. The control was skim milk without addition of lactic acid. Cultures were incubated up to 30 days at 5  C. Strains viability was tested by plating on MRS agar and colony counts on days 0 and 30 were assessed as described by Vinderola et al. (2002). 2.4.2. Lipolytic, proteolytic and b-galactosidase activity Lipolytic activity was tested using Tributyrin agar (Oxoid) as described by Favaro et al. (2013) and LuriaeBertani supplemented with 10 g/L Tween 80 (Barbosa et al., 2010). Proteolytic activity was determined on protein medium with skim milk (Difco), pH 6.5 (Favaro et al., 2013). The b-galactosidase activity was assessed employing sterile filter paper disks impregnated with o-nitrophenyl-b-D-galactopyranose (ONPG Disks, Fluka, Buchs, Switzerland), according to the manufacturer instructions. A colony of each strain, grown on MRS plates at 37  C for 48 h, was picked up and emulsified in a tube containing ONPG disk added with 0.1 mL of sterile saline solution. The tubes were incubated at 37  C, and observed at an interval of one hour, for up to 6 h. The release of a yellow chromogenic compound, o-nitrophenol, indicates a positive colony. 2.4.3. Aggregation E. faecium ST209GB, ST278GB, ST315GB and ST711GB with L. monocytogenes ATCC 7644, L. innocua ATCC 33090 and L. ivanovii subsp. ivanovii ATCC 19119 To evaluate the auto-aggregation, cells of each E. faecium strain, grown in MRS broth for 24 h at 37  C, were centrifuged at (7000  g for 10 min at 20  C), washed, resuspended and diluted in 0.85% sterile saline solution to OD660 ¼ 0.3. One mL of the cell suspension was transferred to a 2 mL sterile plastic cuvette and the OD660 recorded, using a spectrophotometer (Ultraspec 2000, Pharmacia Biotech). To assess the OD60 min, the cultures were centrifuged at 300  g for 2 min at 20  C. Auto-aggregation was determined using the following equation: % Auto-aggregation ¼ [(OD0  OD60 min)/ OD0]  100. OD0 refers to the initial OD and OD60 min refers to the OD determined after 60 min (Todorov and Dicks, 2008). To evaluate the co-aggregation, the four E. faecium strains were grown in 10 mL MRS and L. monocytogenes ATCC 7644, L. innocua ATCC 33090 and L. ivanovii subsp. ivanovii ATCC 19119 in BHI at 37  C. Cells were harvested after 24 h (7000  g for 10 min at 20  C), washed, re-suspended and diluted in 0.85% sterile saline solution to OD660 ¼ 0.3. 500 mL of each suspension were mixed in a 2 mL sterile plastic cuvette and the OD660 recorded. The degree of co-aggregation was determined by OD readings of mixed cultures. Co-aggregation was calculated using the following equation: % Co-aggregation ¼ [(ODtot  ODs)/ ODtot]  100. ODtot refers to the initial OD, taken immediately after the tested strains were mixed and ODS refers to the OD of the supernatant after 60 min (Todorov and Dicks, 2008). Two experiments were conducted in triplicates.

2.4.4. Growth at different pH values and NaCl concentrations E. faecium ST209GB, ST278GB, ST315GB and ST711GB were grown in MRS broth adjusted to pH 2.0, 3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0 and 10.0, respectively, with 1 M NaOH or 1 M lactic acid (Sigma) before autoclaving and re-adjusted after if the pH changed by more than 0.2 units. Tolerance to NaCl was tested by growing the strains in MRS broth with increasing concentrations of sodium chloride (1, 2, 3, 4, 5 and 6%). All tests were conducted in STERELINÔ microtiter plates incubated in TECAN SPECTRAFLUOR (Milan, Italy) equipment. Each well was filled with 180 ml of the MRS medium and inoculated with 20 mL overnight pre-culture (OD600 ¼ 0.02). Optical density readings were recorded every hour for 50 h. The growth experiments were conducted in triplicate. Cultures grown in commercial MRS broth served as control. 2.4.5. Identification of genes encoding map and mub adhesion proteins and EF-Tu elongation factor Primers Mub423F, Mub423R, Map423F, EFTu423F and EFTu423R (Ramiah et al., 2007) were used to amplify mapA, mub and EF-Tu sequences. The amplified product was visualized in a 2% (w/v) agarose gel stained with ethidium bromide (0.5 mg/mL). A band corresponding to the correct size was purified from the gel using the QIAquick PCR purification kit (QIAGEN GmbH). PCR purified products were sequenced via automatic sequencer (ABI Genetic Analyzer 3130XI, Applied Biosystems) using bigdye terminator chemistry (Biosystem, Wanington, England). 3. Results and discussion 3.1. Identification of bacteriocin producing isolates Twelve bacteriocinogenic LAB were isolated from home made goat white brine cheese samples based of their interesting antimicrobial activity against L. monocytogenes Scott A. According to the results of sugar fermentation reactions (API50CHL), the isolates have been classified as Lactococcus lactis (99.8%), however, the results obtained using API20Strep tests indicated that all the strains were 99.9% related to E. faecium species (data not shown). Very frequently identification based only on sugar fermentation profile generated these confusing results. All the isolates were then genetically characterized using 16S rDNA sequencing and genus specific PCR. Amplification of genomic DNA with genus-specific primers produced in all the LAB a 112 bp fragment, which corresponded in size to that of Enterococcus mundtii CRL35 (data not shown) while according to the sequencing of 16S rDNA, all the isolates were identified as E. faecium (99% homology). Random Amplification of Polymorphic DNA (RAPD) PCR, applying primers OPL-02, OPL-04, OPL-14, and OPL-20, revealed that these twelve isolates can be grouped in 4 distinct unique profiles (Fig. 1). The isolates 1 (ST209GB), 2 (ST278GB), 5 (ST315GB) and 6 (ST711GB), indicated by arrows in Fig. 1, were selected as representative of the four different RAPD profiles. 3.2. Characterization of the bacteriocins 3.2.1. Spectrum of antimicrobial activity The four E. faecium strains (ST209GB, ST278GB, ST315GB and ST711GB) were evaluated for their antimicrobial activity by spoton-low method against a panel of test organisms (Table 1) and were able to inhibit the growth of several strains belonging to Enterococcus spp., Listeria spp. and Lactobacillus paracasei. However, none of the other bacteria included in the panel test was affected (Table 1). This narrow-spectrum of bacteriocin activity revealed to be unique for E. faecium. In fact, most of the bacteriocins described for E. faecium were found to be active against a much broader range

L. Favaro et al. / Food Microbiology 38 (2014) 228e239

233

Fig. 1. DNA fragments obtained after RAPD-PCR of the genomic DNA of LAB isolated from white brine cheese (lines from 1 to 12) with Primers OPL 02, OPL 04, OPL 14 and OPL 20. Line M: 1 kb molecular weight marker (Fermentas). Isolates 1 (ST209GB), 2 (ST278GB), 5 (ST315GB) and 6 (ST711GB), indicated by arrows, represent isolates from all 4 profiles and were selected for future studies.

of microbial genera and species (De Vuyst and Vandamme, 1994; Javed et al., 2011; Schirru et al., 2012; Todorov et al., 2012). However, it is important to underline that the very strong activity against L. monocytogenes and Enterococcus spp. exhibited by the four E. faecium strains could have significant application in the biopreservation of fermented food products. Nevertheless, high activity of the bacteriocins produced from E. faecium ST209GB, ST278GB, ST315GB and ST711GB against other Enterococcus spp. should not considered surprising, since according to the definition, bacteriocins are active against closely related species. 3.2.2. Effect of enzymes, pH, detergents and temperature on stability of bacteriocins When exposed to the tested pH and temperature values, enzymes and detergents, the four bacteriocins ST209GB, ST278GB, ST315GB and ST711GB exhibited the same behaviour (data not shown) and were completely affected after the treatment with proteinase K, pronase, trypsin, pepsin and papain, but not once treated with a-amylase or catalase. This suggested that their activity is not dependent on glycosylation and not related to the effect of H2O2. Analogous results have been described for other bacteriocins produced by Enterococcus spp. (Todorov and Dicks, 2005; Todorov et al., 2005, 2010; Schirru et al., 2012; Todorov et al., 2012). All the studied bacteriocins remained stable after incubation (37  C) at pH 2.0, 4.0, 6.0, 8.0, 10.0 and 12.0. Additionally, treatment with Triton X-110, Triton X-114, Tween 20, Tween 80, SDS, NaCl, urea and EDTA had also no effect on the tested bacteriocins. Similar behaviours were reported for the enterocin EJ97 produced by E. faecalis EJ97 (Gálvez et al., 1998) and bozacin B14 from L. lactis subsp. lactis B14 (Ivanova et al., 2000). The bacteriocins ST209GB, ST278GB, ST315GB and ST711GB (pH 6.0) revealed to be heat tolerant and remained stable after 2 h at 100  C. However, slight decrease in activity was observed upon heat treatment at 121  C for 20 min (data not shown). This finding was consistent with a number of bacteriocins produced by Enterococcus spp. (Yamamoto et al., 2003; El-Ghaish et al., 2011; Javed et al., 2011; Schirru et al., 2012; Todorov et al., 2012).

3.2.3. Production of bacteriocins The cell density of E. faecium ST209GB increased from 0.05 to 2.68 (OD600) during 24 h of growth at 37  C (Fig. 2A). Production of bacteriocin ST209GB, assessed against L. ivanovii subsp. ivanovii ATCC 19119, achieved 12800 AU/mL after 24 h. Once L. innocua ATCC 33090 or L. monocytogenes ATCC 7644 were used as test cultures, bacteriocin production (200 AU/mL) was recorded at 6 h and reached 3200 AU/mL at 18 h remaining than stable during the following 6 h (Fig. 2A). Similar profile on growth and bacteriocin production was observed for E. faecium ST278GB, ST315GB and ST711GB (Fig. 2BeD). As reported in Fig. 2B, cell density of E. faecium ST278GB reached 2.48 (OD600) after 24 h while, during the studied incubation period, the production of bacteriocin moved from 200 AU/mL to 6400 AU/mL, 3200 AU/mL and 3200 AU/mL (respectively against L. ivanovii subsp. ivanovii ATCC 19119, L. innocua ATCC 33090 and L. monocytogenes ATCC 7644). Similar growth have been recorded for E. faecium ST315GB (Fig. 2C) and E. faecium ST711GB (Fig. 2D). However, optimal bacteriocin ST315GB production was determined as 25,600 AU/mL, 12,800 AU/ mL and 12,800 AU/mL and bacteriocin ST711GB as 12,800 AU/mL, 6400 AU/mL and 6400 AU/mL against L. ivanovii subsp. ivanovii ATCC 19119, L. innocua ATCC 33090 and L. monocytogenes ATCC 7644, respectively. At the end of the incubation, bacteriocin activity of E. faecium ST711GB slightly decreased against L. monocytogenes ATCC 7644 (Fig. 2D). Considering that the bactericin ST711GB was described to be active after exposed at pH 4.0, this reduction of antimicrobial activity detected once the pH of the MRS medium was about 4.1 (Fig. 2D) cannot be ascribed to the change in culture pH. Indeed, it is unlikely that such a small modification in pH could have caused a sudden interaction of bacteriocin ST711GB from the surface of the producer cell. On the contrary, the decrease in activity may be due to the metabolism of remaining nutrients or medium component(s) not required for cell growth. Overall, the highest production of the bacteriocins ST209GB, ST278GB, ST315GB and ST711GB was recorded during stationary growth, which may suggest that the peptides are secondary metabolites. This result is in accordance with other reports on

234 L. Favaro et al. / Food Microbiology 38 (2014) 228e239 Fig. 2. Production of bacteriocin ST209GB (A), ST278GB (B), ST315GB (C) and ST711GB (D) in MRS broth at 37  C. Antimicrobial activity against L. innocua ATCC 33090, L. ivanovii subsp. ivanovii ATCC 19119 and L. monocytogenes ATCC 7644 are presented as AU/ml (bars). Changes of OD (:) and pH (A) are indicated.

bacteriocins produced by E. faecium and E. mundtii (Todorov and Dicks, 2005; Tomé et al., 2009; Todorov et al., 2012; Schirru et al., 2013). 3.2.4. Mode of activity According to the results reported in Fig. 3, all the four bacteriocins seem to bactericidal: the three test microrganisms (L. monocytogenes ATCC 7644, L. innocua ATCC 33090 and L. ivanovii subsp. ivanovii ATCC 19119) once treated with bacteriocins ST209GB, ST278GB, ST315GB and ST711GB did not grow over a period of 12 h, meanwhile, in the absence of the bacteriocins, they reached stationary growth phase (Fig. 3). Moreover, cell count of L. monocytogenes ATCC 7644, L. innocua ATCC 33090 and L. ivanovii subsp. ivanovii ATCC 19119 on BHI supplemented with 2% agar plates in bacteriocin treated samples showed less than 100 CFU/mL. Similar findings were previously reported for other bacteriocins produced by E. faecium strains (Javed et al., 2011; Todorov and Dicks, 2005; Schirru et al., 2012; Todorov et al., 2012). 3.2.5. Adsorption of bacteriocins to producer cells After treatment of 18 h-old cells of E. faecium ST209GB, ST278GB, ST315GB and ST711GB with 100 mM NaCl, low bacteriocin activity was detected (data not shown). However, the antimicrobial activity was lower than that recorded in the cellfree supernatant, suggesting that bacteriocins adsorb to the surface of the producer cells in very low concentrations. This is in accordance with previously reported work on other bacteriocins secreted by E. faecium strains (Schirru et al., 2012; Todorov et al., 2012). 3.2.6. Screening for presence of bacteriocin genes On the basis of the PCR reactions performed targeting enterocin A, enterocin B, enterocin P and enterocin L50B, E. faecium ST209GB, ST278GB, ST315GB and ST711GB generated positive results (Table 2). The sequence of the generated amplicons was 100% identical to the targeted bacteriocin genes. All the strains produced positive results for enterocin A. E. faecium ST209GB and ST315GB gave a single clear band also for enterocin P and B, while only the strain ST711GB generate positive results for the enterocin L50B. It has been previously reported that one LAB strain can carry more than one bacteriocin gene (Poeta et al., 2007). However, additional experiments on bacteriocin purification, and amino-acid sequence of the expressed bacteriocin/s is required in order to confirm the expression of the detected enterocin gene(s). In this perspective, it seems important to point out that the application of different approaches for the characterization of a bacteriocin is crucial. Very frequently authors report on new bacteriocin identification merely based on the determination of the presence of gene(s) for bacteriocin(s) production (De Kwaadsteniet et al., 2006). However, the evidences for the expression of these bacteriocins were not reported (De Kwaadsteniet et al., 2006; Albano et al., 2007) and the studied bacteriocins have been only presumed to be expressed.

3.3. Safety evaluation Enterococci could be relevant as starter cultures in several artisanal foods, being responsible for the production of peculiar typical characteristics. However, the virulence potential of enterococci needs a proper characterization of wild strains, to verify their adequacy to be used as biopreservatives (Moraes et al., 2012). Therefore, it seemed needful to test the four E. faecium strains for their antibiotic resistance and virulence factors profile.

235 Fig. 3. Effect of bacteriocins ST209GB, ST278GB, ST315GB and ST711GB on (A) L. monocytogenes ATCC 7644, (B) L. innocua ATCC 33090 and (C) L. ivanovii subsp. ivanovii ATCC 19119. Arrows indicates the point at which the bacteriocins were added.

L. Favaro et al. / Food Microbiology 38 (2014) 228e239

236

L. Favaro et al. / Food Microbiology 38 (2014) 228e239

3.3.1. Effect of antibiotics on growth of E. faecium ST209GB, ST278GB, ST315GB and ST711GB According to the results of the disc diffusion method (data not shown), all the E. faecium strains demonstrated susceptibility to the majority of the tested antibiotics: amoxicillin, clavulanic acid, ampicillin, imipenem, linezolid, penicillin and tetracycline. On the other hand, the E. faecium ST209GB, ST278GB, ST315GB were found to be ceftriaxone-resistant and the strain ST278GB showed highlevel resistance to cefotaxime, too. E. faecium ST209GB and ST278GB, resistant to vancomycin, had low erythromycin MIC values if compared to those assessed for the other two strains (Table 3). The acknowledged role of enterococci as cause of life threatening infections in humans is due to the increase of resistance to multiple antibiotics, acting as reservoirs that spread antibiotic resistance genes to virulent enterococci and to other pathogenic or opportunistic bacteria (Giraffa, 2002). Table 3 shows that, with the exception of E. faecium ST209GB and ST278GB against vancomycin, all the bacteriocin-producing enterococci strains were susceptible to ampicillin, penicillin and vancomycin which are the most clinically relevant antibiotics to cure infections with multiple antibiotic-resistant enterococci strains. Similar results have been previously reported for other E. faecium strains (Ben Belgacem et al., 2010; Barbosa et al., 2010). 3.3.2. Screening for physiological and genetic trait related to virulence factor, biogenic amines and antibiotic resistance Despite being less relevant in food isolates, the verification of virulence factors in Enterococcus spp. by molecular and phenotypic procedures is needful due to the risk of genetic transfer since these genes are usually located in conjugative plasmids (Lelieveld et al., 1995). Interestingly, from all the screened genetic sequences related to several virulence factors, biogenic amines and antibiotic resistance (Table 4), only PCR targeting asa1 (aggregation substance), tdc (tyrosine decarboxylase), odc (ornithine decarboxylase) and vanB (vancomycin B) genes generated positive results. However, according to the physiological assays conducted in this study, the four E. faecium strains do not produce gelatinase, DNase and hemolytic activity (data not shown). Although the E. faecium ST315GB and ST711GB resulted to be susceptible to vancomycin (Table 3), they showed positive results for the vanB gene. Such finding should be not considered as controversial since it is known that vanA genes, confering high-level resistance to vancomycin and teicoplanin, have been described in several enterococcal species. On the other hand, vanB genes confer resistance only to various concentrations of vancomycin and have been described in E. faecalis and E. faecium (Kilic et al., 2004). Furthermore, six vancomycin resistance types have been phenotypically and genotypically identified in enterococci and two of them, vanA and vanB, may be located in transferable plasmids (Courvalin, 2006). Taking in consideration possible scenario for a horizontal gene transfer of these plasmids (possibly harbouring vanB gene), presence of such plasmids for E. faecium ST315GB and E. faecium ST711GB merit future research. In general, the here observed frequency of positive results for the studied virulence factors was lower than that reported for other Enterococcus spp. isolates (Barbosa et al., 2010; Gomes et al., 2008), as well as when compared to studies with clinical strains (Franz et al., 2001). 3.3.3. Hydrophobicity All the strains presented low levels of hydrophobicity, determined as adhesion to N-hexadecane: 9.16% for E. faecium ST209GB, 9.85% for E. faecium ST278GB, 7.92% for E. faecium ST315GB and 10.23% for E. faecium ST711GB. Cell surface hydrophobicity is a nonspecific interaction between microbial cells and host. The initial

interaction may be weak, often reversible and precedes subsequent adhesion processes mediated by more specific mechanisms involving cell-surface proteins and lipoteichoic acids (Rojas et al., 2002). Bacterial cells with a high hydrophobicity usually present strong interactions with mucosal cells. Hydrophobicity may assist in adhesion, but is not a prerequisite for strong adherence. Hydrophobicity varies among genetically closely related species and even among strains of the same species (Schar-Zammaretti and Ubbink, 2003). Todorov et al. (2011) reported hydrophobicity values for E. faecium strains similar to those detected in this work, while few Lactobacillus rhamnosus and Lactobacillus plantarum strains have been described by Todorov et al. (2008) for much higher values (75e80%). 3.4. Beneficial and technological properties 3.4.1. Growth in milk and viability in milk acidified with lactic acid The four E. faecium strains grew in milk and were able to change milk’s pH after the 6 and 24 h of incubation. No decrease in cells counts were observed when each E. faecium was maintained in milk acidified to pH 4.0 and 5.0 at 5  C for 30 days (data not shown). A good acid-producing starter culture will reduce the pH of milk from its normal value of about 6.6e5.3 in 6 h using an inoculum of 10% and in general, enterococci exhibit low milk acidifying ability. Investigations on enterococci of dairy origin confirmed the poor acidifying capacity of these microbes in milk with only a small percentage of the strains showing a pH below 5.0e5.2 after 16e 24 h of incubation at 37  C (Cogan et al., 1997). The acidifying activity of the tested enterococcal strains was low: 5.30  0.11 for ST209GB, 5.25  0.13 for ST278GB, 5.22  0.09 for ST315GB and 5.01  0.08 for ST711GB after 24 h incubation in milk with initial pH of 6.5; 4.55  0.07 for ST209GB, 4.60  0.11 for ST278GB, 4.56  0.09 for ST315GB and 4.42  0.06 for ST711GB after 24 h incubation in MRS broth with initial pH of 6.42, suggesting their possible role as adjunct cultures for cheese production, rather than as starter micro-organisms. Enterococci occur as non-starter LAB in many, especially artisanal, cheeses produced from goat, ewe, water-buffalo or bovine milk. Since enterococci may dominate the non-starter LAB of many cheeses, it is supposed that they can positively contribute to the flavour development during cheese ripening. As a consequence, enterococci may improve the sensory characteristics of the final product (Schirru et al., 2012). Lipolysis is also important in cheese ripening as it plays a role in the development of flavour and texture of the final product. Very few reports, on the lipolytic activity of enterococci have been published, with E. faecalis being the most lipolytic species, followed by E. faecium and E. durans (Giraffa, 2002). Results obtained in this study strengthened the view that the species E. faecium generally has low lipolytic activity. Indeed, no strain gave positive results on trybutirin agar medium (data not shown). Protease activity is necessary for good growth of LAB in milk and for casein hydrolysis during cheese ripening. Unfortunately, among the four E. faecium strains, no protease activity was detected. However, conflicting literature data concerning casein proteolysis in enterococci indicate a marked strain-to-strain variation of this phenotypic trait (Giraffa, 2002). 3.4.2. Production b-galactosidase The ability of microorganisms to ferment lactose of milk is an important technological property for LAB with potential application in dairy industry. Hydrolysis of the sugar that confers taste, texture and nutritional value to milk and derivatives is carried out by the enzymes b-D-galactosidase (EC 3.2.1.23) and/or phospho-bD-galactosidase (EC 3.2.1.85) and has been described in different

L. Favaro et al. / Food Microbiology 38 (2014) 228e239

organisms such as bacteria, yeasts and moulds (Zárate and Chaia, 2012). Besides their technological relevance, the pure enzymes or the viable microorganisms that contain them have been used to alleviate intestinal disorders such as lactose intolerance. This phenomenon is spread worldwide among adult population and has been treated successfully by the incorporation of microorganisms, mainly lactobacilli or bifidobacteria, in dairy products as a source of b-galactosidase for the intraintestinal hydrolysis of lactose or the modulation of colonic microbiota (Zárate and Chaia, 2012). In this sense, b-galactosidase activity is a beneficial characteristic for potential probiotics or LAB with application in dairy industry. Interestingly, E. faecium ST209GB, ST278GB, ST315GB and ST711GB produced b-galactosidase activity and such a trait could be very interesting for their potential use in the cheese making industry. 3.4.3. Aggregation Auto-aggregation was found to be strain-specific with values of 12.12  1.1% for E. faecium ST209GB, 8.61  0.1% for E. faecium ST278GB, 10.11  1.7% for E. faecium ST315GB and 10.46  0.1% for E. faecium ST711GB (Fig. 4). In another study conducted by Todorov et al. (2008), strain-specificity in auto-aggregation was also observed for Lactobacillus pentosus ST712BZ and L. paracasei ST284BZ. Various degrees of co-aggregation were measured with L. ivanovii subsp. ivanovii ATCC 19119, L. innocua ATCC 33090 and Listeria monocytogenes ATCC 7644 (Fig. 4). High levels of coaggregation with L. ivanovii subsp. ivanovii ATCC 19119, L. innocua ATCC 33090 and L. monocytogenes ATCC 7644 would facilitate the exclusion of these pathogens from the gastrointestinal tract. In addition, higher co-aggregation levels with different bacteria will facilitate antibacterial action between bacteriocinogenic E. faecium ST209GB, E. faecium ST278GB, E. faecium ST315GB and E. faecium ST711GB and pathogens and may facilitate the exclusion of them from the human gastrointestinal tract (GIT).

237

3.4.4. Identification of genes encoding map and mub adhesion proteins and EF-Tu elongation factor All the E. faecium strains tested in this study did not generate positive PCR results for mub and mapA genes. However, the strains were positive for the presence of EF-Tu (data not shown). The expression of mucus adhesion proteins, such as those encoded by the mub and mapA genes, and of GTP-binding EF-Tu protein has shown to be critical in the adhesion of probiotic strains to human intestine cells (Ramiah et al., 2007). In a previous study (Todorov and Dicks, 2008), these adhesion genes also appear to be present in E. faecium ST311LD and Leuconostoc mesenteroides subsp. mesenteroides ST33LD. The presence of these genes in LAB is may be essential, particularly for probiotic applications. 3.4.5. Growth at different pH values and NaCl concentrations Once grown in MRS with pH adjusted between 2.0 and 10.0, all test strains exhibited growth curves as expected by Enterococcus sp. and, more widely, from LAB (data not shown). At pH below 5.0, the four E. faecium were strongly inhibited and at pH 10.0 their growth was much slower than that showed in the control MRS medium. At pH values higher than that of the control broth (pH 7.0e9.0), their growth was more rapid. Increasing amounts of sodium chloride influenced microbial growth. E. faecium ST209GB grew well up to 5% NaCl and E. faecium ST278GB showed similar ability to grow in the presence of NaCl with the exception that some adaptation to 6% NaCl occurred after prolonged incubation. E. faecium ST315GB and ST711GB were able to grow in MRS containing up to 6% sodium chloride (data not shown). Overall, their strong tolerance to NaCl should not considered surprising since the strains have been isolated from brine type cheeses. The physiological traits exhibited by the tested strains seem to be suitable for the production of several artisanal and traditional

Fig. 4. Auto-aggregation and co-aggregation detected for: E. faecium ST209GB, ST278GB, ST315GB, ST711GB; L. monocytogenes ATCC 7644 (ATCC 7644), L. innocua ATCC 33090 (ATCC 33090) and L. ivanovii subsp. ivanovii ATCC 19119 (ATCC 19119).

238

L. Favaro et al. / Food Microbiology 38 (2014) 228e239

cheeses. In particular, these newly isolated E. faecium could be efficiently utilized in white brine cheeses and in Pecorino-like cheeses processing where sodium chloride content is higher than 3e4% (Foulquié-Moreno et al., 2006; Schirru et al., 2012). 4. Conclusions To the knowledge of the Authors, this is the first study describing bacteriocinogenic E. faecium strains isolated from Bulgarian home made white brine cheese. Considering the narrow spectrum of antimicrobial activity exhibited by the bacteriocins ST209GB, ST278GB, ST315GB and ST711GB and the results regarding safety, technological and beneficial properties of E. faecium ST209GB, ST278GB, ST315GB and ST711GB, these selected strains may have an application as bio-preservatives for the fermented milk products. However, further studies about their potential tyramin production capacity, together with the optimization of their bacteriocins production, will be needful to establish their actual feasibility to be used as bacteriocinogenic strains in the fermentation of dairy commodities. Acknowledgements Dr. Lorenzo Favaro was recipient of “Assegno di ricerca Senior” grant from University of Padova (PD, Italy). Dr. Svetoslav Todorov received grants from CNPq (310203/2010-4) and FAPESP (2012/ 11571-6). This project was partially financed by Progetto di Ateneo 2010 - prot. CPDA102570 (University of Padova, Italy). References Albano, H., Todorov, S.D., van Reenen, C.A., Hogg, T., Dicks, L.M., Teixeira, P., 2007. Characterization of two bacteriocins produced by Pediococcus acidilactici isolated from “Alheira”, a fermented sausage traditionally produced in Portugal. Int. J. Food Microbiol. 116, 239e247. Aymerich, T., Holo, H., Havarstein, L.S., Hugas, M., Garriga, M., Nes, I.F., 1996. Biochemical and genetic characterization of enterocin A from Enterococcus faecium, a new antilisterial bacteriocin in the pediocin family of bacteriocins. Appl. Environ. Microbiol. 62, 1676e1682. Balciunas, E.M., Martinez, F.A.C., Todorov, S.D., Berna Franco, B.D.G.M., Converti, A., Oliveira, R.P.S., 2013. Novel biotechnological applications of bacteriocins: a review. Food Control 32, 134e142. Barbosa, J., Gibbs, P.A., Teixeira, P., 2010. Virulence factors among enterococci isolated from traditional fermented meat products produced in the North of Portugal. Food Control 21, 651e656. Ben Belgacem, Z., Abriouel, H., Ben Omar, N., Lucas, R., Martínez-Canamero, M., Gálvez, A., Manai, M., 2010. Antimicrobial activity, safety aspects, and some technological properties of bacteriocinogenic Enterococcus faecium from artisanal Tunisian fermented meat. Food Control 21, 462e470. Cintas, L.M., Casaus, P., Fernandez, M.F., Hernandez, P.E., 1998. Comparative antimicrobial activity of enterocin L50, pediocin PA-1, nisin A and lactocin S against spoilage and foodborne pathogenic bacteria. Food Microbiol. 15, 289e298. Cogan, T.M., Barbosa, M., Beuvier, E., Bianchi-Salvadori, M.B., Cocconcelli, P.S., Fernandes, I., Gomez, J., Gomez, R., Kalantzopoulos, G., Ledda, A., Medina, M., Rea, M.C., Rodriguez, E., 1997. Characterization of the lactic acid bacteria in artisanal dairy products. J. Dairy Res. 64, 409e421. Cotter, P.D., Hill, C., Ross, P., 2005. Bacteriocins: developing innate immunity for food. Nat. Rev. Microbiol. 3, 777e788. Courvalin, P., 2006. Vancomycin resistance in gram-positive cocci. Clin. Infect. Dis. 42 (Suppl. 1), S25eS34. De Vuyst, L., Vandamme, E.J., 1994. Bacteriocins of Lactic Acid Bacteria: Microbiology, Genetics and Applications. Blackie Academic and Professional, London. De Kwaadsteniet, M., Fraser, T., Van Reenen, C.A., Dicks, L.M.T., 2006. Bacteriocin T8, a novel class IIa sec-dependent bacteriocin produced by Enterococcus faecium T8, isolated from vaginal secretions of children infected with human immunodeficiency virus. Appl. Environ. Microbiol. 72, 4761e4766. de las Rivas, B., Marcobal, A., Munoz, R., 2005. Improved multiplex-PCR method for the simultaneous detection of food bacteria producing biogenic amines. FEMS Microbiol. Lett. 244, 367e372. Dicks, L.M.T., Todorov, S.D., Franco, B.D.G.M., 2011. Current status of antibiotic resistance in lactic acid bacteria. In: Bonilla, A.R., Muniz, K.P. (Eds.), Antibiotic Resistance: Causes and Risk Factors, Mechanisms and Alternatives, Pharmacology e Research, Safety Testing and Regulation. Nova Publisher, New York, USA, pp. 379e425.

Du Toit, M., Franz, C., Dicks, L.M.T., Holzapfel, W.H., 2000. Preliminary characterization of bacteriocins produced by Enterococcus faecium and Enterococcus faecalis isolated from pig faeces. J. Appl. Microbiol. 88, 482e494. El-Ghaish, S., Hadji-Sfaxi, I., Ahmadova, A., Choiset, Y., Rabesona, H., Sitohy, M., Haertlé, T., Chobert, J.-M., 2011. Characterization of two safe Enterococcus strains producing enterocins isolated from Egyptian dairy products. Benef. Microbes 2, 15e27. EFSA, 2008. Update of the criteria used in the assessment of bacterial resistance to antibiotics of human or veterinary importance. Prepared by the panel on additives and products or substances used in animal feed. EFSA J. 732, 1e15. EUCAST, January 5, 2011. European Committee on Antimicrobial Susceptibility Testing Breakpoint Tables for Interpretation of MICs and Zone Diameters. Version 1.3. Favaro, L., Corich, V., Giacomini, A., Basaglia, M., Casella, S., 2013. Grape marcs as unexplored source of new yeasts for future biotechnological applications. World J. Microbiol. Biotechnol. 29, 1551e1562. Felske, A., Rheims, H., Wolterink, A., Stackebrandt, E., Akkermans, A.D.L., 1997. Ribosome analysis reveals prominent activity of an uncultured member of the class Acinetobacteria in grassland soils. Microbiology 143, 2983e2989. Foulquié-Moreno, M.R., Sarantinopoulos, P., Tsakalidou, E., De Vuyst, L., 2006. The role and application of enterococci in food and health. Int. J. Food Microbiol. 106, 1e24. Franz, C.M., Muscholl-Silberhorn, A.B., Yousif, N.M.K., Vancanneyt, M., Swings, J., Holzapfel, W.H., 2001. Incidence of virulence factors and antibiotic resistance among Enterococci isolated from food. Appl. Environ. Microbiol. 67, 4385e 4389. Gálvez, A., Valdivia, E., Abriouel, H., 1998. Isolation and characterisation of enterocin EJ97, a bacteriocin produced by Enterococcus faecalis EJ97. Arch. Microbiol. 171, 59e65. Gillor, O., Etzion, A., Riley, M.A., 2008. The dual role of bacteriocins as anti- and probiotics. Appl. Microbiol. Biotechnol. 81, 591e606. Giraffa, G., 1995. Enterococcal bacteriocins: their potential as anti-Listeria factors in dairy technology. Food Microbiol. 12, 291e299. Giraffa, G., 2002. Enterococci from foods. FEMS Microbiol. Rev. 26, 163e171. Gomes, B.C., Esteves, C.T., Palazzo, I.C.V., Darini, A.L.C., Felis, G.E., Sechi, L.A., Franco, B.D.G.M., De Martinis, E.C.P., 2008. Prevalence and characterization of Enterococcus spp. isolated from Brazilian foods. Food Microbiol. 25, 668e 675. Gutiérrez, J., Criado, R., Citti, R., Martín, M., Herranz, C., Nes, I.F., Cintas, L.M., Hernández, P.E., 2005. Cloning, production and functional expression of enterocin P, a sec-dependent bacteriocin produced by Enterococcus faecium P13, in Escherichia coli. Int. J. Food Microbiol. 103, 239e250. Heu, S., Oh, J., Kang, Y., Ryu, S., Cho, S.K., Cho, Y., Cho, M., 2001. Gly gene cloning and expression and purification of glycinecin A, a bacteriocin produced by Xanthomonas campestris pv. glycines 8ra. Appl. Environ. Microbiol. 67, 4105e4110. Ivanova, I., Kabadjova, P., Pantev, A., Danova, S., Dousset, X., 2000. Detection, purification and partial characterization of a novel bacteriocin substance produced by Lactococcus lactis subsp. lactis B14 isolated from boza-Bulgarian traditional cereal beverage. Biocatalyst 41, 47e53. Javed, A., Masud, T., ul Ain, Q., Imran, M., Maqsood, S., 2011. Enterocins of Enterococcus faecium, emerging natural food preservatives. Ann. Microbiol. 61, 699e 708. Kilic, A., Demiray, T., Saracli, M.A., Bahar, G., Aydogan, H., Baysallar, M., Doganci, L., 2004. Bacteriological characterization of vancomycin-resistant enterococci in a pediatric hospital in Turkey. Ann. Microbiol. 54, 543e551. Lelieveld, H.L.M., Bachmayer, H., Boon, B., Brunius, G., Biirki, K., Chmiel, A., et al., 1995. Safe biotechnology. Part 6. Safety assessment, in respect of human health, of microorganisms used in biotechnology. Appl. Microbiol. Biotechnol. 43, 389e 393. Martin-Platero, A.M., Valdivia, E., Maqueda, M., Martinez-Bueno, M., 2009. Characterization and safety evaluation of enterococci isolated from Spanish goats’ milk cheeses. Int. J. Food Microbiol. 132, 24e32. Montalban-Lopez, M., Sanchez-Hidalgo, M., Valdivia, E., Martinez-Bueno, M., Maqueda, M., 2011. Are bacteriocins underexploited? NOVEL applications for OLD antimicrobials. Curr. Pharmacol. Biotechnol. 12, 1205e1220. Moraes, P.M., Perin, L.M., Todorov, S.D., Silva Jr., A., Franco, B.D., Nero, L.A., 2012. Bacteriocinogenic and virulence potential of Enterococcus isolates obtained from raw milk and cheese. J. Appl. Microbiol. 113, 318e328. Moreno, M.R.F., Callewaert, R., Devreese, B., Van Beeumen, J., De Vuyst, L., 2003. Isolation and biochemical characterisation of enterocins produced by enterococci from different sources. J. Appl. Microbiol. 94, 214e229. Poeta, P., Costa, D., Rojo-Bezares, B., Zarazaga, M., Klibi, N., Rodrigues, J., Torres, C., 2007. Detection of antimicrobial activities and bacteriocin structural genes in faecal enterococci of wild animals. Microbiol. Res. 162, 257e263. Ramiah, K., van Reenen, C.A., Dicks, L.M., 2007. Expression of the mucus adhesion genes Mub and MapA, adhesion-like factor EF-Tu and bacteriocin gene plaA of Lactobacillus plantarum 423, monitored with real-time PCR. Int. J. Food Microbiol. 116, 405e409. Rojas, M., Ascencio, F., Conway, P.L., 2002. Purification and characterization of a surface protein from Lactobacillus fermentum 104R that binds to porcine small intestinal mucus and gastric mucin. Appl. Environ. Microbiol. 68, 2330e2336. Schar-Zammaretti, P., Ubbink, J., 2003. The cell wall of lactic acid bacteria: surface constituents and macromolecular conformations. Biophys. J. 85, 4076e4092. Schirru, S., Todorov, S.D., Favaro, L., Mangia, N.P., Basaglia, M., Casella, S., Comunian, R., Gombossy de Melo Franco, B.D., Deiana, P., 2012. Sardinian goat’s

L. Favaro et al. / Food Microbiology 38 (2014) 228e239 milk as source of bacteriocinogenic potential protective cultures. Food Control 25, 309e320. Schirru, S., Favaro, L., Mangia, N.P., Basaglia, M., Casella, S., Comunian, R., Fancello, F., Gombossy de Melo Franco, B.D., de Souza Oliveira, R.P., Todorov, S.D., 2013. Comparison of bacteriocins production from Enterococcus faecium strains in cheese whey and optimised commercial MRS medium. Ann. Microbiol.. http:// dx.doi.org/10.1007/s13213-013-0667-0. Sparo, M., Nuñez, G.G., Castro, M., Calcagno, M.L., Allende, M.A.G., Ceci, M., Najle, R., Manghi, M., 2008. Characteristics of an environmental strain, Enterococcus faecalis CECT7121, and its effects as additive on craft dry-fermented sausages. Food Microbiol. 25, 607e615. Su, Y.A., Sulavik, M.C., He, P., Makinen, K.K., Makinen, P.L., Fiedler, S., Wirth, R., Clewell, D.B., 1991. Nucleotide sequence of the gelatinase gene (gelE) from Enterococcus faecalis subsp. liquefaciens. Infect. Immun. 59, 415e420. Todorov, S.D., Wachsman, M.B., Knoetze, H., Meincken, M., Dicks, L.M.T., 2005. An antibacterial and antiviral peptide produced by Enterococcus mundtii ST4V isolated from soybeans. I. J. Antimicrob. Agents 25, 508e513. Todorov, S.D., Dicks, L.M.T., 2005. Optimization of bacteriocin ST311LD production by Enterococcus faecium ST311LD, isolated from spoiled black olives. J. Microbiol. 43, 370e374. Todorov, S.D., Dicks, L.M.T., 2008. Evaluation of lactic acid bacteria from kefir, molasses and olive brine as possible probiotics based on physiological properties. Ann. Microbiol. 58, 661e670. Todorov, S.D., Botes, M., Guigas, C., Schillinger, U., Wiid, I., Wachsman, M.B., Holzapfel, W.H., Dicks, L.M.T., 2008. Boza, a natural source of probiotic lactic acid bacteria. J. Appl. Microbiol. 104, 465e477. Todorov, S.D., Wachsman, M., Tomé, E., Dousset, X., Destro, M.T., Dicks, L.M.T., Franco, B.D.G.M., Vaz-Velho, M., Drider, D., 2010. Characterisation of an antiviral

239

pediocin-like bacteriocin produced by Enterococcus faecium. Food Microbiol. 27, 869e879. Todorov, S.D., Furtado, D.N., Saad, S.M.I., Tome, E., Franco, B.D.G.M., 2011. Potential beneficial properties of bacteriocin-producing lactic acid bacteria isolated from smoked salmon. J. Appl. Microbiol. 110, 971e986. Todorov, S.D., Favaro, L., Gibbs, P., Vaz-Velho, M., 2012. Enterococcus faecium isolated from Lombo, Portuguese traditional sausage: characterization of antibacterial compounds and study of the factors affecting bacteriocin production. Benef. Microbes 3, 319e330. Tomé, E., Todorov, S.D., Gibbs, P.A., Teixeira, P.C., 2009. Partial characterization of nine bacteriocins produced by lactic acid bacteria isolated from cold-smoked salmon with activity against Listeria monocytogenes. Food Biotechnol. 23, 50e73. Vankerckhoven, V., Van Autgaerden, T., Vael, C., Lammens, C., Chapelle, S., Rossi, R., Jabes, D., Goossens, H., 2004. Development of a multiplex PCR for the detection of asa1, gelE, cylA, esp, and hyl genes in enterococci and survey for virulence determinants among European hospital isolates of Enterococcus faecium. J. Clin. Microbiol. 42, 4473e4479. Vinderola, G.C., Costa, G.A., Regenhardt, S., Reinheimer, J.A., 2002. Influence of compounds associated with fermented dairy products on the growth of lactic acid starter and probiotic bacteria. Int. Dairy J. 12, 579e589. Yamamoto, Y., Togawa, Y., Shimosaka, M., Okazaki, M., 2003. Purification and characterization of a novel bacteriocin produced by Enterococcus faecalis strain RJ-11. Appl. Environ. Microbiol. 69, 5746e5753. Yang, R., Johnson, M., Ray, B., 1992. Novel method to extract large amounts of bacteriocins from lactic acid bacteria. Appl. Environ. Microbiol. 58, 3355e3359. Zárate, G., Chaia, A.P., 2012. Influence of lactose and lactate on growth and bgalactosidase activity of potential probiotic Propionibacterium acidipropionici. Anaerobe 18, 25e30.