- Email: [email protected]
Genetic characterization of high-level aminoglycoside-resistant Enterococcus faecalis and Enterococcus faecium isolated from retail chicken meat
Genetic characterization of high-level aminoglycoside-resistant Enterococcus faecalis and Enterococcus faecium isolated from retail chicken meat
∗
College of Veterinary Medicine & Zoonoses Research Institute, Kyungpook National University, Daegu 41566, Republic of Korea; and † Department of Basic Sciences, College of Veterinary Medicine, Mississippi State University, Mississippi State 39762, USA
ABSTRACT Retail chicken meat can play a role in the transfer of drug resistance to humans through the handling or ingestion of improperly cooked meat contaminated with resistant enterococci. In fact, highlevel aminoglycoside-resistance (HLAR) in enterococci identified in human cases. Therefore, the prevalence and genetic characterization of HLAR in enterococci in retail chicken meat were investigated in this study. Of the 345 enterococci strains, 29 (8.7%) showed HLAR. All HLAR in enterococci carried at least 1 of 2 aminoglycoside-modifying enzyme genes, aac(6ʹ)Ieaph(2 )-Ia and ant(6)-Ia. Among the 13 isolates that carried aac(6ʹ)Ie-aph(2 )-Ia, 3 had pattern A, with IS256 at both ends, and the other 10 had pattern D, without IS256 at both ends. All HLAR in enterococci also showed multidrug resistance. Among the
24 erythromycin-resistant enterococci, 19 (79.2%) harbored the ermB gene, and one (4.2%) harbored both the ermB and ermA genes. A total of 21 enterococci were tetracycline-resistant and harbored one or more of the following tetracycline resistance genes tet(M), tet(L), and tet(O). The Int-Tn gene was detected in one isolate (3.4%) carrying the tet(M) and ermB genes. All 4 chloramphenicol-resistant isolates carried either the phenicol resistance gene cfr alone (one isolate), both cfr and fexA (one isolate), or both fexA and optrA (2 isolates). Four efflux pump genes, efr(A), efr(B), emeA, and lsa, were detected in all HLAR in Enterococcus faecalis isolates. These results improve our understanding of the transmission dynamics of HLAR in enterococci from non-hospital sources to humans.
Key words: enterococci, poultry industry, aminoglycoside-resistance, resistance gene, virulence gene 2019 Poultry Science 0:1–8 http://dx.doi.org/10.3382/ps/pez403
INTRODUCTION
according to the use of antimicrobials as either therapeutic or preventative measures. Aminoglycosides, such as gentamicin, kanamycin, and streptomycin, are broad-spectrum antimicrobials (Krause et al., 2016). In Korea, gentamicin, kanamycin, and streptomycin are frequently used in poultry operations. Gentamicin is commonly injected subcutaneously with either Marek’s or infectious bursal disease vaccines into day-old chicks in hatcheries. Kanamycin and streptomycin are also administered to chickens in drinking water or as an intramuscular or subcutaneous injection (EMA, 2016; APQA, 2017; Liljebjelke et al., 2017). Enterococci are normal inhabitants of the gastrointestinal tract of humans and animals and are commonly found in food and the environment. Although they were considered to be safe microorganisms for many years, nosocomial infections by enterococci have recently emerged as an important public health problem (Lee et al., 2003). Enterococci show intrinsic lowlevel cross resistance to aminoglycosides due to their decreased uptake of antimicrobials (Murray et al., 2003), and they can acquire high-level resistance to aminoglycosides (Adhikari, 2010). Especially, human cases of high-level aminoglycoside-resistance (HLAR) in
The emergence and spread of drug resistance among bacteria have increased at an alarming rate over the past several decades. The prevalence of multidrugresistance in bacteria has also increased, which threatens to narrow the effectiveness of antimicrobials for treating infectious diseases (van den Boaard et al., 2002; Lee et al., 2003; Kim et al., 2018b). The Korea Animal Health Products Association reported that 154 tons of antimicrobials were sold for use in the poultry industry in 2017 (APQA, 2017). In Korea, most chicken meat is produced by several large integrated broiler operations that supply about 80% of the market (KAPE, 2015). These integrated broiler operations control all phases of chicken production, including breeder flock management, hatcheries, feed management, broiler slaughter, and retail distribution (Choi et al., 2014; Kim et al., 2018c). The prevalence of antimicrobial resistance may vary between operations © 2019 Poultry Science Association Inc. Received February 13, 2019. Accepted June 18, 2019. 1 Corresponding author: [email protected]
1
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
Yeong Bin Kim,∗ Kwang Won Seo,∗,† Se Hyun Son,∗ Eun Bi Noh,∗ and Young Ju Lee∗,1
2
KIM ET AL.
MATERIALS AND METHODS Bacterial Strains In 2016 and 2017, 200 samples of retail chicken meat were purchased from retail markets in South Korea as described previously (Kim et al., 2018a). These meats originated from 50 different farms and 7 different broiler operations that supply about 80% of the broiler chickens in Korea. If several isolates of the same origin showed the same antimicrobial susceptibility patterns, only 1 isolate was randomly chosen for analysis. A total of 335 Enterococcus faecalis (E. faecalis) and 10 Enterococcus faecium (E. faecium) isolates were selected for this study.
Antimicrobial Susceptibility Testing Enterococci isolates were screened for susceptibility to a panel of nine antimicrobial drugs [ampicillin (10 µg), chloramphenicol (30 µg), ciprofloxacin (5 µg), doxycycline (30 µg), erythromycin (15 µg), penicillin (10 units), rifampin (5 µg), tetracycline (30 µg), and vancomycin (30 µg)] on Mueller-Hinton agar (BD Biosciences, Sparks, MD, USA) by using the disc diffusion method. Susceptibility tests were conducted according to Clinical and Laboratory Standards Institute (CLSI) guidelines. Staphylococcus aureus ATCC 25,923 was used as a control. Susceptibility results were interpreted according to CLSI standards (CLSI, 2013). Multidrug resistance (MDR) was defined as acquired non-susceptibility to 3 or more antimicrobial categories.
Detection of High-Level Aminoglycoside-Resistant Enterococci The minimum inhibitory concentration (MIC) values for gentamicin, kanamycin, and streptomycin were determined by the agar dilution method on brain heart infusion agar at concentrations ranging of 256– 2048 μg/mL (serial 2-fold dilutions). Enterococcus faecalis ATCC 29,212 was used as a control. Breakpoints for gentamicin (≥500 µg/mL) and streptomycin
(≥2000 µg/mL) were set according to the guidelines of the CLSI (CLSI, 2013). For kanamycin, the breakpoints (≥500 µg/mL) was proposed by the Société Française de Microbiologie (SFM, 2011).
Identification of Antimicrobial Resistance and Virulence Gene The isolates were tested for the presence of macrolides resistance genes (ermB, ermA, and mef), tetracyclines resistance genes [tet(L), tet(M), and tet(O)], efflux pump genes [efr(A), efr(B), emeA, and lsa], Tn916/1545-like and Tn5397-like transposons genes (Int-Tn and tndX, respectively), phenicols resistance genes (cfr, fexA, and optrA) and aminoglycoside modifying enzyme (AME) genes [aac(6 )-Ie–aph(2 )Ia, aph(2 )-Ib, aph(2 )-Ic, aph(2 )-Id, ant(3 )-Ia, and ant(6)-Ia] by PCR. Table 1 lists the primers used to detect resistance, transposon, and AME genes as previously described (Clark et al., 1999; Vakulenko et al., 2003). In addition, virulence genes, including ace (a collagen-binding protein), asa1 (aggregation substance), cylA (cytolysin activator), efaA (cell wallassociated protein involved in immune evasion), esp (enterococcal surface protein), gelE (gelatinase), and hyl (glycoside-hydrolase) were also determined by PCR as previously described (Agarwal et al., 2009).
Analysis of IS256-Flanking Pattern for aac(6 )-Ie–aph(2 )-Ia The IS256-flaking patterns were investigated in HLAR in enterococci harboring aac(6 )-Ie–aph(2 )-Ia. PCR to determine the IS256-flanking pattern was performed by using 2 primer pairs as reported by Watanabe et al. (2009).
RESULTS Multidrug-Resistance Phenotypes of Enterococci Table 2 shows the prevalence of MDR among enterococci isolated from chicken meats from 7 integrated broiler operations. Of the 345 isolates, 136 (39.4%) were resistant to 3 or more antimicrobial classes. In particular, isolates from operations Ⅵ (52.6%, 10 of 19 isolates) and III (50.9%, 29 of 57 isolates) showed a higher proportion of MDR than isolates from the other operations. In addition, all 4 E. faecium isolates from operation I were MDR. Fig 1 shows the distribution of resistance to each antimicrobial class among the MDR enterococci from the seven integrated broiler operations. Resistance to three antimicrobial classes was a frequent phenotype, with a prevalence rate of 23.8 to 42.1%. One isolate each from operations I and III showed resistance to 6 antimicrobial classes, and one isolate from operation I showed resistance to 7 antimicrobial classes.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
enterococci are continually being identified (Kawalec et al., 2007; Mittal et al., 2016). Several studies have reported HLAR in enterococci in retail chicken meat (Hayes et al., 2003; Choi and Woo, 2013; DonadoGodoy et al., 2015; Tyson et al., 2018), which could be a serious threat to human health (Kim et al., 2018b), because antimicrobial resistance genes and virulence genes can be transferred between humans and animals through the consumption of contaminated animal food products (Kwon et al., 2012). In Korea, there have been only a few studies characterizing HLAR in enterococci isolated from retail chicken meat. Therefore, the aim of this study was to investigate the prevalence of HLAR in enterococci from retail chicken meat and genetically characterize the detected strains.
3
HIGH-LEVEL AMINOGLYCOSIDE RESISTANT ENTEROCOCCI Table 1. Primer sequences used for the amplification. Sequence (5 -3 )
Target gene ermA ermB
tet(L) tet(M) tet(O) cfr fexA optrA eme(A) efr(A) efr(B) lsa aac(6’)Ie-aph(2 )-la aph(2 )-Ib aph(2 )-Ic aph(2 )-Id ant(3 )-Ia ant(6)-Ia
F: TAACATCAGTACGGATATTG R: AGTCTACACTTGGCTTAGG F: CCGAACACTAGGGTTGCTC R: ATCTGGAACATCTGTGGTATG F: AGTATCATTAATCACTAGTGC R: TTCTTCTGGTACTAAAAGTGG F: ATAAATTGTTTCGGGTCGGTAAT R: AACCAGCCAACTAATGACAATGAT F: GTTAAATAGTGTTCTTGGAG R: CTAAGATATGGCTCTAACAA F: GATGGCATACAGGCACAGAC R: CAATATCACCAGAGCAGGCT F: TGAAGTATAAAGCAGGTTGGGAGTCA R: ACCATATAATTGACCACAAGCAGC F: GTACTTGTAGGTGCAATTACGGCTGA R: CGCATCTGAGTAGGACATAGCGTC F: AGGTGGTCAGCGAACTAA R: ATCAACTGTTCCCATTCA F: AGCCCAAGCGAAAAGCGGTTT R: CCATCGCTTTCGGACGTTCA F: GTCTGTTTCGTTTAATGGCAGCAGCC R: CGAATAGCTGGTTCATGTCTAAGGC F: ATGTTCTTAATCAATCCGCTGATGGC R: CATAGTAACTACCAAGGACAGCTACCC F: GTGACTTCTTTTGAACAGTGGGA R: TTCAGCCACTTGTTGTCTGCC F: CAGAGCCTTGGGAAGATGAAG R: CCTCGTGTAATTCATGTTCTGGC F: CTTGGACGCTGAGATATATGAGCAC R: GTTTGTAGCAATTCAGAAACACCCTT F: CCACAATGATAATGACTCAGTTCCC R: CCACAGCTTCCGATAGCAAGAG F: GTGGTTTTTACAGGAATGCCATC R: CCCTCTTCATACCAATCCATATAACC F: TGATTTGCTGGTTACGGTGAC R: CGCTATGTTCTCTTGCTTTTG F: ACTGGCTTAATCAATTTGGG R: GCCTTTCCGCCACCTCACCG
Referenece
200
Di Cesare et al., 2013
139
Di Cesare et al., 2013
348
Di Cesare et al., 2013
1077
Choi and Woo, 2015
657
Choi and Woo, 2015
614
Choi and Woo, 2015
746
Kehrenberg and Schwarz, 2006
1272
Kehrenberg and Schwarz, 2006
1395
Kehrenberg and Schwarz, 2006
123
Choi and Choi 2017
258
Choi and Choi 2017
345
Choi and Choi 2017
232
Choi and Choi 2017
348
Vakulenko et al., 2003
867
Vakulenko et al., 2003
641
Vakulenko et al., 2003
284
Vakulenko et al., 2003
284
Clark et al., 1999
596
Clark et al., 1999
Table 2. Distribution of multidrug-resistant and high-level aminoglycoside resistant enterococci from 7 integrated broiler operation.a Integrated broiler operation
No. of Enterococcus faecalis No. of MDR (%) No. of HLAR (%) No. of Enterococcus faecium No. of MDR (%) No. of HLAR (%) Total No. of MDR (%) No. of HLAR (%) a b
Ⅰ
Ⅱ
Ⅲ
Ⅳ
Ⅴ
Ⅵ
Ⅶ
Total
100 34 (34.0) 9 (9.0) 4 4 (100.0) 0 (0.0) 104 38 (36.5) 9 (8.7)
70 23 (32.9) 3 (4.3) –b – – 70 23 (32.9) 3 (4.3)
54 28 (51.9) 8 (14.8) 3 1 (33.3) 0 (0.0) 57 29 (50.9) 8 (14.0)
51 20 (39.2) 5 (9.8) 2 1 (50.0) 1 (50.0) 53 21 (39.6) 6 (11.3)
21 7 (33.3) 1 (4.8) – – – 21 7 (33.3) 1 (4.8)
18 10 (55.6) 0 (0.0) 1 0 (0.0) 0 (0.0) 19 10 (52.6) 0 (0.0)
21 8 (38.1) 2 (9.5) – – – 21 8 (38.1) 2 (9.5)
335 130 (38.8) 28 (8.4) 10 6 (60.0) 1 (10.0) 345 136 (39.4) 29 (8.7)
MDR, multidrug-resistance; HLAR, high-level aminoglycoside resistance. -, Not detected.
Distribution of High-Level Aminoglycoside Resistance in Enterococci A total of 29 (8.7%) isolates, including 28 E. faecalis and one E. faecium strain, showed HLAR, as shown in Table 2. A higher prevalence of HLAR in enterococci isolates was observed from operation Ⅲ (14.0%, 8 of 57 isolates), and HLAR was not detected from operation Ⅳ.
Phenotypes, Genotypes, and Virulence Genes of High-Level Aminoglycoside Resistance in Enterococci The characteristics of the 29 HLAR in enterococci are shown in Table 3. All HLAR in enterococci carried at least 1 of 2 AME genes, aac(6ʹ)Ie-aph(2 )-Ia and ant(6)-Ia. Especially, 13 isolates showed high-level resistance to gentamicin and kanamycin and harbored
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
mef
Size (bp)
4
KIM ET AL.
aac(6ʹ)Ie-aph(2 )-Ia gene, 3 of isolates had pattern A, with IS256 at both ends, and the other 10 isolates had pattern D, without IS256 at both ends. All HLAR in enterococci were also MDR, and the most common resistance pattern included resistance to ciprofloxacin, erythromycin, and tetracycline. Among 24 erythromycin-resistant enterococci, 19 (79.2%) harbored ermB and 1 (4.2%) harbored both ermB and ermA. All 21 enterococci showed tetracycline-resistance, and they harbored 1 or more of the tetracycline resistance genes, tet(M), tet(L), and tet(O). The Int-Tn gene was detected in one isolate (3.4%) carrying the tet(M) and ermB genes. All 4 chloramphenicol-resistant isolates carried phenicol resistant genes; 1 isolate harbored cfr only, 1 isolate harbored both cfr and fexA, and 2 isolates harbored both fexA and optrA. All 4 efflux pump genes, efr(A), efr(B), emeA, and lsa, were detected in all HLAR E. faecalis isolate; the tndX gene, which is related to a transposon, was not detected in any HLAR in enterococci isolate. All HLAR isolates possessed at least 1 of the following 4 virulence genes, ace (86.2%), gelE (82.8%), efaA (79.3%), and asa1 (65.5%). Two isolates were positive for cylA. However, the esp and hyl genes were not detected in any HLAR in enterococci isolate.
DISCUSSION Enterococci are normal commensals in poultry and other domestic animals. However, enterococci may be transmitted to humans through the handling and consumption of contaminated retail chicken meat (Aslam et al., 2012; Choi et al., 2014). Importantly, zoonotic transmission of enterococci from food animal may be
related to antimicrobial resistance(Mannu et al., 2003; Yılmaz et al., 2016). Previous studies have suggested that a high proportion of enterococci in poultry meats are resistance to multiple antimicrobials (Aslam et al., 2012; DonadoGodoy et al., 2015; Kilonzo-Nthenge et al., 2015). In this study, 34.9% of the 345 enterococci isolates showed resistance to 3 or more antimicrobial classes, and 2 of the 7 broiler operations showed a high proportion (≥50%) of MDR isolates. The difference in the resistance patterns at the various operations may reflect their antimicrobial usage during poultry production (Tyson et al., 2018; Kim et al., 2018c). This suggests that tracking and management of what and how antimicrobials are being used and misused by operations is the most important factor for reduction the incidence of resistant pathogens in poultry production. Although enterococci are intrinsically resistant to penicillins, cephalosporins, and low levels of clindamycin and aminoglycosides, some HLAR in enterococci acquired resistance to chloramphenicol, erythromycin, and high-levels of clindamycin, tetracycline, penicillin, fluoroquinolones, and vancomycin due to the release of various AME (Mendiratta et al., 2008). The presence of AME genes in those isolates implies that neither streptomycin nor gentamicin can be synergistically used with a glycopeptide or beta-lactam for the treatment of enterococcal infections (Udo et al., 2004). Aac(6’)Ie-aph(2 )-Ia and ant(6)-Ia are the most commonly detected genes in high-level gentamicin-resistant enterococci and high-level streptomycin-resistant enterococci, respectively (Chow, 2000). In this study, the aac(6’)Ie-aph(2 )-Ia gene was detected in all 13 isolates with a gentamicin MIC >2048 μg/mL, and the ant(6)-Ia gene was detected in 21 isolates with a
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
Figure 1. Distribution of multidrug resistance of 136 enterococci isolated from 7 integrated broiler operations.
–
– – D
– A D
D
D
D
– – – D
D
Ⅲ
Ⅳ Ⅰ Ⅰ
Ⅶ Ⅶ Ⅲ
Ⅱ
Ⅲ
Ⅲ
Ⅰ Ⅲ Ⅴ Ⅰ
Ⅰ
Ⅳ
EFS 84–1
EFS 90–1 EFS 98–1 EFS 120–1
EFS 122–1 EFS 124–1 EFS 125–1
EFS 131–2
EFS 133–2
EFS 135–1
140–1 146–2 154–1 171–2
EFS EFS EFS EFS
EFS 174–2
E. faecium EFM 1–2
CIP-TE-P
CIP-E
DOX-E-TE DOX-E-TE CIP- DOX-E-TE C-CIP-DOX-E-TE
CIP-E
CIP-E-TE
CIP-E
CIP-TE CIP-DOX-TE CIP-E
CIP-DOX-E-TE DOX-E-TE C-E
C-CIP-DOX-E-TE
CIP-E CIP-TE-RA DOX-E-TE CIP-E
AM-C-CIP-DOX-E-P-TE CIP-DOX-E-TE DOX-E-TE C-CIP-DOX-E-TE DOX-E-TE CIP-DOX-TE CIP-E-TE E-TE CIP-E
Phenotypea
tet(L), tet(M)
ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), fexA, optrA, efr(A), efr(B), emeA, lsa efr(A), efr(B), emeA, lsa
ermB, efr(A), efr(B), emeA, lsa
ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa
ermB, efr(A), efr(B), emeA, lsa
tet(O), efr(A), efr(B), emeA, lsa tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, efr(A), efr(B), emeA, lsa
ermB, tet(L), tet(M), Int-Tn, cfr, fexA, efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermA, ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, fexA, optrA, efr(A), efr(B), emeA, lsa
ermB, efr(A), efr(B), emeA, lsa tet(M), efr(A), efr(B), emeA, lsa tet(L), tet(M), efr(A), efr(B), emeA, lsa efr(A), efr(B), emeA, lsa
ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), tet(O), efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), cfr, efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, tet(M), efr(A), efr(B), emeA, lsa tet(M), efr(A), efr(B), emeA, lsa ermB, efr(A), efr(B), emeA, lsa
Genotype
AM, ampicillin; C, chloramphenicol; CIP, ciprofloxacin; DOX, doxycycline; E, erythromycin; P, penicillin; TE, tetracycline; RA, rifampin. G, gentamicin; S, streptomycin; K, kanamycin. -, Not applicant.
C
b
aac(6’)Ie-aph(2 )-la
ant(6)-Ia ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia ant(6)-Ia aac(6’)Ie-aph(2 )-la aac(6’)Ie-aph(2 )-la, ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia ant(6)-Ia ant(6)-Ia ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia
ant(6)-Ia ant(6)-Ia ant(6)-Ia ant(6)-Ia ant(6)-Ia aac(6’)Ie-aph(2 )-la ant(6)-Ia ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia ant(6)-Ia aac(6’)Ie-aph(2 )-la ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia ant(6)-Ia
AME gene
Other resistance
efaA, gelE efaA, efaA, gelE asa1, gelE
ace, efaA
ace, asa1, efaA, gelE
ace, asa1, efaA, gelE asa1, gelE ace, asa1, efaA, gelE ace, efaA
ace, asa1, efaA, gelE
ace, asa1, efaA, gelE
ace, asa1, efaA, gelE
asa1 ace, asa1, efaA, gelE ace, asa1, efaA, gelE
ace, asa1, efaA, gelE ace, asa1, cylA, efaA, gelE asa1, gelE
ace, efaA,
ace, ace, ace, ace,
ace, asa1, cylA, gelE ace, asa1, efaA, gelE ace, asa1, efaA, gelE ace, efaA, gelE ace, asa1, efaA, gelE ace, efaA, gelE gelE ace, asa1, efaA, gelE ace, efaA, gelE
Virulence factor
>2048 >2048 >2048 >2048 >2048 <256 >2048 >2048
<256 <256 <256 <256 <256 >2048 >2048 <256 >2048
2048 >2048 >2048 >2048 >2048 >2048
2048 <256 >2048 >2048 <256 >2048 >2048 >2048 >2048 <256
<256
>2048 >2048 <256 >2048 <256 <256 <256 >2048 <256 >2048 >2048 >2048 >2048 >2048 <256 <256 <256 >2048 >2048
>2048
<256 <256 >2048
2048
S
>2048
>2048
>2048 >2048 >2048 >2048
>2048
>2048
>2048
<256 >2048 >2048
>2048 >2048 >2048
>2048
>2048 >2048 >2048 >2048
>2048 >2048 >2048 >2048 >2048 >2048 >2048 >2048 >2048
k
MIC (μg/mL)b G
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
a
– A – D
Ⅲ Ⅳ Ⅳ Ⅲ
67–1 77–2 79–2 83–2
EFS EFS EFS EFS
D
-c – – – – A – – D
Ⅰ Ⅰ Ⅳ Ⅱ Ⅲ Ⅱ Ⅰ Ⅰ Ⅳ
IS256flanking pattern
E. faecalis EFS 18–1 EFS 18–2 EFS 25–2 EFS 30–1 EFS 35–1 EFS 38–1 EFS 46–1 EFS 51–1 EFS 57–1
Strain
Integrated broiler operation
Table 3. Characteristics of high-level aminoglycoside resistant 28 Enterococcus faecalis and 1 Enterococcus faecium from retail chicken meat.
HIGH-LEVEL AMINOGLYCOSIDE RESISTANT ENTEROCOCCI
5
6
KIM ET AL.
Although the presence of HLAR in enterococci in chicken meat in Korea may not be important for the poultry industry, monitoring of HLAR in enterococci is needed because it may contribute to the evolution and spread of these strains and resistance-conferring genes to humans. Determination of the molecular characteristics of isolates from non-hospital sources, especially poultry, will also help to define the transmission dynamics of HLAR in enterococci from non-hospital source to humans.
ACKNOWLEDGMENTS This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through Agriculture, Food and Rural Affairs Research Center Support Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (716002–7).
REFERENCES Adhikari, L. 2010. High-level aminoglycoside resistance and reduced susceptibility to vancomycin in nosocomial enterococci. J. Global Infect. Dis. 2:231–235. Agarwal, J., R. Kalyan, and M. Singh. 2009. High-level aminoglycoside resistance and beta-lactamase production in enterococci at a tertiary care hospital in India. Jpn. J. Infect. Dis. 62:158–159. Animal and Plant Quarantine Agency (APQA), 2017. Antimicrobial use and monitoring in animals and animal products. APQA, gimcheon, Republic of Korea. Aslam, M., M. S. Diarra, S. Checkley, V. Bohaychuk, and L. Masson. 2012. Characterization of antimicrobial resistance and virulence genes in Enterococcus spp. isolated from retail meats in Alberta, Canada, Int. J. Food Microbiol. 156:222–230. Cauwerts, K., A. Decostere, E. M. De Graef, F. Haesebrouck, and F. Pasmans. 2007. High prevalence of tetracycline resistance in Enterococcus isolates from broilers carrying the erm(B) gene. Avian Pathol. 36:395–399. Chaj˛ ecka-Wierzchowska, W., A. Zadernowska, U. Zarzecka, A. Zakrzewski, and J. Gajewska. 2019. Enterococci from ready-toeat food - horizontal gene transfer of antibiotic resistance genes and genotypic characterization by PCR melting profile. J. Sci. Food Agric. 99:1172–1179. Choi, J. M., and G. J. Woo. 2013. Molecular characterization of highlevel gentamicin-resistant Enterococcus faecalis from chicken meat in Korea. Int. J. Food Microbiol. 165:1–6. Choi, J. M., and G. J. Woo. 2015. Transfer of tetracycline resistance genes with aggregation substance in food-borne Enterococcus faecalis. Curr. Microbiol. 70:476–484. Choi, M. K., and S. S. Choi. 2017. Analysis of antimicrobial resistance pattern and distribution of multi-drug efflux pump genes and virulence genes in Enterococcus faecalis isolated from retail meat in Seoul. J. Fd Hyg. Safety. 32:135–140. Choi, S. W., J. S. Ha, B. Y. Kim, D. H. Lee, J. K. Park, H. N. Youn, Y. H. Hong, S. B. Lee, J. B. Lee, S. Y. Park, I. S. Choi, and C. S. Song. 2014. Prevalence and characterization of Salmonella species in entire steps of a single integrated broiler supply chain in Korea. Poult. Sci. 93:1251–1257. Chow, J. W. 2000. Aminoglycoside resistance in enterococci. Clin Infect Dis. 31:586–589. Clark, N. C., Ø. Olsvik, J. M. Swenson, C. A. Spiegel, and F. C. Tenover. 1999. Detection of a streptomycin/spectinomycin adenylyltransferase gene (aadA) in Enterococcus faecalis. Antimicrob. Agents Chemother. 43:157–160. Clinical and Laboratory Standards Institute (CLSI), 2013. Performance Standards for Antimicrobial Susceptibility Testing, M100S23. Clinical and Laboratory Standards Institute, Wayne, PA.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
streptomycin MIC ≥2048 μg/mL. For the Tn5281like elements, the 2 representative IS256-flanking patterns, A and D, detected in the present study were previously detected in clinical isolates of enterococci (Simjee et al., 1999; Klibi et al., 2006), and the pattern D was predominant among HLAR in enterococci harboring the aac(6’)Ie-aph(2 )-Ia gene. Pattern A, with IS256 at both ends, was the most frequent pattern detected in the 1990s; however, in recent reports, pattern C, which lacks IS256 at the 5ʹ-end, and pattern D, which lacks IS256 at both ends, are predominant (Leelaporn et al., 2008; Zhang et al., 2018). Our results suggested that plasmid or transposons harboring aac(6ʹ)Ie-aph(2 )-Ia with IS256-flanking pattern D may be predominant in the poultry industry in Korea, although no evidence for an association was found between IS256-flanking pattern and resistance to aminoglycosides, or the presence of virulence determinant genes (Watanabe et al., 2009). In this study, the most common tetracycline and erythromycin resistance genes identified in the resistant strains were tet(L), tet(M), and ermB, which was in agreement with previous studies of isolated from chicken meat (Cauwerts et al., 2007; Diarra et al., 2010; Choi and Woo, 2015). Cauwerts et al. (2007) reported that transposons associated with tet(M) and ermB in enterococci can be easily transferred. In addition, the optrA gene, which encodes an ATP-binding cassette transporter and confers transferable resistance to fluorinated and non-fluorinated phenicols (Wang et al., 2015), and the cfr gene, which confers resistance to 5 chemically unrelated antimicrobial classes including phenicols, were also detected in this study. The emergence of optrA and cfr in enterococci from food animals is a serious concern as they could be transmitted to human via the food chain, and the spread of these genes could significantly limit treatment options for MDR bacteria (Liu et al., 2012; Tamang et al., 2017). Regarding the multidrug efflux pump genes efr(A), efr(B), emeA, and lsa (Lee et al., 2003; Sánchez Valenzuela et al., 2013), 100% of the HLAR E. faecalis strains in this study possessed these genes, whereas the E. faecium strains did not. Multidrug efflux pumps also contribute to the growing problem of antimicrobial resistance in bacteria (Schindler and Kaatz, 2016). Multidrug efflux pumps have emerged as elements relevant to the intrinsic and acquired antimicrobial resistance of bacterial pathogens (Martinez et al., 2009). A number of virulence factors have been described in enterococci (McGowan-Spicer et al., 2008; Diarra et al., 2010), and in this study, the ace, efaA, gelE, and asa1 genes were the most prevalent in HLAR in enterococci, as was reported previously (McGowan-Spicer et al., 2008; Han et al., 2011; Yılmaz et al., 2016). The high prevalence of the gelE gene in isolates from readyto-eat food is considered to be a food safety risk because the gelE gene is associated with human infection (Guerrero-Ramos et al., 2016; Chaj˛ ecka-Wierzchowska et al., 2018).
HIGH-LEVEL AMINOGLYCOSIDE RESISTANT ENTEROCOCCI
Kwon, K. H., S. Y. Hwang, B. Y. Moon, Y. K. Park, S. Shin, C. Y. Hwang, and Y. H. Park. 2012. Occurrence of antimicrobial resistance and virulence genes, and distribution of enterococcal clonal complex 17 from animals and human beings in Korea. J. VET Diagn. Invest. 24:924–931. Lee, E. W., M. N. Huda, T. Kuroda, T. Mizushima, and T. Tsuchiya. 2003. EfrAB, an ABC multidrug efflux pump in Enterococcus faecalis. Antimicrob. Agents Chemother. 47:3733–3738. Leelaporn, A., K. Yodkamol, D. Waywa, and S. Pattanachaiwit. 2008. A novel structure of Tn4001-truncated element, type V, in clinical enterococcal isolates and multiplex PCR for detecting aminoglycoside resistance genes. Int. J. Antimicrob. Agents. 31:250–254. Liljebjelke, K. A., C. L. Hofacre, D. G. White, S. Ayers, M. D. Lee, and J. J. Maurer. 2017. Diversity of antimicrobial resistance phenotypes in Salmonella isolated from commercial poultry farms. Front. Vet. Sci. 96:1–9. Liu, Y., Y. Wang, C. Wu, Z. Shen, S. Schwarz, X. D. Du, L. Dai, W. Zhang, Q. Zhang, and J. Shen. 2012. First report of the multidrug resistance gene cfr in Enterococcus faecalis of animal origin. Antimicrob. Agents Chemother. 56:1650–1654. Mannu, L., A. Paba, E. Daga, R. Comunian, S. Zanetti, I. Duprè, and L. A. Sechi. 2003. Comparison of the incidence of virulence determinants and antibiotic resistance between Enterococcus faecium strains of dairy, animal and clinical origin. Int. J. Food Microbiol. 88:291–304. Martinez, J. L., M. B. Sánchez, L. Martínez-Solano, A. Hernandez, L. Garmendia, A. Fajardo, and C. Alvarez-Ortega. 2009. Functional role of bacterial multidrug efflux pumps in microbial natural ecosystems. FEMS Microbiol. Rev. 33:430–449. Mcgowan-Spicer, L. L., P. J. Fedorka-Cray, J. G. Frye, R. J. Meinersmann, J. B. Barrett, and C. R. Jackson. 2008. Antimicrobial resistance and virulence of Enterococcus faecalis isolated from retail food. J. Food Prot. 71:760–769. Mendiratta, D. K., H. Kaur, V. Deotale, D. C. Thamke, R. Narang, and P. Narang. 2008. Status of high level aminoglycoside resistant Enterococcus faecium and Enterococcus faecalis in a rural hospital of Central India. Indian J. Med. Microbiol. 26:369–371. Mittal, S., P. Singla, A. Deep, K. Bala, R. Sikka, M. Garg, and U. Chaudhary. 2016. Vancomycin and high level aminoglycoside resistance in Enterococcus spp. in a tertiary health care centre: a therapeutic concern. J. Pathogens. 2016:1–5. Murray, P. R., E. J. Baron, J. H. Jorgenson, M. A. Pfaller, and R. H. Yolken. 2003. Manual of Clinical Microbiology, 8th edition. Washinton DC. Sánchez Valenzuela, A., L. Lavilla Lerma, N. Benomar, A. Gálvez, R. Pérez Pulido, and H. Abriouel. 2013. phenotypic and molecular antibiotic resistance profile of Enterococcus faecalis and Enterococcus faecium isolated from different traditional fermented foods. Foodborne Pathog. Dis. 10:143–149. Schindler, B. D., and G. W. Kaatz. 2016. Multidrug efflux pumps of gram-positive bacteria. Drug Resist. Updat. 27:1–13. Simjee, S., A. P. Fraise, and M. J. Gill. 1999. Plasmid heterogeneity and identification of a Tn5281-like element in clinical isolates of high-level gentamicin-resistant Enterococcus faecium isolated in the UK. J. Antimicrob. Chemother. 43:625–635. Société Française de Microbiologie (SFM), 2011. Comité de l’Antibiogramme de la Société Française de Microbiologie. Biologiques, Paris. Tamang, M. D., D. C. Moon, S. R. Kim, H. Y. Kang, K. Lee, H. M. Nam, G. C. Jang, H. S. Lee, S. C. Jung, and S. K. Lim. 2017. Detection of novel oxazolidinone and phenicol resistance gene optrA in enterococcal isolates from food animals and animal carcasses. Vet Microbiol. 201:252–256. Tyson, G. H., E. Nyirabahizi, E. Crarey, C. Kabera, C. Lam, C. RiceTrujillo, P. F. McDermott, and H. Tate. 2018. Prevalence and antimicrobial resistance of enterococci isolated from retail meats in the united states, 2002 to 2014. Appl. Environ. Microbiol. 84: 1–9. Udo, E. E., N. Al-Sweih, P. John, L. E. Jacob, and S. Mohanakrishnan. 2004. Characterization of high-level aminoglycoside-resistant enterococci in Kuwait hospitals. Microb. Drug Resist. 10:139– 145.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
Di Cesare, A., G. M. Luna, C. Vignaroli, S. Pasquaroli, S. Tota, P. Paroncini, and F. Biavasco. 2013. Aquaculture can promote the presence and spread of antibiotic-resistant Enterococci in marine sediments. PLoS One. 8:e62838. Diarra, M. S., H. Rempel, J. Champagne, L. Masson, J. Pritchard, and E. Topp. 2010. Distribution of antimicrobial resistance and virulence genes in Enterococcus spp. and characterization of isolates from broiler chickens. Appl. Environ. Microbiol. 76:8033– 8043. Donado-Godoy, P., B. A. Byrne, M. León, R. Castellanos, C. Vanegas, A. Coral, A. Arevalo, V. Clavijo, M. Vargas, J. J. Romero Zuñiga, M. Tafur, E. Pérez-Gutierrez, and W. A. Smith. 2015. Prevalence, resistance patterns, and risk factors for antimicrobial resistance in bacteria from retail chicken meat in Colombia. J. Food Prot. 78:751–759. European Medicines Agency (EMA). 2016. Updated advice on the use of colistin products in animals within the European Union: development of resistance and possible impact on human and animal health. Accessed Jun. 2016. https://www.ema.europa.eu/ documents/scientific-guideline/updated-advice-use-colistin-pro ducts-animals-within-european-union-development-resistancepossible_en.pdf. Guerrero-Ramos, E., J. Cordero, D. Molina-González, P. Poeta, G. Igrejas, C. Alonso-Calleja, and R. Capita. 2016. Antimicrobial resistance and virulence genes in enterococci from wild game meat in Spain. Food Microbiol. 53:156–164. Han, D. K., T. Unno, J. H. Jang, K. T. Lim, S. N. Lee, G. P. Ko, M. J. Sadowsky, and H. G. Hur. 2011. The occurrence of virulence traits among high-level aminoglycosides resistant Enterococcus isolates obtained from feces of humans, animals, and birds in South Korea. Int. J. Food Microbiol. 144:387–392. Hayes, J. R., L. L. English, P. J. Carter, T. Proescholdt, K. Y. Lee, D. D. Wagner, G. David, T. Proescholdt, and D. G. White. 2003. prevalence and antimicrobial resistance of Enterococcus species isolated from retail meats prevalence and antimicrobial resistance of Enterococcus species isolated from retail meats. Appl. Environ. Microbiol. 69:7153–7160. Kawalec, M., Z. Pietras, E. Daniłowicz, A. Jakubczak, M. Gniadkowski, W. Hryniewicz, and R. J. L. Willems. 2007. Clonal structure of Enterococcus faecalis isolated from Polish hospitals: characterization of epidemic clones. J Clin Microbiol. 45:147–153. Kehrenberg, C., and S. Schwarz. 2006. Distribution of florfenicol resistance genes fexA and cfr among chloramphenicol-resistant Staphylococcus isolates. Antimicrob. Agents Chemother. 50:1156– 1163. Kilonzo-Nthenge, A., A. Brown, S. N. Nahashon, and D. Long. 2015. Occurrence and antimicrobial resistance of enterococci isolated from organic and conventional retail chicken. J. Food Prot. 78:760–766. Kim, Y. B., H. J. Seo, K. W. Seo, H. Y. Jeon, D. K. Kim, S. W. Kim, S.-K. Lim, and Y. J. Lee. 2018. Characteristics of Highlevel ciprofloxacin-resistant Enterococcus faecalis and Enterococcus faecium from retail chicken meat in Korea. J. Food Prot. 81:1357–1363. Kim, Y. B., K. W. Seo, H. Y. Jeon, S. K. Lim, and Y. J. Lee. 2018. Characteristics of the antimicrobial resistance of Staphylococcus aureus isolated from chicken meat produced by different integrated broiler operations in Korea. Poult. Sci. 97:962–969. Kim, Y. J., J. H. Park, and K. H. Seo. 2018. Comparison of the loads and antibiotic-resistance profiles of Enterococcus species from conventional and organic chicken carcasses in South Korea. Poult. Sci. 97:271–278. Klibi, N., K. Ben Slama, A. Masmoudi, S. Gharbi, F. Ruiz-Larrea, C. Fendri, A. Boudabous, and C. Torres. 2006. Diversity of structures carrying the aac(6 )-aph(2 ;) gene in clinical Enterococcus faecalis and Enterococcus faecium strains isolated in Tunisia. J Chemother. 18:353–359. Korea Institute for Animal Products Quality Evaluation (KAPE). 2015. Research on the actual conditions of livestock distribution system 2015. Bundang, Republic of Korea Krause, K. M., A. W. Serio, T. R. Kane, and L. E. Connolly. 2016. Aminoglycosides: an overview. Cold spring harb. Perspect. Med. 6:1–19.
7
8
KIM ET AL. Watanabe, S., N. Kobayashi, D. Quiñones, S. Nagashima, N. Uehara, and N. Watanabe. 2009. Genetic diversity of enterococci harboring the high-level gentamicin resistance gene aac(6’)-Ieaph(2’’)-Ia or aph(2’’)-Ie in a Japanese hospital. Microb. Drug Resist. 15:185–194. Yılmaz, E. S ¸ ., Ö. Aslanta¸s, S. P. Önen, S. Türkyılmaz, and C. Kürekci. 2016. Prevalence, antimicrobial resistance and virulence traits in enterococci from food of animal origin in Turkey. LWT - Food Sci. Technol. 66:20–26. Zhang, J.-M., Q. Wang, T.-Y. Han, J.-H. Liu, X.-X. Hu, F. Qiao, X.-Y. Yang, C.-R. Li, and X.-F. You. 2018. Structure analysis of transposons carrying aac(6’)-aph(2’’) gene in Enterococcus faecalis isolated in Beijing China and comparison of their transfer efficiency. Int. J. Antimicrob. Agents. 52:799– 804.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
Vakulenko, S. B., S. M. Donabedian, M. Anatoliy, M. J. Zervos, S. A. Lerner, J. W. Chow, and A. M. Voskresenskiy. 2003. Multiplex pcr for detection of aminoglycoside resistance genes in enterococci. Antimicrob. Agents Chemother. 47:1423–1426. van den Boaard, A.E., R. Willems, N. London, J. Top, and E. E. Stobberingh. 2002. Antibiotic resistance of faecal enterococci in poultry, poultry farmers and poultry slaughterers. J. Antimicrob. Chemother. 49:497–505. Wang, Y., Y. Lv, J. Cai, S. Schwarz, L. Cui, Z. Hu, R. Zhang, J. Li, Q. Zhao, T. He, D. Wang, Z. Wang, Y. Shen, Y. Li, A. T. Feßler, C. Wu, H. Yu, X. Deng, X. Xia, and J. Shen. 2015. A novel gene, optrA, that confers transferable resistance to oxazolidinones and phenicols and its presence in Enterococcus faecalis and Enterococcus faecium of human and animal origin. J. Antimicrob. Chemother. 70:2182–2190.
∗
College of Veterinary Medicine & Zoonoses Research Institute, Kyungpook National University, Daegu 41566, Republic of Korea; and † Department of Basic Sciences, College of Veterinary Medicine, Mississippi State University, Mississippi State 39762, USA
ABSTRACT Retail chicken meat can play a role in the transfer of drug resistance to humans through the handling or ingestion of improperly cooked meat contaminated with resistant enterococci. In fact, highlevel aminoglycoside-resistance (HLAR) in enterococci identified in human cases. Therefore, the prevalence and genetic characterization of HLAR in enterococci in retail chicken meat were investigated in this study. Of the 345 enterococci strains, 29 (8.7%) showed HLAR. All HLAR in enterococci carried at least 1 of 2 aminoglycoside-modifying enzyme genes, aac(6ʹ)Ieaph(2 )-Ia and ant(6)-Ia. Among the 13 isolates that carried aac(6ʹ)Ie-aph(2 )-Ia, 3 had pattern A, with IS256 at both ends, and the other 10 had pattern D, without IS256 at both ends. All HLAR in enterococci also showed multidrug resistance. Among the
24 erythromycin-resistant enterococci, 19 (79.2%) harbored the ermB gene, and one (4.2%) harbored both the ermB and ermA genes. A total of 21 enterococci were tetracycline-resistant and harbored one or more of the following tetracycline resistance genes tet(M), tet(L), and tet(O). The Int-Tn gene was detected in one isolate (3.4%) carrying the tet(M) and ermB genes. All 4 chloramphenicol-resistant isolates carried either the phenicol resistance gene cfr alone (one isolate), both cfr and fexA (one isolate), or both fexA and optrA (2 isolates). Four efflux pump genes, efr(A), efr(B), emeA, and lsa, were detected in all HLAR in Enterococcus faecalis isolates. These results improve our understanding of the transmission dynamics of HLAR in enterococci from non-hospital sources to humans.
Key words: enterococci, poultry industry, aminoglycoside-resistance, resistance gene, virulence gene 2019 Poultry Science 0:1–8 http://dx.doi.org/10.3382/ps/pez403
INTRODUCTION
according to the use of antimicrobials as either therapeutic or preventative measures. Aminoglycosides, such as gentamicin, kanamycin, and streptomycin, are broad-spectrum antimicrobials (Krause et al., 2016). In Korea, gentamicin, kanamycin, and streptomycin are frequently used in poultry operations. Gentamicin is commonly injected subcutaneously with either Marek’s or infectious bursal disease vaccines into day-old chicks in hatcheries. Kanamycin and streptomycin are also administered to chickens in drinking water or as an intramuscular or subcutaneous injection (EMA, 2016; APQA, 2017; Liljebjelke et al., 2017). Enterococci are normal inhabitants of the gastrointestinal tract of humans and animals and are commonly found in food and the environment. Although they were considered to be safe microorganisms for many years, nosocomial infections by enterococci have recently emerged as an important public health problem (Lee et al., 2003). Enterococci show intrinsic lowlevel cross resistance to aminoglycosides due to their decreased uptake of antimicrobials (Murray et al., 2003), and they can acquire high-level resistance to aminoglycosides (Adhikari, 2010). Especially, human cases of high-level aminoglycoside-resistance (HLAR) in
The emergence and spread of drug resistance among bacteria have increased at an alarming rate over the past several decades. The prevalence of multidrugresistance in bacteria has also increased, which threatens to narrow the effectiveness of antimicrobials for treating infectious diseases (van den Boaard et al., 2002; Lee et al., 2003; Kim et al., 2018b). The Korea Animal Health Products Association reported that 154 tons of antimicrobials were sold for use in the poultry industry in 2017 (APQA, 2017). In Korea, most chicken meat is produced by several large integrated broiler operations that supply about 80% of the market (KAPE, 2015). These integrated broiler operations control all phases of chicken production, including breeder flock management, hatcheries, feed management, broiler slaughter, and retail distribution (Choi et al., 2014; Kim et al., 2018c). The prevalence of antimicrobial resistance may vary between operations © 2019 Poultry Science Association Inc. Received February 13, 2019. Accepted June 18, 2019. 1 Corresponding author: [email protected]
1
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
Yeong Bin Kim,∗ Kwang Won Seo,∗,† Se Hyun Son,∗ Eun Bi Noh,∗ and Young Ju Lee∗,1
2
KIM ET AL.
MATERIALS AND METHODS Bacterial Strains In 2016 and 2017, 200 samples of retail chicken meat were purchased from retail markets in South Korea as described previously (Kim et al., 2018a). These meats originated from 50 different farms and 7 different broiler operations that supply about 80% of the broiler chickens in Korea. If several isolates of the same origin showed the same antimicrobial susceptibility patterns, only 1 isolate was randomly chosen for analysis. A total of 335 Enterococcus faecalis (E. faecalis) and 10 Enterococcus faecium (E. faecium) isolates were selected for this study.
Antimicrobial Susceptibility Testing Enterococci isolates were screened for susceptibility to a panel of nine antimicrobial drugs [ampicillin (10 µg), chloramphenicol (30 µg), ciprofloxacin (5 µg), doxycycline (30 µg), erythromycin (15 µg), penicillin (10 units), rifampin (5 µg), tetracycline (30 µg), and vancomycin (30 µg)] on Mueller-Hinton agar (BD Biosciences, Sparks, MD, USA) by using the disc diffusion method. Susceptibility tests were conducted according to Clinical and Laboratory Standards Institute (CLSI) guidelines. Staphylococcus aureus ATCC 25,923 was used as a control. Susceptibility results were interpreted according to CLSI standards (CLSI, 2013). Multidrug resistance (MDR) was defined as acquired non-susceptibility to 3 or more antimicrobial categories.
Detection of High-Level Aminoglycoside-Resistant Enterococci The minimum inhibitory concentration (MIC) values for gentamicin, kanamycin, and streptomycin were determined by the agar dilution method on brain heart infusion agar at concentrations ranging of 256– 2048 μg/mL (serial 2-fold dilutions). Enterococcus faecalis ATCC 29,212 was used as a control. Breakpoints for gentamicin (≥500 µg/mL) and streptomycin
(≥2000 µg/mL) were set according to the guidelines of the CLSI (CLSI, 2013). For kanamycin, the breakpoints (≥500 µg/mL) was proposed by the Société Française de Microbiologie (SFM, 2011).
Identification of Antimicrobial Resistance and Virulence Gene The isolates were tested for the presence of macrolides resistance genes (ermB, ermA, and mef), tetracyclines resistance genes [tet(L), tet(M), and tet(O)], efflux pump genes [efr(A), efr(B), emeA, and lsa], Tn916/1545-like and Tn5397-like transposons genes (Int-Tn and tndX, respectively), phenicols resistance genes (cfr, fexA, and optrA) and aminoglycoside modifying enzyme (AME) genes [aac(6 )-Ie–aph(2 )Ia, aph(2 )-Ib, aph(2 )-Ic, aph(2 )-Id, ant(3 )-Ia, and ant(6)-Ia] by PCR. Table 1 lists the primers used to detect resistance, transposon, and AME genes as previously described (Clark et al., 1999; Vakulenko et al., 2003). In addition, virulence genes, including ace (a collagen-binding protein), asa1 (aggregation substance), cylA (cytolysin activator), efaA (cell wallassociated protein involved in immune evasion), esp (enterococcal surface protein), gelE (gelatinase), and hyl (glycoside-hydrolase) were also determined by PCR as previously described (Agarwal et al., 2009).
Analysis of IS256-Flanking Pattern for aac(6 )-Ie–aph(2 )-Ia The IS256-flaking patterns were investigated in HLAR in enterococci harboring aac(6 )-Ie–aph(2 )-Ia. PCR to determine the IS256-flanking pattern was performed by using 2 primer pairs as reported by Watanabe et al. (2009).
RESULTS Multidrug-Resistance Phenotypes of Enterococci Table 2 shows the prevalence of MDR among enterococci isolated from chicken meats from 7 integrated broiler operations. Of the 345 isolates, 136 (39.4%) were resistant to 3 or more antimicrobial classes. In particular, isolates from operations Ⅵ (52.6%, 10 of 19 isolates) and III (50.9%, 29 of 57 isolates) showed a higher proportion of MDR than isolates from the other operations. In addition, all 4 E. faecium isolates from operation I were MDR. Fig 1 shows the distribution of resistance to each antimicrobial class among the MDR enterococci from the seven integrated broiler operations. Resistance to three antimicrobial classes was a frequent phenotype, with a prevalence rate of 23.8 to 42.1%. One isolate each from operations I and III showed resistance to 6 antimicrobial classes, and one isolate from operation I showed resistance to 7 antimicrobial classes.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
enterococci are continually being identified (Kawalec et al., 2007; Mittal et al., 2016). Several studies have reported HLAR in enterococci in retail chicken meat (Hayes et al., 2003; Choi and Woo, 2013; DonadoGodoy et al., 2015; Tyson et al., 2018), which could be a serious threat to human health (Kim et al., 2018b), because antimicrobial resistance genes and virulence genes can be transferred between humans and animals through the consumption of contaminated animal food products (Kwon et al., 2012). In Korea, there have been only a few studies characterizing HLAR in enterococci isolated from retail chicken meat. Therefore, the aim of this study was to investigate the prevalence of HLAR in enterococci from retail chicken meat and genetically characterize the detected strains.
3
HIGH-LEVEL AMINOGLYCOSIDE RESISTANT ENTEROCOCCI Table 1. Primer sequences used for the amplification. Sequence (5 -3 )
Target gene ermA ermB
tet(L) tet(M) tet(O) cfr fexA optrA eme(A) efr(A) efr(B) lsa aac(6’)Ie-aph(2 )-la aph(2 )-Ib aph(2 )-Ic aph(2 )-Id ant(3 )-Ia ant(6)-Ia
F: TAACATCAGTACGGATATTG R: AGTCTACACTTGGCTTAGG F: CCGAACACTAGGGTTGCTC R: ATCTGGAACATCTGTGGTATG F: AGTATCATTAATCACTAGTGC R: TTCTTCTGGTACTAAAAGTGG F: ATAAATTGTTTCGGGTCGGTAAT R: AACCAGCCAACTAATGACAATGAT F: GTTAAATAGTGTTCTTGGAG R: CTAAGATATGGCTCTAACAA F: GATGGCATACAGGCACAGAC R: CAATATCACCAGAGCAGGCT F: TGAAGTATAAAGCAGGTTGGGAGTCA R: ACCATATAATTGACCACAAGCAGC F: GTACTTGTAGGTGCAATTACGGCTGA R: CGCATCTGAGTAGGACATAGCGTC F: AGGTGGTCAGCGAACTAA R: ATCAACTGTTCCCATTCA F: AGCCCAAGCGAAAAGCGGTTT R: CCATCGCTTTCGGACGTTCA F: GTCTGTTTCGTTTAATGGCAGCAGCC R: CGAATAGCTGGTTCATGTCTAAGGC F: ATGTTCTTAATCAATCCGCTGATGGC R: CATAGTAACTACCAAGGACAGCTACCC F: GTGACTTCTTTTGAACAGTGGGA R: TTCAGCCACTTGTTGTCTGCC F: CAGAGCCTTGGGAAGATGAAG R: CCTCGTGTAATTCATGTTCTGGC F: CTTGGACGCTGAGATATATGAGCAC R: GTTTGTAGCAATTCAGAAACACCCTT F: CCACAATGATAATGACTCAGTTCCC R: CCACAGCTTCCGATAGCAAGAG F: GTGGTTTTTACAGGAATGCCATC R: CCCTCTTCATACCAATCCATATAACC F: TGATTTGCTGGTTACGGTGAC R: CGCTATGTTCTCTTGCTTTTG F: ACTGGCTTAATCAATTTGGG R: GCCTTTCCGCCACCTCACCG
Referenece
200
Di Cesare et al., 2013
139
Di Cesare et al., 2013
348
Di Cesare et al., 2013
1077
Choi and Woo, 2015
657
Choi and Woo, 2015
614
Choi and Woo, 2015
746
Kehrenberg and Schwarz, 2006
1272
Kehrenberg and Schwarz, 2006
1395
Kehrenberg and Schwarz, 2006
123
Choi and Choi 2017
258
Choi and Choi 2017
345
Choi and Choi 2017
232
Choi and Choi 2017
348
Vakulenko et al., 2003
867
Vakulenko et al., 2003
641
Vakulenko et al., 2003
284
Vakulenko et al., 2003
284
Clark et al., 1999
596
Clark et al., 1999
Table 2. Distribution of multidrug-resistant and high-level aminoglycoside resistant enterococci from 7 integrated broiler operation.a Integrated broiler operation
No. of Enterococcus faecalis No. of MDR (%) No. of HLAR (%) No. of Enterococcus faecium No. of MDR (%) No. of HLAR (%) Total No. of MDR (%) No. of HLAR (%) a b
Ⅰ
Ⅱ
Ⅲ
Ⅳ
Ⅴ
Ⅵ
Ⅶ
Total
100 34 (34.0) 9 (9.0) 4 4 (100.0) 0 (0.0) 104 38 (36.5) 9 (8.7)
70 23 (32.9) 3 (4.3) –b – – 70 23 (32.9) 3 (4.3)
54 28 (51.9) 8 (14.8) 3 1 (33.3) 0 (0.0) 57 29 (50.9) 8 (14.0)
51 20 (39.2) 5 (9.8) 2 1 (50.0) 1 (50.0) 53 21 (39.6) 6 (11.3)
21 7 (33.3) 1 (4.8) – – – 21 7 (33.3) 1 (4.8)
18 10 (55.6) 0 (0.0) 1 0 (0.0) 0 (0.0) 19 10 (52.6) 0 (0.0)
21 8 (38.1) 2 (9.5) – – – 21 8 (38.1) 2 (9.5)
335 130 (38.8) 28 (8.4) 10 6 (60.0) 1 (10.0) 345 136 (39.4) 29 (8.7)
MDR, multidrug-resistance; HLAR, high-level aminoglycoside resistance. -, Not detected.
Distribution of High-Level Aminoglycoside Resistance in Enterococci A total of 29 (8.7%) isolates, including 28 E. faecalis and one E. faecium strain, showed HLAR, as shown in Table 2. A higher prevalence of HLAR in enterococci isolates was observed from operation Ⅲ (14.0%, 8 of 57 isolates), and HLAR was not detected from operation Ⅳ.
Phenotypes, Genotypes, and Virulence Genes of High-Level Aminoglycoside Resistance in Enterococci The characteristics of the 29 HLAR in enterococci are shown in Table 3. All HLAR in enterococci carried at least 1 of 2 AME genes, aac(6ʹ)Ie-aph(2 )-Ia and ant(6)-Ia. Especially, 13 isolates showed high-level resistance to gentamicin and kanamycin and harbored
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
mef
Size (bp)
4
KIM ET AL.
aac(6ʹ)Ie-aph(2 )-Ia gene, 3 of isolates had pattern A, with IS256 at both ends, and the other 10 isolates had pattern D, without IS256 at both ends. All HLAR in enterococci were also MDR, and the most common resistance pattern included resistance to ciprofloxacin, erythromycin, and tetracycline. Among 24 erythromycin-resistant enterococci, 19 (79.2%) harbored ermB and 1 (4.2%) harbored both ermB and ermA. All 21 enterococci showed tetracycline-resistance, and they harbored 1 or more of the tetracycline resistance genes, tet(M), tet(L), and tet(O). The Int-Tn gene was detected in one isolate (3.4%) carrying the tet(M) and ermB genes. All 4 chloramphenicol-resistant isolates carried phenicol resistant genes; 1 isolate harbored cfr only, 1 isolate harbored both cfr and fexA, and 2 isolates harbored both fexA and optrA. All 4 efflux pump genes, efr(A), efr(B), emeA, and lsa, were detected in all HLAR E. faecalis isolate; the tndX gene, which is related to a transposon, was not detected in any HLAR in enterococci isolate. All HLAR isolates possessed at least 1 of the following 4 virulence genes, ace (86.2%), gelE (82.8%), efaA (79.3%), and asa1 (65.5%). Two isolates were positive for cylA. However, the esp and hyl genes were not detected in any HLAR in enterococci isolate.
DISCUSSION Enterococci are normal commensals in poultry and other domestic animals. However, enterococci may be transmitted to humans through the handling and consumption of contaminated retail chicken meat (Aslam et al., 2012; Choi et al., 2014). Importantly, zoonotic transmission of enterococci from food animal may be
related to antimicrobial resistance(Mannu et al., 2003; Yılmaz et al., 2016). Previous studies have suggested that a high proportion of enterococci in poultry meats are resistance to multiple antimicrobials (Aslam et al., 2012; DonadoGodoy et al., 2015; Kilonzo-Nthenge et al., 2015). In this study, 34.9% of the 345 enterococci isolates showed resistance to 3 or more antimicrobial classes, and 2 of the 7 broiler operations showed a high proportion (≥50%) of MDR isolates. The difference in the resistance patterns at the various operations may reflect their antimicrobial usage during poultry production (Tyson et al., 2018; Kim et al., 2018c). This suggests that tracking and management of what and how antimicrobials are being used and misused by operations is the most important factor for reduction the incidence of resistant pathogens in poultry production. Although enterococci are intrinsically resistant to penicillins, cephalosporins, and low levels of clindamycin and aminoglycosides, some HLAR in enterococci acquired resistance to chloramphenicol, erythromycin, and high-levels of clindamycin, tetracycline, penicillin, fluoroquinolones, and vancomycin due to the release of various AME (Mendiratta et al., 2008). The presence of AME genes in those isolates implies that neither streptomycin nor gentamicin can be synergistically used with a glycopeptide or beta-lactam for the treatment of enterococcal infections (Udo et al., 2004). Aac(6’)Ie-aph(2 )-Ia and ant(6)-Ia are the most commonly detected genes in high-level gentamicin-resistant enterococci and high-level streptomycin-resistant enterococci, respectively (Chow, 2000). In this study, the aac(6’)Ie-aph(2 )-Ia gene was detected in all 13 isolates with a gentamicin MIC >2048 μg/mL, and the ant(6)-Ia gene was detected in 21 isolates with a
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
Figure 1. Distribution of multidrug resistance of 136 enterococci isolated from 7 integrated broiler operations.
–
– – D
– A D
D
D
D
– – – D
D
Ⅲ
Ⅳ Ⅰ Ⅰ
Ⅶ Ⅶ Ⅲ
Ⅱ
Ⅲ
Ⅲ
Ⅰ Ⅲ Ⅴ Ⅰ
Ⅰ
Ⅳ
EFS 84–1
EFS 90–1 EFS 98–1 EFS 120–1
EFS 122–1 EFS 124–1 EFS 125–1
EFS 131–2
EFS 133–2
EFS 135–1
140–1 146–2 154–1 171–2
EFS EFS EFS EFS
EFS 174–2
E. faecium EFM 1–2
CIP-TE-P
CIP-E
DOX-E-TE DOX-E-TE CIP- DOX-E-TE C-CIP-DOX-E-TE
CIP-E
CIP-E-TE
CIP-E
CIP-TE CIP-DOX-TE CIP-E
CIP-DOX-E-TE DOX-E-TE C-E
C-CIP-DOX-E-TE
CIP-E CIP-TE-RA DOX-E-TE CIP-E
AM-C-CIP-DOX-E-P-TE CIP-DOX-E-TE DOX-E-TE C-CIP-DOX-E-TE DOX-E-TE CIP-DOX-TE CIP-E-TE E-TE CIP-E
Phenotypea
tet(L), tet(M)
ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), fexA, optrA, efr(A), efr(B), emeA, lsa efr(A), efr(B), emeA, lsa
ermB, efr(A), efr(B), emeA, lsa
ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa
ermB, efr(A), efr(B), emeA, lsa
tet(O), efr(A), efr(B), emeA, lsa tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, efr(A), efr(B), emeA, lsa
ermB, tet(L), tet(M), Int-Tn, cfr, fexA, efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermA, ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, fexA, optrA, efr(A), efr(B), emeA, lsa
ermB, efr(A), efr(B), emeA, lsa tet(M), efr(A), efr(B), emeA, lsa tet(L), tet(M), efr(A), efr(B), emeA, lsa efr(A), efr(B), emeA, lsa
ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), tet(O), efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), cfr, efr(A), efr(B), emeA, lsa ermB, tet(L), tet(M), efr(A), efr(B), emeA, lsa tet(L), tet(M), efr(A), efr(B), emeA, lsa ermB, tet(M), efr(A), efr(B), emeA, lsa tet(M), efr(A), efr(B), emeA, lsa ermB, efr(A), efr(B), emeA, lsa
Genotype
AM, ampicillin; C, chloramphenicol; CIP, ciprofloxacin; DOX, doxycycline; E, erythromycin; P, penicillin; TE, tetracycline; RA, rifampin. G, gentamicin; S, streptomycin; K, kanamycin. -, Not applicant.
C
b
aac(6’)Ie-aph(2 )-la
ant(6)-Ia ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia ant(6)-Ia aac(6’)Ie-aph(2 )-la aac(6’)Ie-aph(2 )-la, ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia ant(6)-Ia ant(6)-Ia ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia
ant(6)-Ia ant(6)-Ia ant(6)-Ia ant(6)-Ia ant(6)-Ia aac(6’)Ie-aph(2 )-la ant(6)-Ia ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia ant(6)-Ia aac(6’)Ie-aph(2 )-la ant(6)-Ia aac(6’)Ie-aph(2 )-la, ant(6)-Ia ant(6)-Ia
AME gene
Other resistance
efaA, gelE efaA, efaA, gelE asa1, gelE
ace, efaA
ace, asa1, efaA, gelE
ace, asa1, efaA, gelE asa1, gelE ace, asa1, efaA, gelE ace, efaA
ace, asa1, efaA, gelE
ace, asa1, efaA, gelE
ace, asa1, efaA, gelE
asa1 ace, asa1, efaA, gelE ace, asa1, efaA, gelE
ace, asa1, efaA, gelE ace, asa1, cylA, efaA, gelE asa1, gelE
ace, efaA,
ace, ace, ace, ace,
ace, asa1, cylA, gelE ace, asa1, efaA, gelE ace, asa1, efaA, gelE ace, efaA, gelE ace, asa1, efaA, gelE ace, efaA, gelE gelE ace, asa1, efaA, gelE ace, efaA, gelE
Virulence factor
>2048 >2048 >2048 >2048 >2048 <256 >2048 >2048
<256 <256 <256 <256 <256 >2048 >2048 <256 >2048
2048 >2048 >2048 >2048 >2048 >2048
2048 <256 >2048 >2048 <256 >2048 >2048 >2048 >2048 <256
<256
>2048 >2048 <256 >2048 <256 <256 <256 >2048 <256 >2048 >2048 >2048 >2048 >2048 <256 <256 <256 >2048 >2048
>2048
<256 <256 >2048
2048
S
>2048
>2048
>2048 >2048 >2048 >2048
>2048
>2048
>2048
<256 >2048 >2048
>2048 >2048 >2048
>2048
>2048 >2048 >2048 >2048
>2048 >2048 >2048 >2048 >2048 >2048 >2048 >2048 >2048
k
MIC (μg/mL)b G
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
a
– A – D
Ⅲ Ⅳ Ⅳ Ⅲ
67–1 77–2 79–2 83–2
EFS EFS EFS EFS
D
-c – – – – A – – D
Ⅰ Ⅰ Ⅳ Ⅱ Ⅲ Ⅱ Ⅰ Ⅰ Ⅳ
IS256flanking pattern
E. faecalis EFS 18–1 EFS 18–2 EFS 25–2 EFS 30–1 EFS 35–1 EFS 38–1 EFS 46–1 EFS 51–1 EFS 57–1
Strain
Integrated broiler operation
Table 3. Characteristics of high-level aminoglycoside resistant 28 Enterococcus faecalis and 1 Enterococcus faecium from retail chicken meat.
HIGH-LEVEL AMINOGLYCOSIDE RESISTANT ENTEROCOCCI
5
6
KIM ET AL.
Although the presence of HLAR in enterococci in chicken meat in Korea may not be important for the poultry industry, monitoring of HLAR in enterococci is needed because it may contribute to the evolution and spread of these strains and resistance-conferring genes to humans. Determination of the molecular characteristics of isolates from non-hospital sources, especially poultry, will also help to define the transmission dynamics of HLAR in enterococci from non-hospital source to humans.
ACKNOWLEDGMENTS This work was supported by Korea Institute of Planning and Evaluation for Technology in Food, Agriculture, Forestry and Fisheries (IPET) through Agriculture, Food and Rural Affairs Research Center Support Program, funded by Ministry of Agriculture, Food and Rural Affairs (MAFRA) (716002–7).
REFERENCES Adhikari, L. 2010. High-level aminoglycoside resistance and reduced susceptibility to vancomycin in nosocomial enterococci. J. Global Infect. Dis. 2:231–235. Agarwal, J., R. Kalyan, and M. Singh. 2009. High-level aminoglycoside resistance and beta-lactamase production in enterococci at a tertiary care hospital in India. Jpn. J. Infect. Dis. 62:158–159. Animal and Plant Quarantine Agency (APQA), 2017. Antimicrobial use and monitoring in animals and animal products. APQA, gimcheon, Republic of Korea. Aslam, M., M. S. Diarra, S. Checkley, V. Bohaychuk, and L. Masson. 2012. Characterization of antimicrobial resistance and virulence genes in Enterococcus spp. isolated from retail meats in Alberta, Canada, Int. J. Food Microbiol. 156:222–230. Cauwerts, K., A. Decostere, E. M. De Graef, F. Haesebrouck, and F. Pasmans. 2007. High prevalence of tetracycline resistance in Enterococcus isolates from broilers carrying the erm(B) gene. Avian Pathol. 36:395–399. Chaj˛ ecka-Wierzchowska, W., A. Zadernowska, U. Zarzecka, A. Zakrzewski, and J. Gajewska. 2019. Enterococci from ready-toeat food - horizontal gene transfer of antibiotic resistance genes and genotypic characterization by PCR melting profile. J. Sci. Food Agric. 99:1172–1179. Choi, J. M., and G. J. Woo. 2013. Molecular characterization of highlevel gentamicin-resistant Enterococcus faecalis from chicken meat in Korea. Int. J. Food Microbiol. 165:1–6. Choi, J. M., and G. J. Woo. 2015. Transfer of tetracycline resistance genes with aggregation substance in food-borne Enterococcus faecalis. Curr. Microbiol. 70:476–484. Choi, M. K., and S. S. Choi. 2017. Analysis of antimicrobial resistance pattern and distribution of multi-drug efflux pump genes and virulence genes in Enterococcus faecalis isolated from retail meat in Seoul. J. Fd Hyg. Safety. 32:135–140. Choi, S. W., J. S. Ha, B. Y. Kim, D. H. Lee, J. K. Park, H. N. Youn, Y. H. Hong, S. B. Lee, J. B. Lee, S. Y. Park, I. S. Choi, and C. S. Song. 2014. Prevalence and characterization of Salmonella species in entire steps of a single integrated broiler supply chain in Korea. Poult. Sci. 93:1251–1257. Chow, J. W. 2000. Aminoglycoside resistance in enterococci. Clin Infect Dis. 31:586–589. Clark, N. C., Ø. Olsvik, J. M. Swenson, C. A. Spiegel, and F. C. Tenover. 1999. Detection of a streptomycin/spectinomycin adenylyltransferase gene (aadA) in Enterococcus faecalis. Antimicrob. Agents Chemother. 43:157–160. Clinical and Laboratory Standards Institute (CLSI), 2013. Performance Standards for Antimicrobial Susceptibility Testing, M100S23. Clinical and Laboratory Standards Institute, Wayne, PA.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
streptomycin MIC ≥2048 μg/mL. For the Tn5281like elements, the 2 representative IS256-flanking patterns, A and D, detected in the present study were previously detected in clinical isolates of enterococci (Simjee et al., 1999; Klibi et al., 2006), and the pattern D was predominant among HLAR in enterococci harboring the aac(6’)Ie-aph(2 )-Ia gene. Pattern A, with IS256 at both ends, was the most frequent pattern detected in the 1990s; however, in recent reports, pattern C, which lacks IS256 at the 5ʹ-end, and pattern D, which lacks IS256 at both ends, are predominant (Leelaporn et al., 2008; Zhang et al., 2018). Our results suggested that plasmid or transposons harboring aac(6ʹ)Ie-aph(2 )-Ia with IS256-flanking pattern D may be predominant in the poultry industry in Korea, although no evidence for an association was found between IS256-flanking pattern and resistance to aminoglycosides, or the presence of virulence determinant genes (Watanabe et al., 2009). In this study, the most common tetracycline and erythromycin resistance genes identified in the resistant strains were tet(L), tet(M), and ermB, which was in agreement with previous studies of isolated from chicken meat (Cauwerts et al., 2007; Diarra et al., 2010; Choi and Woo, 2015). Cauwerts et al. (2007) reported that transposons associated with tet(M) and ermB in enterococci can be easily transferred. In addition, the optrA gene, which encodes an ATP-binding cassette transporter and confers transferable resistance to fluorinated and non-fluorinated phenicols (Wang et al., 2015), and the cfr gene, which confers resistance to 5 chemically unrelated antimicrobial classes including phenicols, were also detected in this study. The emergence of optrA and cfr in enterococci from food animals is a serious concern as they could be transmitted to human via the food chain, and the spread of these genes could significantly limit treatment options for MDR bacteria (Liu et al., 2012; Tamang et al., 2017). Regarding the multidrug efflux pump genes efr(A), efr(B), emeA, and lsa (Lee et al., 2003; Sánchez Valenzuela et al., 2013), 100% of the HLAR E. faecalis strains in this study possessed these genes, whereas the E. faecium strains did not. Multidrug efflux pumps also contribute to the growing problem of antimicrobial resistance in bacteria (Schindler and Kaatz, 2016). Multidrug efflux pumps have emerged as elements relevant to the intrinsic and acquired antimicrobial resistance of bacterial pathogens (Martinez et al., 2009). A number of virulence factors have been described in enterococci (McGowan-Spicer et al., 2008; Diarra et al., 2010), and in this study, the ace, efaA, gelE, and asa1 genes were the most prevalent in HLAR in enterococci, as was reported previously (McGowan-Spicer et al., 2008; Han et al., 2011; Yılmaz et al., 2016). The high prevalence of the gelE gene in isolates from readyto-eat food is considered to be a food safety risk because the gelE gene is associated with human infection (Guerrero-Ramos et al., 2016; Chaj˛ ecka-Wierzchowska et al., 2018).
HIGH-LEVEL AMINOGLYCOSIDE RESISTANT ENTEROCOCCI
Kwon, K. H., S. Y. Hwang, B. Y. Moon, Y. K. Park, S. Shin, C. Y. Hwang, and Y. H. Park. 2012. Occurrence of antimicrobial resistance and virulence genes, and distribution of enterococcal clonal complex 17 from animals and human beings in Korea. J. VET Diagn. Invest. 24:924–931. Lee, E. W., M. N. Huda, T. Kuroda, T. Mizushima, and T. Tsuchiya. 2003. EfrAB, an ABC multidrug efflux pump in Enterococcus faecalis. Antimicrob. Agents Chemother. 47:3733–3738. Leelaporn, A., K. Yodkamol, D. Waywa, and S. Pattanachaiwit. 2008. A novel structure of Tn4001-truncated element, type V, in clinical enterococcal isolates and multiplex PCR for detecting aminoglycoside resistance genes. Int. J. Antimicrob. Agents. 31:250–254. Liljebjelke, K. A., C. L. Hofacre, D. G. White, S. Ayers, M. D. Lee, and J. J. Maurer. 2017. Diversity of antimicrobial resistance phenotypes in Salmonella isolated from commercial poultry farms. Front. Vet. Sci. 96:1–9. Liu, Y., Y. Wang, C. Wu, Z. Shen, S. Schwarz, X. D. Du, L. Dai, W. Zhang, Q. Zhang, and J. Shen. 2012. First report of the multidrug resistance gene cfr in Enterococcus faecalis of animal origin. Antimicrob. Agents Chemother. 56:1650–1654. Mannu, L., A. Paba, E. Daga, R. Comunian, S. Zanetti, I. Duprè, and L. A. Sechi. 2003. Comparison of the incidence of virulence determinants and antibiotic resistance between Enterococcus faecium strains of dairy, animal and clinical origin. Int. J. Food Microbiol. 88:291–304. Martinez, J. L., M. B. Sánchez, L. Martínez-Solano, A. Hernandez, L. Garmendia, A. Fajardo, and C. Alvarez-Ortega. 2009. Functional role of bacterial multidrug efflux pumps in microbial natural ecosystems. FEMS Microbiol. Rev. 33:430–449. Mcgowan-Spicer, L. L., P. J. Fedorka-Cray, J. G. Frye, R. J. Meinersmann, J. B. Barrett, and C. R. Jackson. 2008. Antimicrobial resistance and virulence of Enterococcus faecalis isolated from retail food. J. Food Prot. 71:760–769. Mendiratta, D. K., H. Kaur, V. Deotale, D. C. Thamke, R. Narang, and P. Narang. 2008. Status of high level aminoglycoside resistant Enterococcus faecium and Enterococcus faecalis in a rural hospital of Central India. Indian J. Med. Microbiol. 26:369–371. Mittal, S., P. Singla, A. Deep, K. Bala, R. Sikka, M. Garg, and U. Chaudhary. 2016. Vancomycin and high level aminoglycoside resistance in Enterococcus spp. in a tertiary health care centre: a therapeutic concern. J. Pathogens. 2016:1–5. Murray, P. R., E. J. Baron, J. H. Jorgenson, M. A. Pfaller, and R. H. Yolken. 2003. Manual of Clinical Microbiology, 8th edition. Washinton DC. Sánchez Valenzuela, A., L. Lavilla Lerma, N. Benomar, A. Gálvez, R. Pérez Pulido, and H. Abriouel. 2013. phenotypic and molecular antibiotic resistance profile of Enterococcus faecalis and Enterococcus faecium isolated from different traditional fermented foods. Foodborne Pathog. Dis. 10:143–149. Schindler, B. D., and G. W. Kaatz. 2016. Multidrug efflux pumps of gram-positive bacteria. Drug Resist. Updat. 27:1–13. Simjee, S., A. P. Fraise, and M. J. Gill. 1999. Plasmid heterogeneity and identification of a Tn5281-like element in clinical isolates of high-level gentamicin-resistant Enterococcus faecium isolated in the UK. J. Antimicrob. Chemother. 43:625–635. Société Française de Microbiologie (SFM), 2011. Comité de l’Antibiogramme de la Société Française de Microbiologie. Biologiques, Paris. Tamang, M. D., D. C. Moon, S. R. Kim, H. Y. Kang, K. Lee, H. M. Nam, G. C. Jang, H. S. Lee, S. C. Jung, and S. K. Lim. 2017. Detection of novel oxazolidinone and phenicol resistance gene optrA in enterococcal isolates from food animals and animal carcasses. Vet Microbiol. 201:252–256. Tyson, G. H., E. Nyirabahizi, E. Crarey, C. Kabera, C. Lam, C. RiceTrujillo, P. F. McDermott, and H. Tate. 2018. Prevalence and antimicrobial resistance of enterococci isolated from retail meats in the united states, 2002 to 2014. Appl. Environ. Microbiol. 84: 1–9. Udo, E. E., N. Al-Sweih, P. John, L. E. Jacob, and S. Mohanakrishnan. 2004. Characterization of high-level aminoglycoside-resistant enterococci in Kuwait hospitals. Microb. Drug Resist. 10:139– 145.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
Di Cesare, A., G. M. Luna, C. Vignaroli, S. Pasquaroli, S. Tota, P. Paroncini, and F. Biavasco. 2013. Aquaculture can promote the presence and spread of antibiotic-resistant Enterococci in marine sediments. PLoS One. 8:e62838. Diarra, M. S., H. Rempel, J. Champagne, L. Masson, J. Pritchard, and E. Topp. 2010. Distribution of antimicrobial resistance and virulence genes in Enterococcus spp. and characterization of isolates from broiler chickens. Appl. Environ. Microbiol. 76:8033– 8043. Donado-Godoy, P., B. A. Byrne, M. León, R. Castellanos, C. Vanegas, A. Coral, A. Arevalo, V. Clavijo, M. Vargas, J. J. Romero Zuñiga, M. Tafur, E. Pérez-Gutierrez, and W. A. Smith. 2015. Prevalence, resistance patterns, and risk factors for antimicrobial resistance in bacteria from retail chicken meat in Colombia. J. Food Prot. 78:751–759. European Medicines Agency (EMA). 2016. Updated advice on the use of colistin products in animals within the European Union: development of resistance and possible impact on human and animal health. Accessed Jun. 2016. https://www.ema.europa.eu/ documents/scientific-guideline/updated-advice-use-colistin-pro ducts-animals-within-european-union-development-resistancepossible_en.pdf. Guerrero-Ramos, E., J. Cordero, D. Molina-González, P. Poeta, G. Igrejas, C. Alonso-Calleja, and R. Capita. 2016. Antimicrobial resistance and virulence genes in enterococci from wild game meat in Spain. Food Microbiol. 53:156–164. Han, D. K., T. Unno, J. H. Jang, K. T. Lim, S. N. Lee, G. P. Ko, M. J. Sadowsky, and H. G. Hur. 2011. The occurrence of virulence traits among high-level aminoglycosides resistant Enterococcus isolates obtained from feces of humans, animals, and birds in South Korea. Int. J. Food Microbiol. 144:387–392. Hayes, J. R., L. L. English, P. J. Carter, T. Proescholdt, K. Y. Lee, D. D. Wagner, G. David, T. Proescholdt, and D. G. White. 2003. prevalence and antimicrobial resistance of Enterococcus species isolated from retail meats prevalence and antimicrobial resistance of Enterococcus species isolated from retail meats. Appl. Environ. Microbiol. 69:7153–7160. Kawalec, M., Z. Pietras, E. Daniłowicz, A. Jakubczak, M. Gniadkowski, W. Hryniewicz, and R. J. L. Willems. 2007. Clonal structure of Enterococcus faecalis isolated from Polish hospitals: characterization of epidemic clones. J Clin Microbiol. 45:147–153. Kehrenberg, C., and S. Schwarz. 2006. Distribution of florfenicol resistance genes fexA and cfr among chloramphenicol-resistant Staphylococcus isolates. Antimicrob. Agents Chemother. 50:1156– 1163. Kilonzo-Nthenge, A., A. Brown, S. N. Nahashon, and D. Long. 2015. Occurrence and antimicrobial resistance of enterococci isolated from organic and conventional retail chicken. J. Food Prot. 78:760–766. Kim, Y. B., H. J. Seo, K. W. Seo, H. Y. Jeon, D. K. Kim, S. W. Kim, S.-K. Lim, and Y. J. Lee. 2018. Characteristics of Highlevel ciprofloxacin-resistant Enterococcus faecalis and Enterococcus faecium from retail chicken meat in Korea. J. Food Prot. 81:1357–1363. Kim, Y. B., K. W. Seo, H. Y. Jeon, S. K. Lim, and Y. J. Lee. 2018. Characteristics of the antimicrobial resistance of Staphylococcus aureus isolated from chicken meat produced by different integrated broiler operations in Korea. Poult. Sci. 97:962–969. Kim, Y. J., J. H. Park, and K. H. Seo. 2018. Comparison of the loads and antibiotic-resistance profiles of Enterococcus species from conventional and organic chicken carcasses in South Korea. Poult. Sci. 97:271–278. Klibi, N., K. Ben Slama, A. Masmoudi, S. Gharbi, F. Ruiz-Larrea, C. Fendri, A. Boudabous, and C. Torres. 2006. Diversity of structures carrying the aac(6 )-aph(2 ;) gene in clinical Enterococcus faecalis and Enterococcus faecium strains isolated in Tunisia. J Chemother. 18:353–359. Korea Institute for Animal Products Quality Evaluation (KAPE). 2015. Research on the actual conditions of livestock distribution system 2015. Bundang, Republic of Korea Krause, K. M., A. W. Serio, T. R. Kane, and L. E. Connolly. 2016. Aminoglycosides: an overview. Cold spring harb. Perspect. Med. 6:1–19.
7
8
KIM ET AL. Watanabe, S., N. Kobayashi, D. Quiñones, S. Nagashima, N. Uehara, and N. Watanabe. 2009. Genetic diversity of enterococci harboring the high-level gentamicin resistance gene aac(6’)-Ieaph(2’’)-Ia or aph(2’’)-Ie in a Japanese hospital. Microb. Drug Resist. 15:185–194. Yılmaz, E. S ¸ ., Ö. Aslanta¸s, S. P. Önen, S. Türkyılmaz, and C. Kürekci. 2016. Prevalence, antimicrobial resistance and virulence traits in enterococci from food of animal origin in Turkey. LWT - Food Sci. Technol. 66:20–26. Zhang, J.-M., Q. Wang, T.-Y. Han, J.-H. Liu, X.-X. Hu, F. Qiao, X.-Y. Yang, C.-R. Li, and X.-F. You. 2018. Structure analysis of transposons carrying aac(6’)-aph(2’’) gene in Enterococcus faecalis isolated in Beijing China and comparison of their transfer efficiency. Int. J. Antimicrob. Agents. 52:799– 804.
Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pez403/5531586 by Nottingham Trent University user on 18 July 2019
Vakulenko, S. B., S. M. Donabedian, M. Anatoliy, M. J. Zervos, S. A. Lerner, J. W. Chow, and A. M. Voskresenskiy. 2003. Multiplex pcr for detection of aminoglycoside resistance genes in enterococci. Antimicrob. Agents Chemother. 47:1423–1426. van den Boaard, A.E., R. Willems, N. London, J. Top, and E. E. Stobberingh. 2002. Antibiotic resistance of faecal enterococci in poultry, poultry farmers and poultry slaughterers. J. Antimicrob. Chemother. 49:497–505. Wang, Y., Y. Lv, J. Cai, S. Schwarz, L. Cui, Z. Hu, R. Zhang, J. Li, Q. Zhao, T. He, D. Wang, Z. Wang, Y. Shen, Y. Li, A. T. Feßler, C. Wu, H. Yu, X. Deng, X. Xia, and J. Shen. 2015. A novel gene, optrA, that confers transferable resistance to oxazolidinones and phenicols and its presence in Enterococcus faecalis and Enterococcus faecium of human and animal origin. J. Antimicrob. Chemother. 70:2182–2190.