- Email: [email protected]
Genetic diversity of Enterococcus faecium isolated from Bryndza cheese
International Journal of Food Microbiology 116 (2007) 82 – 87 www.elsevier.com/locate/ijfoodmicro
Genetic diversity of Enterococcus faecium isolated from Bryndza cheese D. Jurkovič a,⁎, L. Križková a , M. Sojka a , M. Takáčová a , R. Dušinský a , J. Krajčovič a , P. Vandamme b , M. Vancanneyt c a
Institute of Cell Biology, Faculty of Natural Sciences, Mlynská dolina, 84215 Bratislava, Slovakia Laboratory of Microbiology, Ghent University, K.L. Ledeganckstraat 35, 9000 Ghent, Belgium BCCM/LMG Bacteria Collection, Ghent University, K.L. Ledeganckstraat 35, 9000 Ghent, Belgium b
c
Received 5 July 2006; received in revised form 5 December 2006; accepted 10 December 2006
Abstract One hundred and seventy-six Enterococcus faecium isolates from Slovak dairy product Bryndza were tested for the presence of plasmid DNA. Eighty-two isolates were positive and their plasmid DNA was isolated and digested by EcoRI and HindIII restriction endonucleases. The patterns obtained were compared with those obtained after pulsed-field gel electrophoresis of macrorestriction fragments (PFGE), (GTG)5–PCR and ERIC–PCR. All these molecular approaches were applied for the study of genetic variability and determination of strain relatednesses among plasmid-positive isolates of E. faecium. In general, all methods revealed a considerable genetic diversity of E. faecium isolates. Plasmid profiling and ERIC–PCR have offered a higher resolution than PFGE and (GTG)5–PCR. © 2007 Elsevier B.V. All rights reserved. Keywords: Bryndza cheese; Plasmid DNA; PFGE; Rep-PCR; Enterococcus
1. Introduction Enterococci play a significant role in the environmental and clinical microbiology. Since the recognition of the genus Enterococcus as a separate genus (Schleifer and Kilpper-Bälz, 1984), several new species have been described as a result of improvements in the identification methods. Enterococcus faecium and Enterococcus faecalis, however, remain the most occurring species analyzed in humans and in dairy products. They are commonly found in a variety of cheeses from Mediterranean Europe produced from raw or pasteurized milk of dairy cattle (Cogan et al., 1997) and play a relevant role in the quality of cheese (Kurmann, 1968; Tsakalidou et al., 1993; Centeno et al., 1999; Sarantinopoulous et al., 2002). Previous studies have shown that enterococci are the predominant Grampositive cocci in human stools at 105 to 108 CFU/g of feces (Jett et al., 1994; Kleessen et al., 2000). E. faecalis is the most common Enterococcus species present in human stool, whereas E. faecium predominate in the intestinal tract of dairy cattle ⁎ Corresponding author. Tel.: +421 2 60296654; fax: +421 2 60296280. E-mail address: [email protected] (D. Jurkovič). 0168-1605/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2006.12.025
(Leclerc et al., 1996). On the other hand, enterococci are used as indicators of faecal contamination (Lopez-Diaz et al., 1995) and are also shown to be a cause of human infections, especially in hospital-associated patients. In recent years, the incidence of enterococcal infections has increased due to their resistance to vancomycin and other antibiotics (Morrison et al., 1997; Robredo et al., 2000). The use of molecular typing techniques in the epidemiological examination of enterococci was reviewed by Willey et al. (1994) and genotypic approaches for characterization and identification of enterococci were summarized by Domig et al. (2003). Numerous epidemiological surveys involving strain-level characterization and intraspecies differentiation have been reported. Many of these studies deal with the prevalence of vancomycin-resistant E. faecium in hospitalized patients (Donabedian et al., 1992; Barbier et al., 1996; Dunne and Wang, 1997; Fridkin et al., 1998; Morrison et al., 1999; Vancanneyt et al., 2002) or with the transmission of enterococci from animals to humans (Bates et al., 1993, 1994). To date, only a few studies have been published to reveal the genomic relationships among E. faecium isolates of human, food and animal origin. Willems et al. (2000) and Quednau et al. (1999)
D. Jurkovič et al. / International Journal of Food Microbiology 116 (2007) 82–87
used, for differential purposes, amplified fragment length polymorphism (AFLP) and restriction endonuclease analysis (REA) of total chromosomal DNA. Vancanneyt et al. (2002) characterized E. faecium isolates using random amplified polymorphic DNA (RAPD–PCR), AFLP and pulsed-field gel electrophoresis (PFGE) analysis, which revealed high genetic diversity among enterococcal strains isolated from various sources. PFGE is considered to be superior for interpreting interstrain relationships among enterococci (Descheemaeker et al., 1997). The repetitive element sequence-based PCR (repPCR) was proven to be a useful tool for identification of enterococci on species (Švec et al., 2005) as well as on strain level. Petroziello et al. (1996) used rep-PCR (RW3A) to generate a distinctive DNA fingerprinting pattern of E. faecium and E. faecalis. Lee et al. (1999) typed vancomycin-resistant enterococci using enterobacterial repetitive intergenic consensus sequences–PCR (ERIC–PCR) and Malathum et al. (1998) differentiated E. faecalis strains using rep-PCR (with BOX and REP primers). However, compared with PFGE, the patterns were more difficult to interpret and some products were inconsistently seen. Plasmids can be lost during fermentation and other processes in cheese production, what could be a possible disadvantage in the use of plasmid profile analysis for molecular differentiation of strains. On the other hand, Donabedian et al. (1992) considered the combined use of whole-plasmid analysis, restriction analysis of plasmid DNA and PFGE of chromosomal DNA for the epidemiological typing of E. faecium strains. By combining plasmid profile analysis and PFGE, Mannu et al. (1999) identified closely related strains isolated from Pecorino Sardo cheese. Son et al. (1999) compared 19 E. faecium isolates recovered from tenderloin beef and suggested that plasmid profiling could be used as an adjunct to RAPD for the typing of E. faecium. In our previous study (Jurkovič et al., 2006) we have found E. faecium to be a dominant species in Bryndza cheese in all analyzed samples. In the present study, we have analyzed intraspecies strain relationships of a large set of Bryndza cheese E. faecium isolates to study the potential correlation of the organisms with their geographic origin, the producers and time of sampling. A genetic variability and possible clonal dissemination of enterococcal strains possessing plasmid DNA in various Bryndza distributors by using of molecular approaches depending on their discriminatory power were studied. Restriction endonucleases were used for digestion of plasmid DNA isolated from all plasmid-positive isolates. In the same group of strains, PFGE of genomic macrorestriction fragments, (GTG)5–PCR and ERIC–PCR were applied for evaluation of genetic relatednesses using total genomic DNA. 2. Material and methods 2.1. Bacterial strains One hundred and seventy-six E. faecium isolates identified using phenotypic methods including biochemical sets and species-specific PCR using ddl gene in the previous study
83
(Jurkovič et al., 2006) were taken for further investigation in this study. Samples were obtained from Bryndza cheese from five different commercial distributors (from Liptovský Mikuláš marked as LM, from Ružomberok marked as R, from Červený Kameň marked as CK, from Tisovec marked as T and from Zvolenská Slatina marked as ZS), in January (I), June (II) and September (III) 2002. 2.2. Plasmid profile analysis A total of 176 E. faecium isolates were used for plasmid profile analysis. The strains were grown overnight at 37 °C in 6 ml BHI broth (Merck, Germany). All reagents were obtained from Sigma-Aldrich (Germany) unless otherwise stated. The cells were harvested by centrifugation and pellets were washed in 500 μl of TES buffer (30 mM NaCl, 50 mM Tris–HCl, pH 8.0, 1 mM EDTA). 400 μl of buffer A (50 mM sucrose, 25 mM Tris–HCl (pH 8.0) and 10 mM EDTA) was added to the cells and the total volume was divided in two tubes (2 ml) with 7 mg of lysosyme per tube with following incubation at 37 °C for 30 min. To each tube, 400 μl of buffer B (0.2 M NaOH, 1% SDS) was added and the mixture was incubated at 4 °C for 10 min. After this step, 300 μl of 5 M potassium acetate (pH 4.8) was added, followed by incubation at 4 °C/10 min and centrifugation (10 000×g) for 5 min. The supernatant was subjected to the phenol–chloroform–isoamylalcohol (25:24:1) extraction with volume ratio 1:1. After mixing and centrifugation (10 000×g for 5 min at 4 °C) the supernatant fluid was removed, 1 volume of chloroform–isoamylalcohol (24:1) was added, and the solution was thoroughly mixed. After centrifugation (10 000×g for 5 min at 4 °C) the aqueous fraction was removed. Overnight precipitation with isopropanol produced a DNA pellet acquired by centrifugation (14 000×g for 15 min at 4 °C). The plasmid DNA was resuspended in 30 μl of TE buffer (pH 8.0). The possible presence of pDNA was checked on 1.0% agarose gels at 80 V for 120 min. The isolation of pDNA has been repeated three times and in those strains with present pDNA followed by digestion using EcoRI and HindIII restriction endonucleases (10 U/μl, Bio-Rad). The reaction mixture comprised 5 μl of pDNA, 30 units of restriction enzyme (EcoRI, resp. HindIII), 2 μl of 10× enzyme buffer, 1 μl of RNase (10 mg/ml) and 9 μl of sterile deionized water. Restriction reaction was carried out at 37 °C for 120 min and stopped by incubation at 65 °C for 5 min. 20 μl of mixture were used for gel electrophoresis (at 90 V for 200 min). 2.3. Isolation of total DNA and Rep-PCR Whole-cell DNA was extracted and purified as described by Gevers et al. (2001). (GTG)5–PCRs was performed as described by Versalovic et al. (1994) by using of Red Goldstar DNA Polymerase (Eurogentec, Belgium) with all plasmid-containing strains of E. faecium. The ERIC–PCR reactions were performed in a total volume of 25 μl, using 50 ng of enterococcal DNA, 1 μl of ERIC1 primer (5′–ATGTAAGCTCCTGGGGATTCAC–3′) at
84
D. Jurkovič et al. / International Journal of Food Microbiology 116 (2007) 82–87
Table 1 The total number of E. faecium strains with pDNA expressed as percentage to all E. faecium isolated from particular distributors
analysis with EcoRI and HindIII restriction endonucleases matched to those from PFGE depending on strain identity.
Distributor
Number and percentage representation of isolates with pDNA
3. Results
Total number of E. faecium Total number of E. pDNA+ faecium
%
3.1. Strain collection
17
37
45.9
11
33
33.3
In the present study, we analysed 176 E. faecium isolates from Bryndza cheese which originated from 5 commercial distributors (Jurkovič et al., 2006) for the presence of plasmid
25 13 16
44 26 36
56.8 50.0 44.4
82
176
46.6
Červený Kameň (CK) Liptovský Mikuláš (LM) Ružomberok (R) Tisovec (T) Zvolenská Slatina (ZS) Total
The 82 plasmid-containing strains were deposited as registered LMG strains in the BCCM/LMG Bacteria Collection, Ghent University, Belgium (http://www. belspo.be/bccm/).
10 pmol, 0.5 μl of dNTP's mix at 10 mM, 1.5 μl of 25 mM MgCl2, 2.5 μl of 10× PCR buffer and 2.5 U of Taq DNA polymerase (TaKaRa, Japan). The amplification was accomplished by predenaturation at 94 °C for 5 min, followed by 35 cycles of 1 min at 94 °C, 1 min at 54 °C and 2 min at 72 °C. An extension step of 8 min at 72 °C was included after the final step. 10 μl of PCR products were used for gel electrophoresis (at 80 V for 150 min). Primers were synthesized by Sigma-Genosys (UK). PCRs were performed with a DNA Thermal Cycler (Perkin Elmer 9600). 2.4. Pulsed-field gel electrophoresis (PFGE) of genomic macrorestriction fragments The PFGE was performed as described by Gelsomino et al. (2002) with all plasmid-containing strains of E. faecium. The restriction of DNA was carried out using SmaI restriction endonuclease (MBI Fermentas). The restriction fragments were separated by PFGE in a contour-clamped homogenous electric field MAPPER system (Bio-Rad). PFGE fingerprints were analyzed on 1.1% agarose gels, stained with ethidium bromide solution (1.5 μg ml − 1 ), visualized under UV light and photographed with TCX-20.M equipment (Vilber Lourmat, France). PCR products as well as plasmid profiles were analyzed on 1.5% agarose gels, stained with ethidium bromide solution (1.5 μg ml− 1), visualized under UV light and photographed with TCX-20.M equipment (Vilber Lourmat, France). The resulting fingerprints obtained from all methods used in this study were normalized by the BioNumerics v4.0 software package (Applied Maths, Belgium). Beside of normalization of fingerprints, the same software was used also for comparison and clustering of PFGE profiles. The similarity among digitized PFGE profiles was calculated using Pearson correlation and an average linkage [unweighted pair group method with arithmetic mean (UPGMA)] dendrogram was derived. The fingerprints generated by ERIC–PCR, (GTG)5–PCR and plasmid profile
Fig. 1. PFGE, ERIC–PCR, (GTG)5–PCR, pDNA/EcoRI and pDNA/HindIII fingerprints of 82 Bryndza cheese strains. The dendrogram was constructed using the unweighted pair group method with arithmetic mean (UPGMA) using correlation levels expressed as percentage values of the Pearson correlation coefficient.
D. Jurkovič et al. / International Journal of Food Microbiology 116 (2007) 82–87
DNA. Eighty-two (46.6%) isolates recovered from all Bryndza distributors investigated in this study were proven to possess the plasmid DNA. The relative occurrence of plasmid-containing isolates obtained from particular distributors ranged between 33.3% (from Liptovský Mikuláš) and 56.8% (from Ružomberok) (Table 1). All plasmid-positive strains (82) were subjected to further analysis using pDNA digestion with restriction endonucleases EcoRI and HindIII, PFGE using SmaI, (GTG)5–PCR, and ERIC–PCR. 3.2. Taxonomic resolution of different fingerprint approaches Since PFGE of genomic macrorestriction fragments has gained wide acceptance for establishing of clonal relatedness within many bacterial species including E. faecium and E. faecalis (Murray et al., 1990; Gordillo et al., 1993; Chiew and Hall, 1998; Dicuonzo et al., 2001), the dendrogram in Fig. 1 was constructed using PFGE profiles. We next evaluated the use of (GTG)5–PCR for intraspecies differentiation of E. faecium. As illustrated in Fig. 1, the grouping of (GTG)5–PCR fingerprints was highly similar with those from PFGE and shows that both approaches yield an analogous taxonomic resolution. Higher discriminatory power was revealed by using ERIC– PCR which even allowed the differentiation of the isolates within clusters generated using PFGE, e.g. of isolates from Červený Kameň (sampling in September) or Ružomberok (sampling in January). The ERIC–PCR with only ERIC1 primer was preferred because of low discriminatory power when using both ERIC1 and ERIC2 primers (data not shown). 3.3. Diversity in Bryndza cheese We have proved that the plasmid-containing enterococci are distributed in all studied types of Bryndza. The PFGE of genomic macrorestriction fragments showed a relative high intraspecies genetic diversity among enterococci from Bryndza cheese and most types contain isolates originating from the same producer. On the other hand, some clusters and subclusters comprise the fingerprints originated from various producers and different time of sampling. It means there was probably no strict affiliation between one type of producer – one season of sampling analysed in one cluster group. Other methods used in this study, especially ERIC–PCR and plasmid profile analysis, showed that strain diversity is even higher than that evaluated by PFGE. 4. Discussion Bryndza product qualified as “protected denomination of origin” (PDO) cheese represents a typical homemade type of cheese which has been produced in Slovakia since the 19th century. This soft spreadable dairy product, made from unpasteurized sheep's milk, is produced in a couple of regions in Slovakia. The PFGE has been considered to have a high discriminatory power and comparing with plasmid profile analysis is advantageous, because PFGE fingerprints are stable over time.
85
The PFGE of all plasmid-containing isolates revealed a relative high intraspecies genetic diversity among enterococci from Bryndza cheese. Our results proved that most PFGE clusters contain isolates obtained from the same producer supporting our hypothesis about the unique geographical samples' origin. When monitoring the strain dissemination of E. faecium during all three seasons in one type of Bryndza distributor, it seems that there was probably no strain circulation of E. faecium within one year in Bryndza cheese. Based on our findings, there is not only a considerable genetic variability among E. faecium isolates among various Bryndza distributors, but even at one distributor at different intervals during one year. To our knowledge, there are only few studies on plasmid profiling of enterococci isolated from environmental sources. A few studies are focused on investigation of plasmids in vancomycin-resistant enterococci (Pompei et al., 1991; Clark et al., 1993; Ma et al., 1998; Morrison et al., 1999). Plasmid profile analysis carried out with 82 isolates confirmed the taxonomic value of this method as a supplementary one for typing of enterococci as described by several authors (Donabedian et al., 1992; Mannu et al., 1999; Son et al., 1999). Analogously to the ERIC–PCR, the clustering after digestion of pDNA can serve as a valuable and sensitive tool for further differentiation of E. faecium isolates grouped in particular PFGE clusters, e.g. in case of isolates from Červený Kameň (sampling in September) or Ružomberok (sampling in January) (data not shown). The HindIII restriction endonucleasedigestion appears to have higher discriminatory power than that of EcoRI as more DNA fragments were obtained. Based on these findings, we can conclude that for epidemiological purposes the use of ERIC–PCR with ERIC1 primer in comparison with other methods applied in this study such as PFGE and plasmid profile analysis yields a benefit because of its time- and cost-consuming aspects. In addition, the ERIC–PCR with ERIC1 primer uses the total DNA which guarantees good reproducibility of results contrary to the plasmid profile analysis. When comparing both PFGE and plasmid profile analysis, the plasmid analysis allows differentiation of enterococcal strains grouped within PFGE clusters. Nevertheless, the plasmid profile analysis should only be considered as an additional approach to the PFGE because of possible loss of bacterial plasmids. In summary, out of 176 E. faecium isolates, the plasmid DNA was extracted in 82 (46.6%). PFGE proved to be a valuable tool for differentiation of environmental plasmidcontaining enterococci. The isolates were mainly grouped into clusters according to their geographical origin and time of sampling, but ordering was not unambiguous. Even higher diversity of E. faecium than that generated by PFGE clustering was observed when ERIC–PCR and plasmid profile analysis were used. It seems that both approaches can be fully applied for the study of genetic variability of other bacterial species as well. Acknowledgements This work was supported by the FEMS Research Fellowship Grant 2005-1 and in part by the VEGA grant of the Ministry of
86
D. Jurkovič et al. / International Journal of Food Microbiology 116 (2007) 82–87
Education of the Slovak Republic No. 1/1269/04 and No. VTP/ 178/2000. D. J. thanks the Laboratory of Microbiology Department of Biochemistry, Physiology and Microbiology, Ghent University, Belgium for professional help and support. M. V. acknowledges the Belgian Federal Public Planning Service – Science Policy. References Barbier, N., Saulnier, P., Chachaty, E., Dumontier, S., Andremont, A., 1996. Random amplified polymorphic DNA typing versus pulsed-field gel electrophoresis for epidemiological typing of vancomycin-resistant enterococci. J. Clin. Microbiol. 34, 1096–1099. Bates, J., Jordens, Z., Selkon, J.B., 1993. Evidence for an animal origin of vancomycin-resistant enterococci. Lancet 342, 490–491. Bates, J., Jordens, J.Z., Griffiths, D.T., 1994. Farm animals as a putative reservoir for vancomycin-resistant enterococcal infection in man. J. Antimicrob. Chemother. 34, 507–516. Centeno, J.A., Menendez, S., Hermida, M., Rodriguez-Otero, J.L., 1999. Effect of the addition of Enterococcus faecalis in Cebreiro cheese manufacture. Int. J. Food Microbiol. 48, 97–111. Chiew, Y.F., Hall, L.M., 1998. Comparison of three methods for the molecular typing of Singapore isolates of enterococci with high-level aminoglycoside resistances. J. Hosp. Infect. 38, 223–230. Clark, N.C., Cooksey, R.C., Hill, B.C., Swenson, J.M., Tenover, F., 1993. Characterization of glycopeptide-resistant enterococci from U.S. hospitals. Antimicrob. Agents Chemother. 37, 2311–2317. Cogan, T.M., Barbosa, M., Beuvier, E., Bianchi-Salvadori, B., Cocconcelli, P.S., Fernandes, I., Gomez, J., Gomez, R., Kalantzopoulos, G., Ledda, A., Medina, M., Rea, M.C., Rodriguez, E., 1997. Characterization of the lactic acid bacteria in artisanal dairy products. J. Dairy Res. 64, 409–421. Descheemaeker, P., Lammens, C., Pot, B., Vandamme, P., Goossens, H., 1997. Evaluation of arbitrarily primed PCR analysis and pulsed-field gel electrophoresis of large genomic DNA fragments for identification of enterococci important in human medicine. Int. J. Syst. Bacteriol. 47, 555–561. Dicuonzo, G., Gherardi, G., Lorino, G., Angeletti, S., Battistoni, F., Bertuccini, L., Creti, R., Di Rosa, R., Venditti, M., Baldassarri, L., 2001. Antibiotic resistance and genotypic characterization by PFGE of clinical and environmental isolates of enterococci. FEMS Microbiol. Lett. 201, 205–211. Domig, K.J., Mayer, H.K., Kneifel, W., 2003. Methods used for the isolation, enumeration, characterisation and identification of Enterococcus spp. 2. Pheno- and genotypic criteria. Int. J. Food Microbiol. 88, 165–188. Donabedian, S.M., Chow, J.W., Boyce, J.M., McCabe, R.E., Markowitz, S.M., Coudron, P.E., Kuritza, A., Pierson, C.L., Zervos, M.J., 1992. Molecular typing of ampicillin-resistant, non-β-lactamase-producing Enterococcus faecium isolates from diverse geographic areas. J. Clin. Microbiol. 30, 2757–2761. Dunne, W.M., Wang, W., 1997. Clonal dissemination and colony morphotype variation of vancomycin-resistant Enterococcus faecium isolates in metropolitan Detroit, Michigan. J. Clin. Microbiol. 35, 388–392. Fridkin, S.K., Yokoe, D.S., Whitney, C.G., Onderdonk, A., Hooper, D.C., 1998. Epidemiology of a dominant clonal strain of vancomycin-resistant Enterococcus faecium at separate hospitals in Boston, Massachusetts. J. Clin. Microbiol. 36, 965–970. Gelsomino, R., Vancanneyt, M., Cogan, T.M., Condon, S., Swings, J., 2002. Source of enterococci in a farmhouse raw-milk cheese. Appl. Environ. Microbiol. 68, 3560–3565. Gevers, D., Huys, G., Swings, J., 2001. Applicability of rep-PCR fingerprinting for identification of Lactobacillus species. FEMS Microbiol. Lett. 205, 31–36. Gordillo, M.E., Sigh, K.V., Murray, B.E., 1993. Comparison of ribotyping and pulsed-field gel electrophoresis for subspecies differentiation of strains of Enterococcus faecalis. J. Clin. Microbiol. 31, 1570–1574. Jett, B.D., Huycke, M.M., Gilmore, M.S., 1994. Virulence of enterococci. Clin. Microbiol. Rev. 7, 462–478.
Jurkovič, D., Križková, L., Dušinský, R., Belicová, A., Sojka, M., Krajčovič, J., Ebringer, L., 2006. Identification and characterization of enterococci from Bryndza cheese. Lett. Appl. Microbiol. 42, 553–559. Kleessen, B., Bezirtzoglou, E., Mättö, J., 2000. Culture-based knowledge on biodiversity, development and stability of human gastrointestinal microflora. Microb. Ecol. Health Dis. 2, 53–63. Kurmann, J.A., 1968. Über die Ursachen der qualitätsfördernde Wirkung auf Emmentaler und Greyerzerkäse bei einer Einimpfung von Streptococcus faecalis in keimarmer Rohmilch. Milchwissenschaft 23, 193–198. Leclerc, H., Devriese, L.A., Mossel, D.A.A., 1996. Taxonomical changes in intestinal (faecal) enterococci and streptococci: consequences on their use as indicators of faecal contamination in drinking water. J. Appl. Bacteriol. 81, 459–466. Lee, H.K., Lee, W.G., Cho, S.R., 1999. Clinical and molecular biological analysis of a nosocomial outbreak of vancomycin-resistant enterococci in a neonatal intensive care unit. Acta Paediatr. 88, 651–654. Lopez-Diaz, T.M., Santos, J.A., Gonzales, C.J., Moreno, B., Garcia, M.L., 1995. Bacteriological quality of a traditional Spanish blue cheese. Milchwissenschaft 50, 503–504. Ma, X., Kudo, M., Takahashi, A., Tanimoto, K., Ike, Y., 1998. Evidence of nosocomial infection in Japan caused by high level gentamicin-resistant Enterococcus faecalis and identification of the pheromone-responsive conjugative plasmid enconding gentamicin resistance. J. Clin. Microbiol. 36, 2460–2464. Malathum, K., Singh, K.V., Weinstock, G.M., Murray, B.E., 1998. Repetitive sequence-based PCR versus pulsed-field gel electrophoresis for typing of Enterococcus faecalis at the subspecies level. J. Clin. Microbiol. 36, 211–215. Mannu, L., Paba, A., Pes, M., Floris, R., Scintu, M.F., Morelli, L., 1999. Strain typing among enterococci isolated from home-made Pecorino Sardo cheese. FEMS Microbiol. Lett. 170, 25–30. Morrison, D., Woodford, N., Cookson, B., 1997. Enterococci as emerging pathogens in humans. Soc. Appl. Bacteriol. Symp. Ser. 26, 89S–99S. Morrison, D., Woodford, N., Barrett, S.P., Sisson, P., Cookson, B.D., 1999. DNA banding pattern polymorphism in vancomycin-resistant Enterococcus faecium and criteria for defining strains. J. Clin. Microbiol. 37, 1084–1091. Murray, B.E., Singh, K.V., Heath, J.D., Sharma, B.R., Weinstock, G.M., 1990. Comparison of genomic DNAs of different enterococcal isolates using restriction endonucleases with infrequent recognition sites. J. Clin. Microbiol. 28, 2059–2063. Petroziello, J.M., Gress, M.J., Mc Cleskey, F.K., Namdari, H., Del Vecchio, V.G., 1996. Genetic fingerprinting of clinical strains of Enterococcus faecalis and Enterococcus faecium by Rep-PCR. Infect. Control Hosp. Epidemiol. 17, 46. Pompei, R., Lampis, G., Berlutti, F., Thaller, M.C., 1991. Characterization of yellow-pigmented enterococci from severe human infections. J. Clin. Microbiol. 29, 2884–2886. Quednau, M., Ahrne, S., Molin, G., 1999. Genomic relationships between Enterococcus faecium strains from different sources and with different antibiotic resistance profiles evaluated by restriction endonuclease analysis of total chromosomal DNA using EcoRI and PvuII. Appl. Environ. Microbiol. 65, 1777–1780. Robredo, B., Singh, K.V., Baquero, F., Murray, B.E., Torres, C., 2000. Vancomycin-resistant enterococci isolated from animals and food. Int. J. Food Microbiol. 54, 197–204. Sarantinopoulous, P., Kalantzopoulous, G., Tsakalidou, E., 2002. Effect of Enterococcus faecium on microbiological, physicochemical and sensory characteristics of Greek Feta cheese. Int. J. Food Microbiol. 76, 93–105. Schleifer, K.H., Kilpper-Bälz, R., 1984. Transfer of Streptococcus faecalis and Streptococcus faecium to the genus Enterococcus nom. rev. as Enterococcus faecalis comb. nov. and Enterococcus faecium comb. nov. Int. J. Syst. Bacteriol. 34, 31–34. Son, R., Nimita, F., Rusul, G., Nasreldin, E., Samuel, L., Nishibuchi, M., 1999. Isolation and molecular characterization of vancomycin-resistant Enterococcus faecium in Malaysia. Lett. Appl. Microbiol. 29, 118–122. Švec, P., Vancanneyt, M., Seman, M., Snauwaert, C., Lefebvre, K., Sedláček, I., Swings, J., 2005. Evaluation of (GTG)5–PCR for identification of Enterococcus spp. FEMS Microbiol. Lett. 247, 59–63.
D. Jurkovič et al. / International Journal of Food Microbiology 116 (2007) 82–87 Tsakalidou, E., Manolopoulou, E., Tsilibari, V., Georgalaki, M., Kalantzopoulous, G., 1993. Esterolytic activities of Enterococcus durans and E. faecium strains isolated from Greek cheese. Neth. Milk Dairy J. 47, 145–150. Vancanneyt, M., Lombardi, A., Andrighetto, C., Knijff, E., Torriani, S., Bjorkroth, K.J., Franz, C.M., Foulquie Moreno, M.R., Revets, H., De Vuyst, L., Swings, J., Kersters, K., Dellaglio, F., Holzapfel, W.H., 2002. Intraspecies genomic groups in Enterococcus faecium and their correlation with origin and pathogenicity. Appl. Environ. Microbiol. 68, 1381–1391. Versalovic, J., Schneider, M., De Bruijn, F.J., Lupski, J.R., 1994. Genomic fingerprinting of bacteria using repetitive sequence-based polymerase chain reaction. Methods Mol. Cell. Biol. 5, 25–40.
87
Willems, R.J.L., Top, J., van den Braak, N., van Belkum, A., Endtz, H., Mevius, D., Stobberingh, E., van den Bogaard, A., van Embden, J.D.A., 2000. Host specificity of vancomycin-resistant Enterococcus faecium. J. Infect. Dis. 182, 816–823. Willey, B.M., McGeer, A.J., Ostrowski, M.A., Kreiswirth, B.N., Low, D.E., 1994. The use of molecular typing techniques in the epidemiologic investigation of resistant enterococci. Infect. Control Hosp. Epidemiol. 15, 548–556.
Genetic diversity of Enterococcus faecium isolated from Bryndza cheese D. Jurkovič a,⁎, L. Križková a , M. Sojka a , M. Takáčová a , R. Dušinský a , J. Krajčovič a , P. Vandamme b , M. Vancanneyt c a
Institute of Cell Biology, Faculty of Natural Sciences, Mlynská dolina, 84215 Bratislava, Slovakia Laboratory of Microbiology, Ghent University, K.L. Ledeganckstraat 35, 9000 Ghent, Belgium BCCM/LMG Bacteria Collection, Ghent University, K.L. Ledeganckstraat 35, 9000 Ghent, Belgium b
c
Received 5 July 2006; received in revised form 5 December 2006; accepted 10 December 2006
Abstract One hundred and seventy-six Enterococcus faecium isolates from Slovak dairy product Bryndza were tested for the presence of plasmid DNA. Eighty-two isolates were positive and their plasmid DNA was isolated and digested by EcoRI and HindIII restriction endonucleases. The patterns obtained were compared with those obtained after pulsed-field gel electrophoresis of macrorestriction fragments (PFGE), (GTG)5–PCR and ERIC–PCR. All these molecular approaches were applied for the study of genetic variability and determination of strain relatednesses among plasmid-positive isolates of E. faecium. In general, all methods revealed a considerable genetic diversity of E. faecium isolates. Plasmid profiling and ERIC–PCR have offered a higher resolution than PFGE and (GTG)5–PCR. © 2007 Elsevier B.V. All rights reserved. Keywords: Bryndza cheese; Plasmid DNA; PFGE; Rep-PCR; Enterococcus
1. Introduction Enterococci play a significant role in the environmental and clinical microbiology. Since the recognition of the genus Enterococcus as a separate genus (Schleifer and Kilpper-Bälz, 1984), several new species have been described as a result of improvements in the identification methods. Enterococcus faecium and Enterococcus faecalis, however, remain the most occurring species analyzed in humans and in dairy products. They are commonly found in a variety of cheeses from Mediterranean Europe produced from raw or pasteurized milk of dairy cattle (Cogan et al., 1997) and play a relevant role in the quality of cheese (Kurmann, 1968; Tsakalidou et al., 1993; Centeno et al., 1999; Sarantinopoulous et al., 2002). Previous studies have shown that enterococci are the predominant Grampositive cocci in human stools at 105 to 108 CFU/g of feces (Jett et al., 1994; Kleessen et al., 2000). E. faecalis is the most common Enterococcus species present in human stool, whereas E. faecium predominate in the intestinal tract of dairy cattle ⁎ Corresponding author. Tel.: +421 2 60296654; fax: +421 2 60296280. E-mail address: [email protected] (D. Jurkovič). 0168-1605/$ - see front matter © 2007 Elsevier B.V. All rights reserved. doi:10.1016/j.ijfoodmicro.2006.12.025
(Leclerc et al., 1996). On the other hand, enterococci are used as indicators of faecal contamination (Lopez-Diaz et al., 1995) and are also shown to be a cause of human infections, especially in hospital-associated patients. In recent years, the incidence of enterococcal infections has increased due to their resistance to vancomycin and other antibiotics (Morrison et al., 1997; Robredo et al., 2000). The use of molecular typing techniques in the epidemiological examination of enterococci was reviewed by Willey et al. (1994) and genotypic approaches for characterization and identification of enterococci were summarized by Domig et al. (2003). Numerous epidemiological surveys involving strain-level characterization and intraspecies differentiation have been reported. Many of these studies deal with the prevalence of vancomycin-resistant E. faecium in hospitalized patients (Donabedian et al., 1992; Barbier et al., 1996; Dunne and Wang, 1997; Fridkin et al., 1998; Morrison et al., 1999; Vancanneyt et al., 2002) or with the transmission of enterococci from animals to humans (Bates et al., 1993, 1994). To date, only a few studies have been published to reveal the genomic relationships among E. faecium isolates of human, food and animal origin. Willems et al. (2000) and Quednau et al. (1999)
D. Jurkovič et al. / International Journal of Food Microbiology 116 (2007) 82–87
used, for differential purposes, amplified fragment length polymorphism (AFLP) and restriction endonuclease analysis (REA) of total chromosomal DNA. Vancanneyt et al. (2002) characterized E. faecium isolates using random amplified polymorphic DNA (RAPD–PCR), AFLP and pulsed-field gel electrophoresis (PFGE) analysis, which revealed high genetic diversity among enterococcal strains isolated from various sources. PFGE is considered to be superior for interpreting interstrain relationships among enterococci (Descheemaeker et al., 1997). The repetitive element sequence-based PCR (repPCR) was proven to be a useful tool for identification of enterococci on species (Švec et al., 2005) as well as on strain level. Petroziello et al. (1996) used rep-PCR (RW3A) to generate a distinctive DNA fingerprinting pattern of E. faecium and E. faecalis. Lee et al. (1999) typed vancomycin-resistant enterococci using enterobacterial repetitive intergenic consensus sequences–PCR (ERIC–PCR) and Malathum et al. (1998) differentiated E. faecalis strains using rep-PCR (with BOX and REP primers). However, compared with PFGE, the patterns were more difficult to interpret and some products were inconsistently seen. Plasmids can be lost during fermentation and other processes in cheese production, what could be a possible disadvantage in the use of plasmid profile analysis for molecular differentiation of strains. On the other hand, Donabedian et al. (1992) considered the combined use of whole-plasmid analysis, restriction analysis of plasmid DNA and PFGE of chromosomal DNA for the epidemiological typing of E. faecium strains. By combining plasmid profile analysis and PFGE, Mannu et al. (1999) identified closely related strains isolated from Pecorino Sardo cheese. Son et al. (1999) compared 19 E. faecium isolates recovered from tenderloin beef and suggested that plasmid profiling could be used as an adjunct to RAPD for the typing of E. faecium. In our previous study (Jurkovič et al., 2006) we have found E. faecium to be a dominant species in Bryndza cheese in all analyzed samples. In the present study, we have analyzed intraspecies strain relationships of a large set of Bryndza cheese E. faecium isolates to study the potential correlation of the organisms with their geographic origin, the producers and time of sampling. A genetic variability and possible clonal dissemination of enterococcal strains possessing plasmid DNA in various Bryndza distributors by using of molecular approaches depending on their discriminatory power were studied. Restriction endonucleases were used for digestion of plasmid DNA isolated from all plasmid-positive isolates. In the same group of strains, PFGE of genomic macrorestriction fragments, (GTG)5–PCR and ERIC–PCR were applied for evaluation of genetic relatednesses using total genomic DNA. 2. Material and methods 2.1. Bacterial strains One hundred and seventy-six E. faecium isolates identified using phenotypic methods including biochemical sets and species-specific PCR using ddl gene in the previous study
83
(Jurkovič et al., 2006) were taken for further investigation in this study. Samples were obtained from Bryndza cheese from five different commercial distributors (from Liptovský Mikuláš marked as LM, from Ružomberok marked as R, from Červený Kameň marked as CK, from Tisovec marked as T and from Zvolenská Slatina marked as ZS), in January (I), June (II) and September (III) 2002. 2.2. Plasmid profile analysis A total of 176 E. faecium isolates were used for plasmid profile analysis. The strains were grown overnight at 37 °C in 6 ml BHI broth (Merck, Germany). All reagents were obtained from Sigma-Aldrich (Germany) unless otherwise stated. The cells were harvested by centrifugation and pellets were washed in 500 μl of TES buffer (30 mM NaCl, 50 mM Tris–HCl, pH 8.0, 1 mM EDTA). 400 μl of buffer A (50 mM sucrose, 25 mM Tris–HCl (pH 8.0) and 10 mM EDTA) was added to the cells and the total volume was divided in two tubes (2 ml) with 7 mg of lysosyme per tube with following incubation at 37 °C for 30 min. To each tube, 400 μl of buffer B (0.2 M NaOH, 1% SDS) was added and the mixture was incubated at 4 °C for 10 min. After this step, 300 μl of 5 M potassium acetate (pH 4.8) was added, followed by incubation at 4 °C/10 min and centrifugation (10 000×g) for 5 min. The supernatant was subjected to the phenol–chloroform–isoamylalcohol (25:24:1) extraction with volume ratio 1:1. After mixing and centrifugation (10 000×g for 5 min at 4 °C) the supernatant fluid was removed, 1 volume of chloroform–isoamylalcohol (24:1) was added, and the solution was thoroughly mixed. After centrifugation (10 000×g for 5 min at 4 °C) the aqueous fraction was removed. Overnight precipitation with isopropanol produced a DNA pellet acquired by centrifugation (14 000×g for 15 min at 4 °C). The plasmid DNA was resuspended in 30 μl of TE buffer (pH 8.0). The possible presence of pDNA was checked on 1.0% agarose gels at 80 V for 120 min. The isolation of pDNA has been repeated three times and in those strains with present pDNA followed by digestion using EcoRI and HindIII restriction endonucleases (10 U/μl, Bio-Rad). The reaction mixture comprised 5 μl of pDNA, 30 units of restriction enzyme (EcoRI, resp. HindIII), 2 μl of 10× enzyme buffer, 1 μl of RNase (10 mg/ml) and 9 μl of sterile deionized water. Restriction reaction was carried out at 37 °C for 120 min and stopped by incubation at 65 °C for 5 min. 20 μl of mixture were used for gel electrophoresis (at 90 V for 200 min). 2.3. Isolation of total DNA and Rep-PCR Whole-cell DNA was extracted and purified as described by Gevers et al. (2001). (GTG)5–PCRs was performed as described by Versalovic et al. (1994) by using of Red Goldstar DNA Polymerase (Eurogentec, Belgium) with all plasmid-containing strains of E. faecium. The ERIC–PCR reactions were performed in a total volume of 25 μl, using 50 ng of enterococcal DNA, 1 μl of ERIC1 primer (5′–ATGTAAGCTCCTGGGGATTCAC–3′) at
84
D. Jurkovič et al. / International Journal of Food Microbiology 116 (2007) 82–87
Table 1 The total number of E. faecium strains with pDNA expressed as percentage to all E. faecium isolated from particular distributors
analysis with EcoRI and HindIII restriction endonucleases matched to those from PFGE depending on strain identity.
Distributor
Number and percentage representation of isolates with pDNA
3. Results
Total number of E. faecium Total number of E. pDNA+ faecium
%
3.1. Strain collection
17
37
45.9
11
33
33.3
In the present study, we analysed 176 E. faecium isolates from Bryndza cheese which originated from 5 commercial distributors (Jurkovič et al., 2006) for the presence of plasmid
25 13 16
44 26 36
56.8 50.0 44.4
82
176
46.6
Červený Kameň (CK) Liptovský Mikuláš (LM) Ružomberok (R) Tisovec (T) Zvolenská Slatina (ZS) Total
The 82 plasmid-containing strains were deposited as registered LMG strains in the BCCM/LMG Bacteria Collection, Ghent University, Belgium (http://www. belspo.be/bccm/).
10 pmol, 0.5 μl of dNTP's mix at 10 mM, 1.5 μl of 25 mM MgCl2, 2.5 μl of 10× PCR buffer and 2.5 U of Taq DNA polymerase (TaKaRa, Japan). The amplification was accomplished by predenaturation at 94 °C for 5 min, followed by 35 cycles of 1 min at 94 °C, 1 min at 54 °C and 2 min at 72 °C. An extension step of 8 min at 72 °C was included after the final step. 10 μl of PCR products were used for gel electrophoresis (at 80 V for 150 min). Primers were synthesized by Sigma-Genosys (UK). PCRs were performed with a DNA Thermal Cycler (Perkin Elmer 9600). 2.4. Pulsed-field gel electrophoresis (PFGE) of genomic macrorestriction fragments The PFGE was performed as described by Gelsomino et al. (2002) with all plasmid-containing strains of E. faecium. The restriction of DNA was carried out using SmaI restriction endonuclease (MBI Fermentas). The restriction fragments were separated by PFGE in a contour-clamped homogenous electric field MAPPER system (Bio-Rad). PFGE fingerprints were analyzed on 1.1% agarose gels, stained with ethidium bromide solution (1.5 μg ml − 1 ), visualized under UV light and photographed with TCX-20.M equipment (Vilber Lourmat, France). PCR products as well as plasmid profiles were analyzed on 1.5% agarose gels, stained with ethidium bromide solution (1.5 μg ml− 1), visualized under UV light and photographed with TCX-20.M equipment (Vilber Lourmat, France). The resulting fingerprints obtained from all methods used in this study were normalized by the BioNumerics v4.0 software package (Applied Maths, Belgium). Beside of normalization of fingerprints, the same software was used also for comparison and clustering of PFGE profiles. The similarity among digitized PFGE profiles was calculated using Pearson correlation and an average linkage [unweighted pair group method with arithmetic mean (UPGMA)] dendrogram was derived. The fingerprints generated by ERIC–PCR, (GTG)5–PCR and plasmid profile
Fig. 1. PFGE, ERIC–PCR, (GTG)5–PCR, pDNA/EcoRI and pDNA/HindIII fingerprints of 82 Bryndza cheese strains. The dendrogram was constructed using the unweighted pair group method with arithmetic mean (UPGMA) using correlation levels expressed as percentage values of the Pearson correlation coefficient.
D. Jurkovič et al. / International Journal of Food Microbiology 116 (2007) 82–87
DNA. Eighty-two (46.6%) isolates recovered from all Bryndza distributors investigated in this study were proven to possess the plasmid DNA. The relative occurrence of plasmid-containing isolates obtained from particular distributors ranged between 33.3% (from Liptovský Mikuláš) and 56.8% (from Ružomberok) (Table 1). All plasmid-positive strains (82) were subjected to further analysis using pDNA digestion with restriction endonucleases EcoRI and HindIII, PFGE using SmaI, (GTG)5–PCR, and ERIC–PCR. 3.2. Taxonomic resolution of different fingerprint approaches Since PFGE of genomic macrorestriction fragments has gained wide acceptance for establishing of clonal relatedness within many bacterial species including E. faecium and E. faecalis (Murray et al., 1990; Gordillo et al., 1993; Chiew and Hall, 1998; Dicuonzo et al., 2001), the dendrogram in Fig. 1 was constructed using PFGE profiles. We next evaluated the use of (GTG)5–PCR for intraspecies differentiation of E. faecium. As illustrated in Fig. 1, the grouping of (GTG)5–PCR fingerprints was highly similar with those from PFGE and shows that both approaches yield an analogous taxonomic resolution. Higher discriminatory power was revealed by using ERIC– PCR which even allowed the differentiation of the isolates within clusters generated using PFGE, e.g. of isolates from Červený Kameň (sampling in September) or Ružomberok (sampling in January). The ERIC–PCR with only ERIC1 primer was preferred because of low discriminatory power when using both ERIC1 and ERIC2 primers (data not shown). 3.3. Diversity in Bryndza cheese We have proved that the plasmid-containing enterococci are distributed in all studied types of Bryndza. The PFGE of genomic macrorestriction fragments showed a relative high intraspecies genetic diversity among enterococci from Bryndza cheese and most types contain isolates originating from the same producer. On the other hand, some clusters and subclusters comprise the fingerprints originated from various producers and different time of sampling. It means there was probably no strict affiliation between one type of producer – one season of sampling analysed in one cluster group. Other methods used in this study, especially ERIC–PCR and plasmid profile analysis, showed that strain diversity is even higher than that evaluated by PFGE. 4. Discussion Bryndza product qualified as “protected denomination of origin” (PDO) cheese represents a typical homemade type of cheese which has been produced in Slovakia since the 19th century. This soft spreadable dairy product, made from unpasteurized sheep's milk, is produced in a couple of regions in Slovakia. The PFGE has been considered to have a high discriminatory power and comparing with plasmid profile analysis is advantageous, because PFGE fingerprints are stable over time.
85
The PFGE of all plasmid-containing isolates revealed a relative high intraspecies genetic diversity among enterococci from Bryndza cheese. Our results proved that most PFGE clusters contain isolates obtained from the same producer supporting our hypothesis about the unique geographical samples' origin. When monitoring the strain dissemination of E. faecium during all three seasons in one type of Bryndza distributor, it seems that there was probably no strain circulation of E. faecium within one year in Bryndza cheese. Based on our findings, there is not only a considerable genetic variability among E. faecium isolates among various Bryndza distributors, but even at one distributor at different intervals during one year. To our knowledge, there are only few studies on plasmid profiling of enterococci isolated from environmental sources. A few studies are focused on investigation of plasmids in vancomycin-resistant enterococci (Pompei et al., 1991; Clark et al., 1993; Ma et al., 1998; Morrison et al., 1999). Plasmid profile analysis carried out with 82 isolates confirmed the taxonomic value of this method as a supplementary one for typing of enterococci as described by several authors (Donabedian et al., 1992; Mannu et al., 1999; Son et al., 1999). Analogously to the ERIC–PCR, the clustering after digestion of pDNA can serve as a valuable and sensitive tool for further differentiation of E. faecium isolates grouped in particular PFGE clusters, e.g. in case of isolates from Červený Kameň (sampling in September) or Ružomberok (sampling in January) (data not shown). The HindIII restriction endonucleasedigestion appears to have higher discriminatory power than that of EcoRI as more DNA fragments were obtained. Based on these findings, we can conclude that for epidemiological purposes the use of ERIC–PCR with ERIC1 primer in comparison with other methods applied in this study such as PFGE and plasmid profile analysis yields a benefit because of its time- and cost-consuming aspects. In addition, the ERIC–PCR with ERIC1 primer uses the total DNA which guarantees good reproducibility of results contrary to the plasmid profile analysis. When comparing both PFGE and plasmid profile analysis, the plasmid analysis allows differentiation of enterococcal strains grouped within PFGE clusters. Nevertheless, the plasmid profile analysis should only be considered as an additional approach to the PFGE because of possible loss of bacterial plasmids. In summary, out of 176 E. faecium isolates, the plasmid DNA was extracted in 82 (46.6%). PFGE proved to be a valuable tool for differentiation of environmental plasmidcontaining enterococci. The isolates were mainly grouped into clusters according to their geographical origin and time of sampling, but ordering was not unambiguous. Even higher diversity of E. faecium than that generated by PFGE clustering was observed when ERIC–PCR and plasmid profile analysis were used. It seems that both approaches can be fully applied for the study of genetic variability of other bacterial species as well. Acknowledgements This work was supported by the FEMS Research Fellowship Grant 2005-1 and in part by the VEGA grant of the Ministry of
86
D. Jurkovič et al. / International Journal of Food Microbiology 116 (2007) 82–87
Education of the Slovak Republic No. 1/1269/04 and No. VTP/ 178/2000. D. J. thanks the Laboratory of Microbiology Department of Biochemistry, Physiology and Microbiology, Ghent University, Belgium for professional help and support. M. V. acknowledges the Belgian Federal Public Planning Service – Science Policy. References Barbier, N., Saulnier, P., Chachaty, E., Dumontier, S., Andremont, A., 1996. Random amplified polymorphic DNA typing versus pulsed-field gel electrophoresis for epidemiological typing of vancomycin-resistant enterococci. J. Clin. Microbiol. 34, 1096–1099. Bates, J., Jordens, Z., Selkon, J.B., 1993. Evidence for an animal origin of vancomycin-resistant enterococci. Lancet 342, 490–491. Bates, J., Jordens, J.Z., Griffiths, D.T., 1994. Farm animals as a putative reservoir for vancomycin-resistant enterococcal infection in man. J. Antimicrob. Chemother. 34, 507–516. Centeno, J.A., Menendez, S., Hermida, M., Rodriguez-Otero, J.L., 1999. Effect of the addition of Enterococcus faecalis in Cebreiro cheese manufacture. Int. J. Food Microbiol. 48, 97–111. Chiew, Y.F., Hall, L.M., 1998. Comparison of three methods for the molecular typing of Singapore isolates of enterococci with high-level aminoglycoside resistances. J. Hosp. Infect. 38, 223–230. Clark, N.C., Cooksey, R.C., Hill, B.C., Swenson, J.M., Tenover, F., 1993. Characterization of glycopeptide-resistant enterococci from U.S. hospitals. Antimicrob. Agents Chemother. 37, 2311–2317. Cogan, T.M., Barbosa, M., Beuvier, E., Bianchi-Salvadori, B., Cocconcelli, P.S., Fernandes, I., Gomez, J., Gomez, R., Kalantzopoulos, G., Ledda, A., Medina, M., Rea, M.C., Rodriguez, E., 1997. Characterization of the lactic acid bacteria in artisanal dairy products. J. Dairy Res. 64, 409–421. Descheemaeker, P., Lammens, C., Pot, B., Vandamme, P., Goossens, H., 1997. Evaluation of arbitrarily primed PCR analysis and pulsed-field gel electrophoresis of large genomic DNA fragments for identification of enterococci important in human medicine. Int. J. Syst. Bacteriol. 47, 555–561. Dicuonzo, G., Gherardi, G., Lorino, G., Angeletti, S., Battistoni, F., Bertuccini, L., Creti, R., Di Rosa, R., Venditti, M., Baldassarri, L., 2001. Antibiotic resistance and genotypic characterization by PFGE of clinical and environmental isolates of enterococci. FEMS Microbiol. Lett. 201, 205–211. Domig, K.J., Mayer, H.K., Kneifel, W., 2003. Methods used for the isolation, enumeration, characterisation and identification of Enterococcus spp. 2. Pheno- and genotypic criteria. Int. J. Food Microbiol. 88, 165–188. Donabedian, S.M., Chow, J.W., Boyce, J.M., McCabe, R.E., Markowitz, S.M., Coudron, P.E., Kuritza, A., Pierson, C.L., Zervos, M.J., 1992. Molecular typing of ampicillin-resistant, non-β-lactamase-producing Enterococcus faecium isolates from diverse geographic areas. J. Clin. Microbiol. 30, 2757–2761. Dunne, W.M., Wang, W., 1997. Clonal dissemination and colony morphotype variation of vancomycin-resistant Enterococcus faecium isolates in metropolitan Detroit, Michigan. J. Clin. Microbiol. 35, 388–392. Fridkin, S.K., Yokoe, D.S., Whitney, C.G., Onderdonk, A., Hooper, D.C., 1998. Epidemiology of a dominant clonal strain of vancomycin-resistant Enterococcus faecium at separate hospitals in Boston, Massachusetts. J. Clin. Microbiol. 36, 965–970. Gelsomino, R., Vancanneyt, M., Cogan, T.M., Condon, S., Swings, J., 2002. Source of enterococci in a farmhouse raw-milk cheese. Appl. Environ. Microbiol. 68, 3560–3565. Gevers, D., Huys, G., Swings, J., 2001. Applicability of rep-PCR fingerprinting for identification of Lactobacillus species. FEMS Microbiol. Lett. 205, 31–36. Gordillo, M.E., Sigh, K.V., Murray, B.E., 1993. Comparison of ribotyping and pulsed-field gel electrophoresis for subspecies differentiation of strains of Enterococcus faecalis. J. Clin. Microbiol. 31, 1570–1574. Jett, B.D., Huycke, M.M., Gilmore, M.S., 1994. Virulence of enterococci. Clin. Microbiol. Rev. 7, 462–478.
Jurkovič, D., Križková, L., Dušinský, R., Belicová, A., Sojka, M., Krajčovič, J., Ebringer, L., 2006. Identification and characterization of enterococci from Bryndza cheese. Lett. Appl. Microbiol. 42, 553–559. Kleessen, B., Bezirtzoglou, E., Mättö, J., 2000. Culture-based knowledge on biodiversity, development and stability of human gastrointestinal microflora. Microb. Ecol. Health Dis. 2, 53–63. Kurmann, J.A., 1968. Über die Ursachen der qualitätsfördernde Wirkung auf Emmentaler und Greyerzerkäse bei einer Einimpfung von Streptococcus faecalis in keimarmer Rohmilch. Milchwissenschaft 23, 193–198. Leclerc, H., Devriese, L.A., Mossel, D.A.A., 1996. Taxonomical changes in intestinal (faecal) enterococci and streptococci: consequences on their use as indicators of faecal contamination in drinking water. J. Appl. Bacteriol. 81, 459–466. Lee, H.K., Lee, W.G., Cho, S.R., 1999. Clinical and molecular biological analysis of a nosocomial outbreak of vancomycin-resistant enterococci in a neonatal intensive care unit. Acta Paediatr. 88, 651–654. Lopez-Diaz, T.M., Santos, J.A., Gonzales, C.J., Moreno, B., Garcia, M.L., 1995. Bacteriological quality of a traditional Spanish blue cheese. Milchwissenschaft 50, 503–504. Ma, X., Kudo, M., Takahashi, A., Tanimoto, K., Ike, Y., 1998. Evidence of nosocomial infection in Japan caused by high level gentamicin-resistant Enterococcus faecalis and identification of the pheromone-responsive conjugative plasmid enconding gentamicin resistance. J. Clin. Microbiol. 36, 2460–2464. Malathum, K., Singh, K.V., Weinstock, G.M., Murray, B.E., 1998. Repetitive sequence-based PCR versus pulsed-field gel electrophoresis for typing of Enterococcus faecalis at the subspecies level. J. Clin. Microbiol. 36, 211–215. Mannu, L., Paba, A., Pes, M., Floris, R., Scintu, M.F., Morelli, L., 1999. Strain typing among enterococci isolated from home-made Pecorino Sardo cheese. FEMS Microbiol. Lett. 170, 25–30. Morrison, D., Woodford, N., Cookson, B., 1997. Enterococci as emerging pathogens in humans. Soc. Appl. Bacteriol. Symp. Ser. 26, 89S–99S. Morrison, D., Woodford, N., Barrett, S.P., Sisson, P., Cookson, B.D., 1999. DNA banding pattern polymorphism in vancomycin-resistant Enterococcus faecium and criteria for defining strains. J. Clin. Microbiol. 37, 1084–1091. Murray, B.E., Singh, K.V., Heath, J.D., Sharma, B.R., Weinstock, G.M., 1990. Comparison of genomic DNAs of different enterococcal isolates using restriction endonucleases with infrequent recognition sites. J. Clin. Microbiol. 28, 2059–2063. Petroziello, J.M., Gress, M.J., Mc Cleskey, F.K., Namdari, H., Del Vecchio, V.G., 1996. Genetic fingerprinting of clinical strains of Enterococcus faecalis and Enterococcus faecium by Rep-PCR. Infect. Control Hosp. Epidemiol. 17, 46. Pompei, R., Lampis, G., Berlutti, F., Thaller, M.C., 1991. Characterization of yellow-pigmented enterococci from severe human infections. J. Clin. Microbiol. 29, 2884–2886. Quednau, M., Ahrne, S., Molin, G., 1999. Genomic relationships between Enterococcus faecium strains from different sources and with different antibiotic resistance profiles evaluated by restriction endonuclease analysis of total chromosomal DNA using EcoRI and PvuII. Appl. Environ. Microbiol. 65, 1777–1780. Robredo, B., Singh, K.V., Baquero, F., Murray, B.E., Torres, C., 2000. Vancomycin-resistant enterococci isolated from animals and food. Int. J. Food Microbiol. 54, 197–204. Sarantinopoulous, P., Kalantzopoulous, G., Tsakalidou, E., 2002. Effect of Enterococcus faecium on microbiological, physicochemical and sensory characteristics of Greek Feta cheese. Int. J. Food Microbiol. 76, 93–105. Schleifer, K.H., Kilpper-Bälz, R., 1984. Transfer of Streptococcus faecalis and Streptococcus faecium to the genus Enterococcus nom. rev. as Enterococcus faecalis comb. nov. and Enterococcus faecium comb. nov. Int. J. Syst. Bacteriol. 34, 31–34. Son, R., Nimita, F., Rusul, G., Nasreldin, E., Samuel, L., Nishibuchi, M., 1999. Isolation and molecular characterization of vancomycin-resistant Enterococcus faecium in Malaysia. Lett. Appl. Microbiol. 29, 118–122. Švec, P., Vancanneyt, M., Seman, M., Snauwaert, C., Lefebvre, K., Sedláček, I., Swings, J., 2005. Evaluation of (GTG)5–PCR for identification of Enterococcus spp. FEMS Microbiol. Lett. 247, 59–63.
D. Jurkovič et al. / International Journal of Food Microbiology 116 (2007) 82–87 Tsakalidou, E., Manolopoulou, E., Tsilibari, V., Georgalaki, M., Kalantzopoulous, G., 1993. Esterolytic activities of Enterococcus durans and E. faecium strains isolated from Greek cheese. Neth. Milk Dairy J. 47, 145–150. Vancanneyt, M., Lombardi, A., Andrighetto, C., Knijff, E., Torriani, S., Bjorkroth, K.J., Franz, C.M., Foulquie Moreno, M.R., Revets, H., De Vuyst, L., Swings, J., Kersters, K., Dellaglio, F., Holzapfel, W.H., 2002. Intraspecies genomic groups in Enterococcus faecium and their correlation with origin and pathogenicity. Appl. Environ. Microbiol. 68, 1381–1391. Versalovic, J., Schneider, M., De Bruijn, F.J., Lupski, J.R., 1994. Genomic fingerprinting of bacteria using repetitive sequence-based polymerase chain reaction. Methods Mol. Cell. Biol. 5, 25–40.
87
Willems, R.J.L., Top, J., van den Braak, N., van Belkum, A., Endtz, H., Mevius, D., Stobberingh, E., van den Bogaard, A., van Embden, J.D.A., 2000. Host specificity of vancomycin-resistant Enterococcus faecium. J. Infect. Dis. 182, 816–823. Willey, B.M., McGeer, A.J., Ostrowski, M.A., Kreiswirth, B.N., Low, D.E., 1994. The use of molecular typing techniques in the epidemiologic investigation of resistant enterococci. Infect. Control Hosp. Epidemiol. 15, 548–556.